A SNP molecular marker for identification of Laiwu black chicken and its application

Abstract

The present invention relates to a SNP molecular marker for identifying Laiwu black chicken and an application thereof. The SNP molecular marker for identifying Laiwu black chicken includes 18 sites, and the typing results of the 18 SNP sites in the chicken genome to be tested are detected. The 18 SNPs are used as predictive variables, and a machine learning method is used to identify Laiwu black chickens and non-Laiwu black chickens. The machine learning is carried out using a SVM (Support Vector Machine) model. By using the 18 SNP sites and identification technology provided by the present invention, the identification accuracy rate of Laiwu black chickens is as high as 92%, which provides strong technical support for the identification, seed preservation, and genetic breeding of Laiwu black chickens in the future.

Description

Technical Field

[0001] The invention relates to a SNP molecular marker for identifying Laiwu black chicken and application thereof, and belongs to the technical fields of animal husbandry and molecular biology. Background Art

[0002] Agricultural germplasm resources are strategic resources for ensuring national food security and the effective supply of important agricultural and sideline products, and are the material basis for original innovation in agricultural science and technology and the development of the modern seed industry. Identifying and evaluating high-quality and efficient germplasm resources provides a reliable basis for scientific protection and utilization, and is an important guarantee for achieving high-quality development of modern agriculture in the future.

[0003] Laiwu Black Chicken is a local specialty chicken germplasm resource in Shandong Province. It is a small black-feathered type, mainly produced in the mountainous area of ​​central Shandong and the source of the Wen River. The chicken is small in size, with black feathers, black legs, black beak, a single red comb, and white skin. Laiwu Black Chicken has the characteristics of early sexual maturity and high egg production, and is an important local chicken resource in Shandong Province.

[0004] The method of identifying Laiwu black chicken in the market mainly relies on appearance observation. This observation is highly subjective, and the identification error rate is high, especially when identifying Laiwu black chicken and other breeds of chicken hybrid offspring, it is easy to cause incorrect classification and identification. Moreover, black chicken varieties are relatively similar when they are just hatched, and the identification error rate is also high. Although traditional marker identification methods such as cytological markers, biochemical markers and immunological markers have been used in variety identification, these markers have low polymorphism and small information content, and are indirect reflections of genes. They are greatly affected by the interaction between genes and the environment, and have great limitations in production practice. The advent of DNA molecular genetic markers provides an effective solution to overcome this problem. DNA molecular genetic markers have the characteristics of not being restricted by phenotype, time and space, and good polymorphism, so they are often used to carry out variety identification. Including microsatellite markers, restriction fragment length polymorphisms and single nucleotide polymorphisms (Singlenucleotide polymorphism, SNP) markers, etc. Restriction fragment length polymorphism molecular markers are cumbersome to operate and costly, with limited marker numbers and polymorphisms; microsatellite marker detection methods have low automation and throughput, and different conditions in different laboratories make it difficult to achieve standardization and scale; SNP refers to DNA sequence polymorphism caused by single nucleotide variations at the genomic DNA level. Compared with the first-generation genetic markers represented by restriction fragment length polymorphism and the second-generation genetic markers represented by microsatellite polymorphism, SNP has the characteristics of rich sites, wide distribution, high genetic stability, representativeness, and convenient and fast detection. Using the SNP sites with large breed differences in individual genomic DNA, the genotypes of different site combinations are used for breed identification, and the identification results are more objective and accurate. In view of this, there is an urgent need to develop a product and method that can effectively and accurately identify the Laiwu black chicken breed in both scientific research and practice, and apply it to the identification of Laiwu black chicken breeds. Summary of the invention

[0005] In view of the above problems, the present invention provides a SNP molecular marker for the identification of Laiwu black chicken and its application. The present invention performs whole genome resequencing on 9 chicken breeds, screens out 18 SNP sites unique to Laiwu black chicken, and establishes a Laiwu black chicken breed identification model based on the combination of 18 SNP sites. The technical solution of the present invention is as follows:

[0006] A SNP molecular marker for identifying Laiwu black chicken, the specific SNP site of the SNP molecular marker is shown in Table 1:

[0007] Table 1. Laiwu black chicken breed-specific SNP loci

[0008]

[0009]

[0010] Further, the PCR primers for amplifying the SNP molecular markers identified in Laiwu black chicken are shown in Table 2:

[0011] Table 2 PCR primers for 18 SNP marker loci

[0012]

[0013]

[0014]

[0015] The present invention also includes a SNP gene chip for identifying Laiwu black chicken, on which the PCR primers shown in Table 2 are fixed.

