Primers for real-time fluorescent recombinase polymerase isothermal amplification and their applications and products

Abstract

The present invention provides a primer for real-time fluorescent recombinase polymerase isothermal amplification and its application and product, which relate to the field of biotechnology. The primer for real-time fluorescent recombinase polymerase isothermal amplification provided by the present invention comprises an upstream primer and a downstream primer; the upstream primer is composed of a long-chain oligonucleotide and a short-chain oligonucleotide; the 5' end of the long-chain oligonucleotide is connected to a fluorescent group, the 3' end of the short-chain oligonucleotide is connected to a quenching group, the 5' end of the long-chain oligonucleotide is complementary to the 3' end of the short-chain oligonucleotide, and the 3' end of the long-chain oligonucleotide is complementary to the target gene. The primer has a simple design and low synthesis cost. It is used in real-time fluorescent recombinase polymerase isothermal amplification, has the characteristics of high detection sensitivity, strong specificity, short reaction time, low detection equipment requirements, and is independent of exo enzyme activity.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, and in particular to a primer used for real-time fluorescent recombinase polymerase isothermal amplification and an application and product thereof. Background Art

[0002] In vitro nucleic acid amplification technology is one of the most commonly used technologies in life science research. Polymerase chain reaction (PCR) was invented in 1983 and has become the most widely used nucleic acid amplification technology. This technology has strong specificity and high sensitivity, but it requires expensive temperature cyclers and is difficult to promote to on-site testing.

[0003] In recent years, with the continuous development of molecular biology technology, the emergence of constant temperature nucleic acid amplification technology has solved the instrumental limitations of PCR technology. This technology does not require temperature cycling and reacts more quickly, making it very suitable for on-site testing in resource-limited areas. There are more than a dozen constant temperature amplification technologies that have been reported. Recombinase polymerase amplification (RPA) is a new constant temperature amplification technology involving recombinase, single-stranded DNA binding protein and strand displacement Bsu polymerase. It can react continuously at 23-45°C, with a reaction time of only 5-20 minutes. It has strong specificity and high sensitivity, making it very suitable for disease diagnosis and on-site testing.

[0004] Compared with the RPA basic reaction system, real-time fluorescence quantitative RPA achieves real-time monitoring of template amplification by adding an exonuclease III (exo) and an exo fluorescent probe (named exo probe according to the name of the enzyme). The exo fluorescent probe has an abasic site analog - a tetrahydrofuran (THF) site, and a fluorescent group and a quenching group are labeled on the thymine on both sides of the site, respectively. At this time, the fluorescence intensity is very low. When the probe binds to the target sequence, the THF site will be recognized and enzymatically hydrolyzed by the exonuclease III, separating the fluorescent group from the quenching group, and enhancing the fluorescence intensity of the fluorescent group, thereby achieving real-time monitoring of the template amplification process.

[0005] However, the above-mentioned probes still have many defects. For example, the probes are too long to detect short-sequence nucleic acids; the cost of probe synthesis is high; and exo enzymes need to be added, which increases the cost of reagents.

[0006] In view of this, the present invention is proposed. Summary of the invention

[0007] The first object of the present invention is to provide a primer for real-time fluorescent recombinase polymerase isothermal amplification to solve at least one of the above problems.

[0008] The second purpose of the present invention is to provide the use of the above primers in the preparation of nucleic acid detection products.

[0009] The third object of the present invention is to provide a nucleic acid detection kit.

[0010] The fourth object of the present invention is to provide a nucleic acid detection method for purposes other than disease diagnosis or treatment.

[0011] The fifth object of the present invention is to provide a primer for detecting Helicobacter pylori.

[0012] The sixth object of the present invention is to provide the use of the above primers for detecting Helicobacter pylori in the preparation of products for detecting Helicobacter pylori.

[0013] The seventh object of the present invention is to provide a kit for detecting Helicobacter pylori.

[0014] In a first aspect, the present invention provides a primer for real-time fluorescent recombinase polymerase isothermal amplification, comprising an upstream primer and a downstream primer;

[0015] The upstream primer is composed of a long-chain oligonucleotide and a short-chain oligonucleotide;

[0016] The 5' end of the long-chain oligonucleotide is connected to a fluorescent group, the 3' end of the short-chain oligonucleotide is connected to a quenching group, the 5' end of the long-chain oligonucleotide is complementary hybridized with the 3' end of the short-chain oligonucleotide, and the 3' end of the long-chain oligonucleotide is complementary hybridized with the target gene.

