Application of SNP markers associated with the trait of lambing in Matou goats

Abstract

The present invention provides a use of a SNP marker related to the trait of having many lambs in a horse-head goat, including the use of a SNP marker and a kit for detecting the SNP marker in assisting the identification of the trait of having many lambs in a horse-head goat or in breeding a horse-head goat having the trait of having many lambs. The SNP marker is located at 53696339bp on chromosome 18 of the horse-head goat, which is the g.1489C>A site on intron 4 of the APOE gene. The number of lambs born by horse-head goat individuals with CC genotype or AC genotype at this site is significantly higher than that with AA genotype. The use of the SNP marker improves the accuracy of the result of the identification of the trait of having many lambs. The use of the SNP marker in breeding horse-head goats increases the average number of lambs born per litter of ewes by more than 60%, reduces the breeding cost, and is conducive to accelerating the establishment of a high-breeding population of horse-head goats.

Description

Technical Field

[0001] The invention relates to the technical field of animal molecular markers, and in particular to a use of a SNP marker associated with the trait of having many lambs in a horse-head goat. Background Art

[0002] Matou goats have excellent characteristics such as docile character, strong sociability, strong disease resistance, fast growth rate, and good meat performance. However, factors such as insufficient breeding ewes, high feeding costs, and backward breeding models make it impossible for Matou goat production to fully meet the needs of rapid growth in consumption. Improving the reproductive efficiency of ewes and the number of high-quality groups is the key to promoting the quality and efficiency of Matou goat breeding. The number of lambs is one of the important indicators to measure the reproductive performance of ewes. Since the trait of multiple lambs is a complex trait regulated by multiple genes, its heritability is relatively low. The traditional breeding method based on phenotype cannot increase the number of lambs in a short period of time, and its accuracy is based on a large amount of phenotypic data of each generation of goats. This has limited the progress and accuracy of the selection and breeding of Matou goats to a certain extent.

[0003] Although molecular breeding technology and molecular marker-assisted selection have opened up a new and rapid path for livestock and poultry breeding, there are currently few reports on candidate genes for the multi-lamb trait in goats, and even fewer reports on candidate genes for the multi-lamb trait in horse-head goats. Therefore, there is a lack of means to implement early selection of horse-head goats through molecular-assisted marker technology. Summary of the invention

[0004] The applicant discovered that the genetic variation of the APOE gene (see SEQ NO.1) has a certain effect on the number of lambs born by Matou goats. Further research revealed that the g.1489C>A site on intron 4 of the APOE gene is significantly correlated with the number of lambs born by Matou goats. Based on this, a use of a SNP marker related to the multi-lamb trait of Matou goats is provided.

[0005] In the first aspect, the present invention provides a use of a SNP marker in assisting the identification of the fecundity trait of a Matou goat, wherein the SNP marker is located at 53696339 bp on chromosome 18 of the Matou goat, which is the g.1489C>A site on intron 4 of the APOE gene. The number of lambs produced by Matou goats with CC genotype or AC genotype is significantly higher than that with AA genotype.

[0006] This SNP marker enriches the molecular marker genetic resource library for goat breeding. It can be used alone or in combination with other SNP markers related to the multi-lamb trait of Matou goats to identify the multi-lamb trait of Matou goats, thereby improving the accuracy of the identification results.

[0007] In a second aspect, the present invention provides a kit for detecting SNP markers for use in assisting identification of the multi-lamb trait of horse-head goats or breeding horse-head goats with the multi-lamb trait, the kit comprising a primer pair:

[0008] Upstream primer F: 5'-TTAGGATGTTGCTGGGAGCG-3' (see SEQ NO. 2),

[0009] Downstream primer R: 5'-GTGTTGGTGATGGGGACAGA-3' (see SEQ NO. 3);

[0010] The SNP marker is located at 53696339bp on chromosome 18 of the Matou goat.

[0011] The primer pair in this kit is designed for the 53695869-53696787bp interval of chromosome 18, contains SNP markers, can amplify fragments containing SNP markers, and increase the concentration of SNP markers in the test object.

[0012] In a third aspect, the present invention provides a method for identifying the trait of having more lambs than a goat, comprising:

[0013] Extracting genomic DNA from the tested horse-head goat;

[0014] The genomic DNA of the tested horse-head goat was used as a template for amplification;

[0015] The amplified product was sequenced to determine the genotype of the SNP marker; the SNP marker was located at 53696339 bp on chromosome 18 of the Matou goat;

[0016] Prediction of individual lambing trait of Matou goat based on genotype of SNP markers.