[0016] Furthermore, the present invention provides an application of the amplified SNP molecular markers for identifying Laiwu black chicken and the SNP gene chip in identifying Laiwu black chicken.

[0017] The present invention also includes a method for identifying Laiwu black chicken using SNP molecular markers, the steps of which are as follows:

[0018] (1) Extracting sample genomic DNA and amplifying it using the PCR primers described in Table 2;

[0019] The PCR reaction program was as follows: 95°C for 10 min, 95°C for 30 s, 60°C for 30 s, and 72°C for 50 s, for a total of 32 cycles; 72°C for 10 min;

[0020] The PCR reaction system (20 μl) is as follows: template DNA 0.5 μl, 10 pmol / μl upstream primer 0.5 μl, 10 pmol / μl downstream primer 0.5 μl, 2*Master mix 10 μl, ddH2O 8.5 μl.

[0021] (2) allele sequencing of the amplified products using direct sequencing;

[0022] (3) Obtaining a gene table of SNP-corresponding sites of the sample to be tested;

[0023] (4) Prepare the input file for analysis, convert the file into Plink format, and then use plink to convert the genotypes in the file into 0 1 2 format;

[0024] (5) Input the data file into the random sampling training SVM (Support Vector Machine) model for prediction.

[0025] Compared with the prior art, the present invention has the following advantages:

[0026] 1. The present invention proposes for the first time the 18 most representative differential SNP sites of Laiwu black chicken.

[0027] 2. The SNP markers used in the present invention are derived from the whole genome SNP data set, which is different from the previous molecular markers in specific regions of the genome (such as mitochondria, microsatellite markers, etc.), and are more accurate in identifying the source of samples.

[0028] 3. The present invention uses 70% of the individuals in 410 Laiwu black chickens and 559 background chickens as the training group to conduct 20 random sampling training SVM models, and determines that these 18 SNP sites can successfully identify the Laiwu black chicken variety. Using these 18 SNP sites and identification technology provided by the present invention, the identification accuracy of Laiwu black chicken is as high as 92%.

[0029] 4. The present invention uses the SVM (Support Vector Machine) model to carry out machine learning. The SVM classification idea is simple, which is to maximize the interval between the sample and the decision surface. The classification effect is better and can better separate Laiwu black chickens from non-Laiwu black chickens.

[0030] 5. The present invention provides powerful technical support for the identification, seed conservation, and genetic breeding of Laiwu black chicken in the future. DETAILED DESCRIPTION

[0031] The present invention will be further described below in conjunction with specific embodiments, and the advantages and features of the present invention will become clearer as the description proceeds. However, the embodiments are exemplary only and do not constitute any limitation to the scope of the present invention. It should be understood by those skilled in the art that the details and forms of the technical solution of the present invention may be modified or replaced without departing from the spirit and scope of the present invention, but these modifications and replacements all fall within the scope of protection of the present invention.

[0032] Example 1: Screening for breed-specific SNPs

[0033] 1. Experimental Materials

[0034] Twenty Laiwu black chickens, 20 Langya chickens, 20 Shouguang chickens, 20 Wenshang Luhua chickens, 20 Luxi fighting cocks, 20 Jining hundred-day chickens, 20 Luxi miniature chickens and 20 recessive white-feathered chickens were randomly selected from the Shandong Province chicken live gene bank and various Shandong Province local chicken original breeding farms.

[0035] 2. Genome resequencing

[0036] Blood was collected from the wing vein of the experimental chickens, and total genomic DNA was extracted using the conventional phenol-chloroform method. The quality and quantity of DNA were determined using a NanoDrop ND-2000 spectrophotometer and agarose gel electrophoresis. The DNA library was constructed for each individual using the Nextera DNA library preparation kit (Illumina Inc., San Diego, CA, USA) standard process. All libraries were Sequencing was performed on the HiSeq X10 sequencing system with an average sequencing depth of 10X.

[0037] 3. Identification of breed-specific SNPs in Laiwu black chicken

[0038] The genomic information of 160 chickens was obtained by whole genome resequencing. We used the genetic differentiation (Fst) between Laiwu Black Chicken and other chicken breeds (chicken breeds other than Laiwu Black Chicken) to identify the genomic regions selected in the Laiwu Black Chicken population. Considering that the chicken population has a high genomic nucleotide diversity and heterozygosity, we reduced the window size and step size to 40kb and 10kb, respectively, when calculating the Weir-Fst value of each window. The top 1% in the window is considered to be the hypothetical genomic region selected.

[0039] For SNPs in the selected genomic regions, we used a simple summary statistic (di) based on an unbiased estimate of pairwise Fst to measure the site-specific differences in allele frequencies for each breed. We calculated the statistic for SNPs in each significant window as follows:

[0040]

[0041] where E[Fst ij ] and sd[Fst ij ] represents the expected value and standard deviation of Fst between breeds i and j calculated from 22083 SNPs in 40 regions.