[0017] As a further technical solution, the long-chain oligonucleotide consists of 40-60 nucleotides, wherein the length complementary to the short-chain oligonucleotide is 10-30 nucleotides, and the length complementary to the target gene is 30-35 nucleotides;

[0018] The short-chain oligonucleotide consists of 10-30 nucleotides;

[0019] Preferably, the downstream primer consists of 30-35 nucleotides.

[0020] As a further technical solution, the fluorescent group includes FAM, HEX, TET, ROX, CY3, CY5, VIC, JOE, SIMA, Alexa Fluor 488, TexasRed or Quasar 670;

[0021] The quenching group includes TAMRA, Dabcyl, BHQ-1, BHQ-2, BHQ-3, MGB or Eclipse.

[0022] In a second aspect, the present invention provides the use of the above-mentioned primers in the preparation of nucleic acid detection products.

[0023] In a third aspect, the present invention provides a nucleic acid detection kit comprising the above-mentioned primers.

[0024] As a further technical solution, the molar ratio of the long-chain oligonucleotide to the short-chain oligonucleotide is 1:1 to 1:3, preferably 1:2.

[0025] In a fourth aspect, the present invention provides a method for detecting nucleic acids for purposes other than disease diagnosis or treatment, using the above-mentioned primers to amplify the nucleic acid to be tested by a recombinase polymerase isothermal amplification method to achieve detection of the nucleic acid to be tested.

[0026] In a fifth aspect, the present invention provides a primer for detecting Helicobacter pylori, comprising an upstream primer and a downstream primer;

[0027] The upstream primer is composed of a long-chain oligonucleotide and a short-chain oligonucleotide;

[0028] The 5' end of the long-chain oligonucleotide is connected to a fluorescent group, the 3' end of the short-chain oligonucleotide is connected to a quenching group, and the 5' end of the long-chain oligonucleotide is complementary to the 3' end of the short-chain oligonucleotide;

[0029] The sequence of the long-chain oligonucleotide is shown in SEQ ID NO.1;

[0030] The sequence of the short-chain oligonucleotide is shown in SEQ ID NO.2;

[0031] The sequence of the downstream primer is shown in SEQ ID NO.3.

[0032] In a sixth aspect, the present invention provides use of the above-mentioned primers for detecting Helicobacter pylori in preparing a product for detecting Helicobacter pylori.

[0033] In a seventh aspect, the present invention provides a kit for detecting Helicobacter pylori, comprising the above-mentioned primers for detecting Helicobacter pylori.

[0034] Compared with the prior art, the present invention has the following beneficial effects:

[0035] The primers for real-time fluorescent recombinase polymerase isothermal amplification provided by the present invention are simple in design and low in synthesis cost. They are used in recombinase polymerase isothermal amplification and have the characteristics of high detection sensitivity, strong specificity, short reaction time, low detection equipment requirements, and are independent of Exo enzyme activity.

[0036] The primers for detecting Helicobacter pylori provided by the present invention have low synthesis cost, high sensitivity and strong specificity, and can be used for the diagnosis of Helicobacter pylori related diseases. BRIEF DESCRIPTION OF THE DRAWINGS

[0037] In order to more clearly illustrate the specific implementation methods of the present invention or the technical solutions in the prior art, the drawings required for use in the specific implementation methods or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are some implementation methods of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0038] Figure 1 This is a schematic diagram of the real-time fluorescence RPA isothermal amplification principle of the primers of the present invention;

[0039] Figure 2 The results of detecting Helicobacter pylori (HP) DNA using the primer-optimized real-time fluorescence RPA constant temperature amplification system of the present invention;

[0040] Figure 3 The sensitivity results of the real-time fluorescence RPA-HP isothermal amplification system of the primers of the present invention for detecting HP DNA;

[0041] Figure 4 It is the specific result of the real-time fluorescence RPA-HP constant temperature amplification system of the primers of the present invention;

[0042] Figure 5 To compare the results of HP DNA detection by the present invention and the real-time fluorescent probe method RPA. DETAILED DESCRIPTION

[0043] The embodiments of the present invention will be described in detail below in conjunction with the embodiments and examples, but it will be appreciated by those skilled in the art that the following embodiments and examples are only used to illustrate the present invention and should not be considered as limiting the scope of the present invention. Based on the embodiments in the present invention, all other embodiments obtained by those of ordinary skill in the art without making creative work are within the scope of protection of the present invention. If specific conditions are not specified, proceed according to normal conditions or conditions recommended by the manufacturer. If the manufacturer is not specified for the reagents or instruments used, they are all conventional products that can be purchased commercially.