[0017] In some embodiments provided by the present invention, amplification using the genomic DNA of the tested horse-head goat as a template comprises:

[0018] Using primer pairs to perform PCR amplification on the genomic DNA of the tested horse-head goat to obtain a PCR amplification product;

[0019] The upstream primer of the primer pair is F: 5'-TTAGGATGTTGCTGGGAGCG-3',

[0020] The downstream primer of the primer pair is R: 5'-GTGTTGGTGATGGGGACAGA-3'.

[0021] In some embodiments provided by the present invention, determining the lambing trait of a Matou goat individual according to the genotype of a SNP marker comprises:

[0022] If the genotype of this SNP marker is CC genotype or AC genotype, the individual horse-headed goat has the trait of having multiple lambs;

[0023] If the genotype of this SNP marker is AA genotype, the individual horse-head goat does not have the trait of having many lambs.

[0024] In a fourth aspect, the present invention provides a method for breeding horse-head goats with the trait of having many lambs, wherein the SNP markers of the horse-head goats to be tested are detected, and individuals with the target genotype are selected for breeding superior varieties with the trait of having many lambs;

[0025] Among them: the SNP marker is located at 53696339bp on chromosome 18 of the Matou goat.

[0026] In some embodiments provided by the present invention, the target genotype is optimally a CC genotype and suboptimally an AC genotype.

[0027] In some embodiments provided by the present invention, the following steps are included:

[0028] Extracting genomic DNA from the tested horse-head goat;

[0029] The genomic DNA of the tested horse-head goat was used as a template for amplification reaction;

[0030] The amplified product was sequenced to determine the genotype of the SNP marker; the SNP marker was located at 53696339 bp on chromosome 18 of the Matou goat;

[0031] Individuals with the target genotype are selected for breeding superior varieties with the trait of multiple lambs.

[0032] In some embodiments provided by the present invention, amplification using the genomic DNA of the tested horse-head goat as a template comprises:

[0033] Using primer pairs to perform PCR amplification on the genomic DNA of the tested horse-head goat to obtain a PCR amplification product;

[0034] The upstream primer of the primer pair is F: 5'-TTAGGATGTTGCTGGGAGCG-3',

[0035] The downstream primer of the primer pair is R: 5'-GTGTTGGTGATGGGGACAGA-3'.

[0036] The present invention has the following beneficial effects:

[0037] The present invention utilizes the SNP marker located at the 53696339bp on chromosome 18 of the Matou goat, namely the g.1489C>A site on intron 4 of the APOE gene, to identify the multiple-lamb trait and select multiple-lamb ewes for the Matou goat, thereby improving the accuracy of the multiple-lamb trait identification results, increasing the average number of lambs born per ewes by more than 60%, reducing breeding costs, and facilitating the establishment of a high-breeding population of Matou goats. BRIEF DESCRIPTION OF THE DRAWINGS

[0038] Figure 1 This is a schematic diagram of the PCR amplification product of the APOE gene intron 4 sequence of the Matou goat; where: L represents MarkerDL5000, and lanes 1-10 represent the DNA amplification results of different Matou goats.

[0039] Figure 2 The typing results of the g.1489C>A site of the APOE gene of the Matou goat are shown, and from left to right are the sequencing peak graphs of CC type, CA type and AA type respectively. DETAILED DESCRIPTION

[0040] The features and advantages of the present invention will be further understood through the detailed description of the following embodiments in conjunction with the accompanying drawings. The embodiments provided are only partial descriptions of the method of the present invention and do not limit the remaining contents disclosed by the present invention in any way.

[0041] The goat apolipoprotein E (APOE) gene is located on chromosome 18 and includes 6 exons and 5 introns. APOE is composed of a variety of lipoproteins. It takes up lipoprotein remnants through the low-density lipoprotein cholesterol receptor pathway and plays a key role in the metabolism of cholesterol and other lipids. Granulosa cell proliferation, oocyte maturation and ovulation all require energy consumption. The metabolism and ATP levels in oocytes and adjacent cumulus cells play an important role in oocyte quality and embryonic health development, and lipid metabolism is one of the important sources of energy. Studies have shown that APOE (- / -) mice have disordered plasma cholesterol metabolism, lipid accumulation leads to increased ovarian weight and reduced estrus frequency and duration, and APOE deficiency increases the number of follicles, while the proportion of follicle atresia and apoptosis increases. In human medicine, the APOE gene has also been shown to regulate the function of steroid hormones and has an important impact on human reproduction. Although previous reports suggest that APOE may affect ovarian development by regulating steroid metabolism and thus affect the number of lambs born in Matou goats, there have been no reports on the effects of genetic variation in the APOE gene on the number of lambs born in goats.