[0042] The top 1% outliers in the window were considered as the selected genomic SNPs, and a total of 1142 breed-specific SNPs were screened through Di analysis. Then, LD pruning was performed on the 1142 SNPs with a window size of 25 SNPs, a step size of 5 SNPs, and r 2 The threshold value was 0.2, and 18 Laiwu Black Chicken breed-specific SNP markers were obtained as shown in Table 1:

[0043] Table 1. Laiwu Black Chicken breed-specific SNP loci

[0044]

[0045]

[0046] Example 2: Using molecular marker detection to distinguish Laiwu black chicken from non-Laiwu black chicken

[0047] Samples to be tested: 410 Laiwu black chickens, 589 background chickens (including 18 Shouguang chickens, 10 Wenshang Luhua chickens, 10 Wenshang Luhua chickens, 10 new strains of Wenshang Luhua chickens, 10 Langya chickens, 17 Jining Bairi chickens, 20 Luxi fighting chickens, 20 Luxi miniature chickens, 17 recessive white-feathered chickens, 341 Jingxing yellow chickens, 9 bearded chickens, 24 Daweishan miniature chickens, 21 scoop chickens, 21 Wuding chickens, 10 Tibetan chickens, 7 Zhuanghe big-bone chickens, 30 red jungle fowls, and 4 eight-clawed chickens). Blood was collected from the wing veins of the experimental chickens for genomic DNA extraction.

[0048] PCR reaction and sequence determination method: PCR amplification was performed in a BioThermocycler thermal cycler using upstream and downstream primers as shown in Table 2. The PCR reaction program was: 95°C 10 min, 95°C 30 s, 60°C 30 s, 72°C 50 s, 32 cycles in total; 72°C 10 min. The PCR reaction system was calculated as 20 μl: template DNA 0.5 μl, 10 pmol / μl upstream primer 0.5 μl, 10 pmol / μl downstream primer 0.5 μl, 2*Master mix 10 μl, ddH2O 8.5 μl. Direct sequencing was used to sequence the amplified products for alleles.

[0049] Table 2 Primer information of 18 loci

[0050]

[0051]

[0052] Prediction of Laiwu Black Chicken and Non-Laiwu Black Chicken: 18 SNPs were used as predictive variables, Laiwu Black Chicken or Non-Laiwu Black Chicken was used as the prediction value, and 70% of the individuals in the sample to be tested were used as the training group to train the SVM (Support Vector Machine) model for 20 random samplings. The optimal value of the Cost hyperparameter was 1, and the optimal value of the Gamma parameter was 0.05. The results of the 20 samplings are shown in Table 3. The results show that the prediction accuracy of 30% of the test population is 92% ± 0.02%, the false positive rate is 5.56% ± 1.83%, and the false negative rate is 11.25% ± 3.81%, which can effectively realize the variety identification of Laiwu Black Chicken.

[0053] Table 3 Prediction results of Laiwu black chicken using 18 SNPs

[0054] Accuracy (%) False positive rate (%) False negative rate (%) Measurement results 92.00±2.00 5.56±1.83 11.25±3.81

Claims

1. A SNP molecular marker for identifying Laiwu black chicken, characterized in that: The specific SNP sites of the Laiwu black chicken are as follows: 1_110259404 is located at position 110259404 of chromosome 1, and its deoxynucleotide is T 1_110265820 is located at position 110265820 of chromosome 1, and its deoxynucleotide is C 3_27332382 is located at position 27332382 of chromosome 3, and its deoxynucleotide is G 4_37258551 is located at position 37258551 of chromosome 4, and its deoxynucleotide is T 4_69703600 is located at position 69703600 of chromosome 4, and its deoxynucleotide is G 4_697468200 is located at position 69746820 on chromosome 4, and its deoxynucleotide is A 6_20199423 is located at position 20199423 on chromosome 6, and its deoxynucleotide is T 6_20215669 is located at position 20215669 of chromosome 6, and its deoxynucleotide is G 9_8381083 is located at position 8381083 of chromosome 9, and its deoxynucleotide is T 9_23901671 is located at position 23901671 of chromosome 9, and its deoxynucleotide is T 11_18800455 is located at position 18800455 of chromosome 11, and its deoxynucleotide is T 14_9196624 is located at position 9196624 on chromosome 14, and its deoxynucleotide is G 14_9247709 is located at position 9247709 of chromosome 14, and its deoxynucleotide is A 14_14071236 is located at position 14071236 of chromosome 14, and its deoxynucleotide is A 14_14085421 is located at position 14085421 of chromosome 14, and its deoxynucleotide is T 20_1568965 is located at position 1568965 of chromosome 20, and its deoxynucleotide is C 20_6690004 is located at position 6690004 of chromosome 20, and its deoxynucleotide is C 20_6696886 is located at position 6696886 of chromosome 20, and its deoxynucleotide is G.