[0044] In a first aspect, the present invention provides a primer for real-time fluorescent recombinase polymerase isothermal amplification, comprising an upstream primer and a downstream primer;

[0045] The upstream primer is composed of a long-chain oligonucleotide and a short-chain oligonucleotide;

[0046] The 5' end of the long-chain oligonucleotide is connected to a fluorescent group, the 3' end of the short-chain oligonucleotide is connected to a quenching group, the 5' end of the long-chain oligonucleotide is complementary hybridized with the 3' end of the short-chain oligonucleotide, and the 3' end of the long-chain oligonucleotide is complementary hybridized with the target gene.

[0047] The amplification detection principle of the primers of the present invention is as follows:

[0048] like Figure 1 As shown. First, two oligonucleotide chains of different lengths with complementary sequences are synthesized, wherein the 5' end of the long-chain oligonucleotide is connected to a fluorescent group, and the 3' end of the long-chain oligonucleotide is connected to a quenching group. The two chains are hybridized by high-temperature denaturation, and the quenching group can quench the fluorescent group, and no fluorescence is generated; when the gene to be tested exists in the RPA reaction system, the upstream long oligonucleotide chain and the downstream common primer are complementary hybridized and extended with the gene to be tested, and the downstream primer is extended to the upstream long oligonucleotide chain through chain displacement, and its short oligonucleotide chain is separated from the long oligonucleotide chain. The fluorescence emitted by the fluorescent group is not absorbed by the quenching group, and a fluorescent signal is generated in the solution, and the fluorescence intensity is proportional to the number of target genes in the solution, which can be quantitatively measured. When there is no target gene in the solution, the double-stranded oligonucleotide chain specifically binds, and no fluorescence is generated in the solution.

[0049] The primers for real-time fluorescent recombinase polymerase isothermal amplification provided by the present invention are simple in design and low in synthesis cost. They are used in recombinase polymerase isothermal amplification and have the characteristics of high detection sensitivity, strong specificity, short reaction time, low detection equipment requirements, and are independent of Exo enzyme activity.

[0050] In some preferred embodiments, the length of the long-chain oligonucleotide may be, for example, but not limited to 40, 45, 50, 55 or 60 nucleotides, wherein the length complementary to the short-chain oligonucleotide may be, for example, but not limited to 10, 15, 20, 25 or 30 nucleotides, and the length complementary to the target gene may be, for example, but not limited to 30, 31, 32, 33, 34 or 35 nucleotides;

[0051] The length of the short oligonucleotide may be, for example, but not limited to, 10, 15, 20, 25 or 30 nucleotides;

[0052] Preferably, the length of the downstream primer may be, for example, but not limited to, 30, 31, 32, 33, 34 or 35 nucleotides.

[0053] The sensitivity of the primers is made higher by further optimizing and adjusting the primer structure.

[0054] In some preferred embodiments, the fluorescent group includes FAM, HEX, TET, ROX, CY3, CY5, VIC, JOE, SIMA, Alexa Fluor 488, TexasRed or Quasar 670, or other fluorescent groups known to those skilled in the art.

[0055] The quenching group includes TAMRA, Dabcyl, BHQ-1, BHQ-2, BHQ-3, MGB or Eclipse, or other quenching groups known to those skilled in the art.

[0056] In a second aspect, the present invention provides the use of the above-mentioned primers in the preparation of nucleic acid detection products.

[0057] The primers provided by the present invention can be used for nucleic acid detection by adopting a recombinase polymerase isothermal amplification method.

[0058] In some preferred embodiments, the product comprises a reagent or a kit.

[0059] In a third aspect, the present invention provides a nucleic acid detection kit comprising the above-mentioned primers.

[0060] The kit provided by the present invention comprises the above primers, and thus has all the beneficial effects of the primers.