[0042] The present invention verifies the relationship between the g.1489C>A site on intron 4 of the APOE gene and the trait of having more lambs than the Matou goat through the following examples. The location of the g.1489C>A site on the APOE gene is as follows:

[0043] GTATGGGGGCGGGGCTTGCCCAGGTTCTTTTGCCCCACCCCCTCCC

[0044] ATCCTCATCTTGTCGTCCTCCCGTCCGTGGTCCGTGGGTCCTCTCA

[0045] TCTGCTGGTCTATCTCCCCAGGTCTGAGGTCTCTCTGACATTCCTT

[0046] GGTTCTGAGCTGCAGTTTTACTTTCTCAGAGCCTCAGTTTCCCCA

[0047] TCCTTAAAATGAGAGTTTCTAGCGCACTACTGTCAGGCAGGTAGT

[0048] GAGGAGCAGCTAAGTGTCAGCGGTGATTATTCTCTATCTGGGGCT

[0049] GTTTTATTCTCTATCGCCCCAGCGTGGCAGTACGTGGA A (g.1489C>A)CACACATAATCCATGCTTATCAAGTGCTTAAACCG GCTGGGCGTCTCTCCACCCCATCTCCACCCCCCAGTGCTCTAAAGAAGCCCACCAGCCTCTGTGGAGCACCTCCTCTGTACCGGGTACTGTGTGCCTGGAGCGGGCAGAGGACCCTGACCGCGGTGAACTGTCTGTGTGCAG.

[0050] Example

[0051] 1. Experimental Materials and Methods

[0052] 1.1 Experimental population and phenotypic data

[0053] A total of 97 Matou goat ewes provided by Qingqing Matou Goat Breeding Professional Cooperative in Yunxi County, Hubei Province and Hubei Xinnong Ecological Technology Co., Ltd. were used as experimental subjects. Blood was collected from the jugular vein, anticoagulated with EDTA, and stored at -20℃. The number of lambs born per litter of these ewes was recorded, and a total of 97 lambing data of ewes were obtained.

[0054] 1.2 Extraction of genomic DNA from blood

[0055] Total DNA was extracted using the Tiangen Blood Genomic DNA Extraction Kit, and the steps were as follows:

[0056] 1) Take 200 μL of blood sample, add 400 μL of cell lysis buffer CL to the sample, invert to mix, centrifuge at 10000 rpm for 1 min, remove the supernatant, and keep the cell nucleus pellet. Add 200 μL of buffer GS to the cell nucleus pellet and shake until thoroughly mixed. Add 4 μL of ribonuclease A (RNaseA, 100 mg / mL) solution to the 200 μL sample obtained by the above treatment, shake for 15 seconds, and place at room temperature for 5 minutes.

[0057] 2) Add 200 μL of buffer GB and 20 μL of proteinase K premix solution to the 200 μL sample obtained by the above treatment, mix thoroughly by inversion, and place at 56° C. for 15 min, inverting and mixing several times.

[0058] 3) After standing at room temperature for 2-5 minutes, add 350 μL of buffer BD and mix thoroughly by inversion.

[0059] 4) Add the solution and flocculent precipitate obtained in the previous step to an adsorption column CG2, centrifuge at 12000 rpm for 30 seconds, pour out the waste liquid in the collection tube, and place the adsorption column CG2 in the collection tube.

[0060] 5) Add 500 μL of buffer GDB to the adsorption column CG2, centrifuge at 12000 rpm (~13400×g) for 30 seconds, pour out the waste liquid in the collection tube, and place the adsorption column CG2 in the collection tube.

[0061] 6) Add 600 μL of rinsing solution PWB to the adsorption column CG2, centrifuge at 12000 rpm for 30 seconds, pour out the waste liquid in the collection tube, and place the adsorption column CG2 in the collection tube.

[0062] 7) Repeat step 6.

[0063] 8) Centrifuge at 12000 rpm for 2 min, discard the waste liquid, and place the adsorption column CG2 at room temperature for 2 min to completely dry the residual rinse liquid in the adsorption material.

[0064] 9) Transfer the adsorption column CG2 into a 1.5 mL centrifuge tube, add 60 μL of elution buffer TB to the middle of the adsorption membrane, let it stand at room temperature for 2 minutes, centrifuge at 12000 rpm for 2 minutes, and collect the solution into the centrifuge tube.

[0065] 10) Use NanoDrop spectrophotometer to detect DNA concentration and purity. The OD260 / OD280 value should be between 1.7 and 2.0. 1% agarose gel electrophoresis is used to detect DNA quality.