2. A SNP primer combination for identifying Laiwu black chicken varieties, characterized in that: The primer combination includes a primer set for amplifying all SNP sites in the SNP site combination of claim 1; The sequences of primers for each SNP site are: 1_110259404F:5'GCCTGAACCTCTGATTGACC3' 1_110259404R:5'TCCTTCCTCCTTGGAAGTCA3' 1_110265820F:5'TGCTCAGCACCAGAAGAGTC3' 1_110265820R:5'AAGCAAGCTGTAGAAACTGGAA3' 3_27332382F:5'GACCCCACGATCATTTTCAC3' 3_27332382R:5'TTTGTTTTCTGGGGAAGCTG3' 4_37258551F:5'TGGGTGATTTTGGTTTCCTCT3' 4_37258551R:5’CAGCCTTGTCTGGTGGTTG3’ 4_69703600F:5’TAAACACGCATTTTCCAGCA3’ 4_69703600R:5’AGGGCCACCTGCAATGTTA3’ 4_69746820F:5’TCAGACCTCTGTATGGCTTATCA3’ 4_69746820R:5’TTCAAATGATCACGCTGAAGTC3’ 6_20199423F:5’CTGTTGGCAGCATGTGAACT3’ 6_20199423R:5’TGCACATGGTCACACTGACA3’ 6_20215669 F:5’CACAAATGCTTCCACCAAGTT3’ 6_20215669 R:5’CCTTGTCTTCGTGAGCCTTC3’ 9_8381083 F:5’TTTTGTTCCTTATCCACCCTGT3’ 9_8381083 R:5’GGCACAAAGCCAACATACCT3’ 9_23901671 F:5’GCAATGCCACAGCAACTAAT3’ 9_23901671 R:5’TTTTTCCAACCTGAACGATTCT3’ 11_18800455 F:5’ TCACTGCACAAACAAAAATTCC3’ 11_18800455R:5’ CCTGGTTTTGCAAAGAGAACA3’ 14_9196624 F:5’CATTCTGTATTGCTGTGTGTGG3’ 14_9196624 R:5’TGACATTTCTGACCCCCAAC3’ 14_9247709 F:5’GCATAATTTGAGAGAGGTGTGC3’ 14_9247709 R:5’CGGCAAAGAAAGAAGGTGTAA3’ 14_14071236 F:5’TGAACATGAGCCAGCAGTGT3’ 14_14071236 R:5’TGTCTGGTCTTGCAGTGAGG3’ 14_14085421 F:5’GACCTGGGCAGATCTTCTGT3’ 14_14085421 R:5’CCTAAAATGCCAAGAGCTGAG3’ 20_1568965 F:5’AACAGCTGCCTACCTTGGAA3’ 20_1568965R:5’TTGCATAAAAATATCATCAAGCATATC3’ 20_6690004 F:5’ATTTACCAACCCGCTGTCTG3’ 20_6690004 R:5'AGTCATGGGGTTGACAGAGC3' 20_6696886 F:5'CACTGCGAGCAGATGAAGG3' 20_6696886 R: 5'TTGTTTCTGTGCCTTTGCTG3'.

3. Application of the SNP molecular marker as claimed in claim 1 in identifying the variety of Laiwu black chicken.

4. A method for identifying Laiwu black chicken using SNP molecular markers, characterized in that: Here are the steps: (1) extracting sample genomic DNA and amplifying it using the PCR primer set described in claim 2; The PCR reaction program was as follows: 95°C for 10 min, 95°C for 30 s, 60°C for 30 s, and 72°C for 50 s, for a total of 32 cycles; 72°C for 10 min; The PCR reaction system was calculated as 20 μl: template DNA 0.5 μl, 10 pmol / μl upstream primer 0.5 μl, 10 pmol / μl downstream primer 0.5 μl, 2*Master mix 10 μl, ddH2O 8.5 μl; (2) Use direct sequencing to perform allele sequencing on the amplified product; (3) Obtaining the gene table of the SNP corresponding sites of the sample to be tested; (4) Prepare the input file for analysis, convert the file into Plink format, and then use plink to convert the genotypes in the file into 0 1 2 format; (5) Input the data file into the random sampling training SVM (Support Vector Machine) model for prediction.

Images