[0061] In some preferred embodiments, the kit further comprises: a recombinase, a single-stranded DNA binding protein, and a strand displacement DNA polymerase, for realizing recombinase polymerase isothermal amplification.

[0062] In some preferred embodiments, the molar ratio of the long-chain oligonucleotide to the short-chain oligonucleotide is 1:1 to 1:3, preferably 1:2.

[0063] In a fourth aspect, the present invention provides a method for detecting nucleic acids for purposes other than disease diagnosis or treatment, using the above-mentioned primers to amplify the nucleic acid to be tested by a recombinase polymerase isothermal amplification method to achieve detection of the nucleic acid to be tested.

[0064] The nucleic acid detection method provided by the present invention has high sensitivity, strong specificity, short reaction time, low detection equipment requirements, and is independent of exo enzyme activity, and can be used for gene mutation, genotyping or life science experimental research.

[0065] In some preferred embodiments, the steps of the nucleic acid detection method may be as follows:

[0066] 1) Setting primers according to the conserved region of the target gene to obtain a long-chain oligonucleotide labeled with a fluorescent group and a short-chain oligonucleotide labeled with the quenching group, and downstream common primers. The size of the amplified target fragment can be, for example, 80-300 bp;

[0067] 2) mixing the long-chain oligonucleotide labeled with the fluorescent group and the short-chain oligonucleotide labeled with the quenching group at a molar ratio of 1:2, denaturing at 98° C. for 2 min, and slowly cooling to 25° C. at 0.2° C. / s to prepare a partially complementary double-stranded modified upstream primer;

[0068] 3) using the nucleic acid to be tested as a template, and performing RPA isothermal amplification using the modified upstream primer containing a partially complementary double strand and the downstream common primer respectively;

[0069] 4) Real-time fluorescence detection of amplified products to detect the nucleic acid to be tested.

[0070] In some preferred embodiments, nucleic acid detection includes one or more of real-time fluorescent RPA, gene chip and membrane hybridization.

[0071] In a fifth aspect, the present invention provides a primer for detecting Helicobacter pylori, comprising an upstream primer and a downstream primer;

[0072] The upstream primer is composed of a long-chain oligonucleotide and a short-chain oligonucleotide;

[0073] The 5' end of the long-chain oligonucleotide is connected to a fluorescent group, the 3' end of the short-chain oligonucleotide is connected to a quenching group, and the 5' end of the long-chain oligonucleotide is complementary to the 3' end of the short-chain oligonucleotide;

[0074] The sequence of the long-chain oligonucleotide is shown in SEQ ID NO.1:

[0075] CCAGCTGAACGGTACGGCAACGGCATTAAATACCGACCTGCATG AATGGCGTAACGAG(SEQ IDNO.1);

[0076] The sequence of the short-chain oligonucleotide is shown in SEQ ID NO.2:

[0077] TGCCGTACCGTTCAGCTGG(SEQ ID NO.2);

[0078] The sequence of the downstream primer is shown in SEQ ID NO.3:

[0079] GCCAAAGCCCTTACTTCAAAGCCTCCCACCTAT (SEQ ID NO. 3).

[0080] The primers for detecting Helicobacter pylori provided by the present invention have low synthesis cost, high sensitivity, strong specificity, short reaction time, and low requirements for detection equipment, and can be used for the diagnosis of Helicobacter pylori-related diseases.

[0081] In a sixth aspect, the present invention provides use of the above-mentioned primers for detecting Helicobacter pylori in preparing a product for detecting Helicobacter pylori.

[0082] In a seventh aspect, the present invention provides a kit for detecting Helicobacter pylori, comprising the above-mentioned primers for detecting Helicobacter pylori.

[0083] The kit comprises the above primers for detecting Helicobacter pylori and thus has all the beneficial effects of the primers.

[0084] In some preferred embodiments, the kit further comprises: a recombinase, a single-stranded DNA binding protein, and a strand displacement DNA polymerase, for realizing recombinase polymerase isothermal amplification.

[0085] In some preferred embodiments, the molar ratio of the long-chain oligonucleotide to the short-chain oligonucleotide is 1:1 to 1:3, preferably 1:2.

[0086] The present invention is further described below by means of specific examples and comparative examples. However, it should be understood that these examples are only used for more detailed description and should not be construed as limiting the present invention in any form.