[0066] 1.3 Primer design and PCR amplification

[0067] After the DNA samples were quality checked, primers were designed, amplified and sequenced for the 53695869-53696787 interval on chromosome 18 of 97 samples. The SNP marker information to be detected in this interval is as follows (Table 1):

[0068] Table 1 Information of SNP markers to be detected

[0069]

[0070] Note: Referring to the APOE gene sequence in NCBI (NC_030825.1 and XM_018062561.1), the first base of the gene is marked as 1, and the coding is arranged from 5' to 3' according to the general SNP numbering rules.

[0071] The main steps are:

[0072] (1) Primer design

[0073] According to the reference sequence provided by Ensembl (reference genome ARS1: CM004579.1), PCR amplification primers were designed using Primer5.0.

[0074] Upstream primer F: 5'-TTAGGATGTTGCTGGGAGCG-3'

[0075] Downstream primer R: 5'-GTGTTGGTGATGGGGACAGA-3'

[0076] (2) PCR amplification

[0077] The PCR reaction system (20 μL) contained 0.5 μL of upstream primer, 0.5 μL of downstream primer, 10 μL of 2×TaqPCRMasterMix, 1 μL of template DNA, and ddH2O supplemented to 20 μL.

[0078] Reaction process: ① 95℃ for 3 min; ② 94℃ for 30 s, 58℃ for 45 s, and 72℃ for 60 s, a total of 30 cycles; ③ 72℃ for 10 min.

[0079] (3) Sequence analysis

[0080] The amplified products were tested by agarose gel electrophoresis and sent to the Wuhan Branch of Beijing Qingke Biotechnology Co., Ltd. for bidirectional sequencing. The sequencing results were checked with SeqMan software and the detected SNP markers were typed.

[0081] 1.4 Statistical analysis

[0082] The genotype frequency and allele frequency of each locus were calculated using Excel, and the Hardy-Weinberg equilibrium of each locus was analyzed using the chi-square test. The univariate analysis of the general linear model in IBM SPSS Statistics 21 software was used, and the LSD method was used for multiple comparisons to conduct an association analysis between the genotype of each locus and the number of lambs, and the results were expressed as "mean ± standard error". The analysis model is: Y = μ + G + ε, where Y is the observed value of the trait; μ is the population mean; G is the genotype efficiency; ε is the random residual effect.

[0083] 2. Test results

[0084] 2.1 PCR amplification results

[0085] The electrophoresis results of PCR amplification products are as follows Figure 1 As shown, the amplification effect is good, and the size of the amplified fragment is about 900 bp, which is consistent with the expected target fragment size and can be used for subsequent sequencing and analysis.

[0086] 2.2g.1489C>A site polymorphism analysis

[0087] The polymorphism of g.1489C>A locus in the Matou goat population is as follows Figure 2 The sequencing peak diagram showed that there were three genotypes of CC, CA and AA at this locus in the Matou goat population.

[0088] The genotype frequency, gene frequency, genetic diversity and Hardy-Weinberg equilibrium test analysis results of the g.1489C>A site are shown in Table 2. g.1489C>A is in Hardy-Weinberg equilibrium, and the site is moderately polymorphic (0.25 <PIC<0.50)。

[0089] Table 2g. Polymorphism analysis of 1489C>A locus

[0090]

[0091] Note: PIC is the polymorphism information content, He is the expected heterozygosity, Ne is the effective population content, χ 2 The chi-square value is (P<0.05).

[0092] 2.3 Association analysis between SNP markers and goat fecundity

[0093] The IBM SPSS Statistics 21 software was used to analyze the effects of different genotypes of the APOE gene g.1489C>A locus on the number of goats born (Table 3). The results showed that the number of goats born by individuals with CC genotype and AC genotype at the g.1489C>A locus was significantly higher than that of the AA type (P<0.05). Compared with the AA genotype, the number of goats born by CC and AC genotypes increased by 0.80 and 0.72 on average, respectively, an increase of 66.67% and 60%, respectively.

[0094] Table 3g.1489C>A site polymorphism and association analysis with litter size (mean ± standard error)

[0095]

[0096] Note: The number of litters is expressed as "mean ± standard error". Different lowercase letters indicate significant differences (P<0.05).

[0097] The above research results suggest that the APOE gene can be used as an important candidate gene affecting the trait of multiple lambs in Matou goats, and the g.1489C>A site on intron 4 of the APOE gene can be used for marker-assisted selection of the number of lambs born in Matou goats. In production practice, individuals with CC and AC genotypes at the g.1489C>A site can be reserved for breeding, thereby increasing the number of lambs born in the Matou goat population and thus improving economic benefits.