[0087] Example 1 Real-time fluorescence RPA isothermal amplification method to detect HP DNA

[0088] 1. Design and optimization of HP DNA partially complementary double-stranded modified primers and downstream common primers

[0089] Primer design principle: The upstream primer consists of two oligonucleotides of different lengths but with complementary sequences. The 5' end of the long-chain oligonucleotide is connected to a fluorescent group, and the 3' end of the short-chain oligonucleotide is connected to a quenching group. The 5' end of the long-chain oligonucleotide is complementary to the 3' end of the short-chain oligonucleotide, and the 3' end of the long-chain oligonucleotide is complementary to the target gene. The long-chain oligonucleotide consists of 40-60 nucleotides, of which the length complementary to the short-chain oligonucleotide is 10-30 nucleotides, and the length complementary to the target gene is 30-35 nucleotides. The short-chain oligonucleotide consists of 10-30 nucleotides. The downstream primer consists of 30-35 nucleotides.

[0090] According to the above primer design principle, in accordance with the target molecule HP DNA sequence to be detected (GenBank: CP116234.1), three sets of partially complementary double-stranded modified primers and downstream common primers (combination 1, combination 2 and combination 3) for detecting HP DNA were designed and synthesized for screening and optimization, and commissioned to Jiangsu Saisuofei Biotechnology Co., Ltd. for synthesis and purification. The sequences are shown in Table 1.

[0091] Table 1

[0092]

[0093] Note: The horizontal line below is the complementary sequence to HP-short F.

[0094] 2. HP DNA Extraction

[0095] Sample collection and DNA extraction: Based on informed consent, gastric mucosal samples were collected from 5 patients with Helicobacter pylori infection in Henan Provincial Hospital of Traditional Chinese Medicine. DNA was extracted from all samples using the tissue genomic DNA extraction kit (Cat. No.: DP304) of Tiangen Biochemical Technology (Beijing) Co., Ltd., and the five samples to be tested were identified as HP genes using Sanger sequencing.

[0096] 3. Real-time fluorescence RPA reaction

[0097] The reaction reagent was the RPA basic amplification kit (catalog number: TABAS03KIT) from TwistDx, UK. The reaction system was configured as follows: 29.5 μL Rehydration buffer (TwistDx) was added to each tube of freeze-dried powder, 0.3 μmol / L double-stranded oligonucleotide (HP-long F and HP-short F molar ratio of 1:2 for high temperature denaturation hybridization), 0.2 μmol / L downstream common primer HP-R, 48 μL ddH2O, gently mixed, centrifuged briefly, divided into two (24 μL each) into PCR reaction tubes, 2 μL HP DNA template or negative control (ddH2O) was added to each tube, 2.5 μL 140 mM MgOAc was added to the inner wall of the tube cap, MgOAc was centrifuged into the tube before being put on the machine, mixed, and immediately tested on the machine.

[0098] Reaction conditions: 37°C, 30 min; FAM channel fluorescence signal was collected every 30 s, and the fluorescence quantitative PCR instrument used was ABI7500.

[0099] The reaction curve is shown in Figure 2 The HP DNA reaction wells of combinations 1-3 showed obvious amplification curves, and the amplification signal of combination 1 was the strongest, while no amplification curve was produced in the negative control wells, indicating that the system can specifically detect HP DNA.

[0100] Example 2: Sensitivity of partially complementary double-stranded modified primers in real-time fluorescence RPA-HP isothermal amplification system for detecting HP DNA

[0101] HP DNA (stock solution of 5.8x10 6 copies / mL) and the concentration was 1x10 6 copies / mL, 1x10 5 copies / mL, 1x10 4 copies / mL, 1x10 3 copies / mL, 5x10 2 copies / mL, 1x10 2The detection limit was tested by using the primers of combination 1 according to the method of Example 1. The detection results are shown in Figure 3 As shown, 1x10 6 Copies / mL~5x10 2 The templates have fluorescence amplification curves, 1x10 2 There was no amplification curve in the copies / mL and ddH2O groups, indicating that the detection limit of this system for HP DNA was 500 copies / mL.

[0102] Example 3: Detection of HP DNA specificity by partially complementary double-stranded modified primers using real-time fluorescence RPA-HP constant temperature amplification system

[0103] Specific verification sample nucleic acid: Helicobacter pylori, Staphylococcus aureus, Escherichia coli, Salmonella, Norovirus, Rotavirus Group A, Enterovirus 71, sourced from clinical test samples preserved in this laboratory.