[0098] The foregoing is merely a specific embodiment of the present invention, which enables those skilled in the art to understand or implement the present invention. Various modifications to these embodiments will be apparent to those skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention will not be limited to the embodiments shown herein, but rather to the widest scope consistent with the principles and novel features claimed herein.

Claims

1. Use of a reagent for detecting SNP markers in assisting identification of the trait of multiplication of lambs in Matou goats, characterized in that: The SNP marker is located at 53696339bp on chromosome 18 of the Matou goat, which is the g.1489C>A site on intron 4 of the APOE gene. The number of lambs born by Matou goats with CC genotype or AC genotype is significantly higher than that with AA genotype; the version number of the APOE gene in NCBI is NC_030825.

1.

2. Use of a kit for detecting SNP markers in assisting identification of the trait of multiplicity in Matou goats, characterized in that: The kit contains primer pairs: Upstream primer F: 5'-TTAGGATGTTGCTGGGAGCG-3', Downstream primer R: 5′-GTGTTGGTGATGGGGACAGA-3′; The SNP marker is located at 53696339bp on chromosome 18 of the Matou goat, which is the g.1489C>A site on intron 4 of the APOE gene. The number of lambs born by Matou goats with CC genotype or AC genotype is significantly higher than that with AA genotype; the version number of the APOE gene in NCBI is NC_030825.

1.

3. A method for identifying the trait of having more lambs than Matou goats, characterized in that: include: Extracting genomic DNA from the tested horse-head goat; The genomic DNA of the tested horse-head goat was used as a template for amplification; The amplified product was sequenced to determine the genotype of the SNP marker; the SNP marker was located at the 53696339 bp on chromosome 18 of the Matou goat, which was the g.1489C>A site on intron 4 of the APOE gene. The number of lambs born by Matou goats with CC genotype or AC genotype was significantly higher than that with AA genotype; the version number of the APOE gene in NCBI was NC_030825.1; Predicting the fecundity of Matou goats based on the genotypes of SNP markers.

4. The method for identifying the trait of having many lambs in a horse-head goat according to claim 3, characterized in that: The amplification using the genomic DNA of the tested goat as a template comprises: Using primer pairs to perform PCR amplification on the genomic DNA of the tested goat to obtain a PCR amplification product; The upstream primer of the primer pair is F: 5'-TTAGGATGTTGCTGGGAGCG-3', The downstream primer of the primer pair is R: 5'-GTGTTGGTGATGGGGACAGA-3'.

5. The method for identifying the trait of having more lambs than Matou goats according to claim 3, characterized in that: Determining the multi-lamb trait of the individual Matou goat according to the genotype of the SNP marker includes: If the genotype of the SNP marker is CC genotype or AC genotype, the individual horse-headed goat has the trait of having multiple lambs; If the genotype of the SNP marker is the AA genotype, the individual horse-head goat does not have the trait of having many lambs.

6. A method for breeding horse-head goats with the trait of multiple lambs, characterized in that: The SNP markers of the tested Matou goats are tested, and individuals with the target genotype are selected for breeding superior varieties with the trait of multiple lambs; Among them: the SNP marker is located at 53696339bp on chromosome 18 of the Matou goat, which is the g.1489C>A site on intron 4 of the APOE gene. The number of lambs born by Matou goats with CC genotype or AC genotype is significantly higher than that with AA genotype; the version number of the APOE gene in NCBI is NC_030825.

1.

7. The method for breeding horse-head goats with the trait of bearing many lambs according to claim 6, characterized in that: The target genotype is CC genotype or AC genotype.

8. The method for breeding horse-head goats with the trait of having many lambs according to claim 6, characterized in that: The following steps are involved: Extracting genomic DNA from the tested horse-head goat; The genomic DNA of the tested horse-head goat was used as a template for amplification reaction; The amplified product was sequenced to determine the genotype of the SNP marker; the SNP marker was located at 53696339 bp on chromosome 18 of the Matou goat; Individuals with the target genotype are selected for breeding superior varieties with the trait of multiple lambs.

9. The method for breeding horse-head goats with the trait of having multiple lambs according to claim 8, characterized in that: The amplification using the genomic DNA of the tested goat as a template comprises: Using primer pairs to perform PCR amplification on the genomic DNA of the tested goat to obtain a PCR amplification product; The upstream primer of the primer pair is F: 5'-TTAGGATGTTGCTGGGAGCG-3', The downstream primer of the primer pair is R: 5'-GTGTTGGTGATGGGGACAGA-3'.

Images