[0104] The primers in combination 1 were used for detection according to the method of Example 1. The results are as follows: Figure 4 As shown. Figure 4 The amplification curve shows that the detection method established in this study showed a positive amplification curve for HP DNA, while other common pathogens in the digestive tract did not show positive amplification reactions, indicating that this method has good specificity and will not produce false positive amplification.

[0105] Example 4 Comparison of partially complementary double-stranded modified primer real-time fluorescence RPA (RPA-1) and real-time fluorescence probe RPA (RPA-2) in detecting HP DNA

[0106] According to the target molecule HP DNA sequence (GenBank: CP116234.1), the real-time fluorescence probe RPA primers and probes for detecting HP DNA were designed and synthesized, and Jiangsu Saisuofei Biotechnology Co., Ltd. was commissioned to synthesize and purify. The sequence is shown in Table 2. The reaction reagent is the RPA real-time fluorescence probe amplification kit (Cat. No.: TALQEXO01) of TwistDx, UK. The reaction system configuration method is as follows: 25 μL buffer, 0.2 μmol / μL upstream primer, 0.2 μmol / μL downstream primer, 0.1 μmol / μL probe, and ddH2O to 48 μL. Gently mix, centrifuge briefly, divide it into two (24 μL each) and put it into the PCR reaction tube, add 2 μL HP DNA template or negative control (ddH2O) to each tube, add 2.5 μL 140mM MgOAc to the inner wall of the tube cap, centrifuge MgOAc into the tube before loading, mix, and immediately load the machine for detection, and immediately place it in the fluorescence quantitative PCR instrument for reaction. Fluorescence RPA reaction conditions: 37°C for 30 min, and the fluorescence signal of the FAM channel was collected every 30 s. The primers for real-time fluorescence RPA detection of HP DNA by partially complementary double-stranded modified primers were combination 1 in Example 1, and the method of Example 1 was used for detection. The above two methods simultaneously detected HP DNA of three samples with different concentrations (the concentrations were 1x10 3 copies / mL, 5x10 2 copies / mL, 1x10 2 copies / mL).

[0107] The results are as follows Figure 5 As shown in the figure, the partially complementary double-stranded modified primer real-time fluorescence RPA is represented as RPA-1, and the real-time fluorescence probe RPA is represented as RPA-2. When the sample concentration is ≥5x10 2 copies / mL, both methods can show significant fluorescence amplification, and their Ct values ​​are similar to the fluorescence signals; when the sample concentration is ≤1x10 2 When the amplification curve was 3.3347 W / mL, it was consistent with the blank control amplification curve, and no fluorescence amplification occurred, indicating that the detection sensitivity of the two methods was similar.

[0108] Table 2

[0109]

[0110] Note: The above HP-RPA-P is a modified probe, the modification includes: modification with a fluorescent reporter group and a fluorescent quencher group, with one base T and one base G between the two groups, where base A is replaced with a tetrahydrofuran residue, and the sequence of the probe before modification is shown in SEQ ID NO.9:

[0111] TGGGAGCTGTCTCAACCAGAGATTCAGTGAAATTGTAGTGGAGGTGAAA (SEQ ID NO. 9).

[0112] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or replace some or all of the technical features therein with equivalents. However, these modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. A primer for detecting Helicobacter pylori, characterized in that: including an upstream primer and a downstream primer; The upstream primer is composed of a long-chain oligonucleotide and a short-chain oligonucleotide; The 5' end of the long-chain oligonucleotide is connected to a fluorescent group, the 3' end of the short-chain oligonucleotide is connected to a quenching group, and the 5' end of the long-chain oligonucleotide is complementary to the 3' end of the short-chain oligonucleotide; The sequence of the long-chain oligonucleotide is shown in SEQ ID NO.1; The sequence of the short-chain oligonucleotide is shown in SEQ ID NO.2; The sequence of the downstream primer is shown in SEQ ID NO.

3.

2. Use of the primers according to claim 1 in preparing products for detecting Helicobacter pylori.

3. A kit for detecting Helicobacter pylori, characterized in that: Comprising the primer of claim 1.

Images