RNA deprotection agent and use thereof

By using dimethylethanolamine hydrofluoric acid as an RNA deprotectant, the problems of low coupling efficiency and byproduct generation during RNA synthesis were solved, thereby improving the purity and success rate of RNA synthesis.

CN117024497BActive Publication Date: 2025-11-18GENERAL BIOL (ANHUI) CO LTD
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202310925922.2
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-07-26
Publication Date
2025-11-18
Estimated Expiration
2043-07-26

AI Technical Summary

Technical Problem

In current RNA synthesis processes, RNA coupling efficiency is low and byproducts are easily generated, leading to synthesis failure. This is mainly because the commonly used deprotecting agent, triethylamine trihydrofluoride, tends to depurinate and destroy the intact structure of RNA.

Method used

Dimethylethanolamine hydrofluoric acid was synthesized using dimethylethanolamine and anhydrous hydrogen fluoride as a deprotecting agent. Combined with 1-methyl-2-pyrrolidone, and through an appropriate buffer environment, the degree of depurination was reduced to prepare an RNA deprotecting agent for deprotection of crude RNA synthesized by solid-phase phosphoramidite method.

Benefits of technology

It improves the purity and success rate of RNA synthesis, reduces the generation of byproducts, and enhances the efficiency of RNA synthesis.

✦ Generated by Eureka AI based on patent content.
Patent Text Reader

Abstract

The application discloses an RNA deprotection agent and application thereof, and belongs to the technical field of nucleic acid synthesis, and comprises the following components by volume: 60 parts of 1-methyl-2-pyrrolidone, 30 parts of dimethyl ethanolamine hydrofluoride and 40 parts of dimethyl ethanolamine; the dimethyl ethanolamine hydrofluoride is synthesized by the following steps: adding dimethyl ethanolamine into a sealed reaction container, cooling for 10-20 min through an acetone dry ice bath, then condensing anhydrous hydrogen fluoride into the reaction container, cooling for 10-15 min through an acetone dry ice bath, and heating to 25±2 DEG C at a temperature increasing speed of 0.5-1 DEG C / min to obtain the dimethyl ethanolamine hydrofluoride. Compared with the RNA deprotection agent in the prior art which takes triethylamine trihydrogen fluoride salt and triethylamine as raw materials, the RNA deprotection agent can reduce the degree of RNA deprotonation, reduce the generation of by-products, improve the purity of RNA synthesis, and improve the success rate of RNA synthesis.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of nucleic acid synthesis technology, specifically relating to an RNA deprotectant and its application. Background Technology

[0002] Oligonucleotides are generally synthesized using the solid-phase phosphoramidite method. The phosphoramidite method involves fixing DNA onto a solid support and then performing a four-step cyclic reaction: deprotection, coupling, capping, and oxidation, to link nucleotide monomers one by one, ultimately completing the synthesis of the DNA chain.

[0003] Oligonucleotide deprotection can be divided into three parts: cleavage, phosphate deprotection, and base deprotection. Because RNA has an additional hydroxyl group at the 2' end of its glycosyl group compared to DNA, and this hydroxyl group is a reactive group, it must be pre-protected during synthesis to prevent side reactions at the 2' end. Protecting groups used to protect the 2' hydroxyl group, such as tert-butyldimethylsilyl (TBDMS) and triisopropylsiloxymethyl (TOM), can create significant steric hindrance, leading to reduced coupling efficiency between RNA and nucleic acids. Therefore, deprotection is also necessary.

[0004] Triethylamine trihydrofluoride is a commonly used reagent for removing silane protecting groups. It is often used as an RNA deprotecting agent by mixing 1-methyl-2-pyrrolidone, triethylamine trihydrofluoride, and triethylamine. The deprotection is achieved by reacting triethylamine trihydrofluoride with the 2' hydroxyl protecting group. However, the added buffer triethylamine tends to depurinate, resulting in the generation of too many byproducts, damage to the intact structure of RNA, and failure of RNA synthesis.

[0005] Oligonucleotide deprotection can be divided into three parts: cleavage, phosphate deprotection, and base deprotection. Because RNA has an additional hydroxyl group at the 2' end of its glycosyl group compared to DNA, and this hydroxyl group is a reactive group, it must be pre-protected during synthesis to prevent side reactions at the 2' end. Protecting groups used to protect the 2' hydroxyl group, such as tert-butyldimethylsilyl (TBDMS) and triisopropylsiloxymethyl (TOM), can create significant steric hindrance, leading to reduced coupling efficiency between RNA and nucleic acids. Therefore, deprotection is also necessary.

[0006] Triethylamine trihydrofluoride is a commonly used reagent for removing silane protecting groups. It is often used as an RNA deprotecting agent by mixing 1-methyl-2-pyrrolidone, triethylamine trihydrofluoride, and triethylamine. The deprotection is achieved by reacting triethylamine trihydrofluoride with the 2' hydroxyl protecting group. However, the added buffer triethylamine tends to depurinate, resulting in the generation of too many byproducts, damage to the intact structure of RNA, and failure of RNA synthesis.

[0007] The objective of this invention can be achieved through the following technical solutions:

[0008] An RNA deprotecting agent comprises the following components in parts by volume: 60 parts 1-methyl-2-pyrrolidone, 30 parts dimethylethanolamine hydrofluoric acid, and 40 parts dimethylethanolamine; the dimethylethanolamine hydrofluoric acid is an acidic compound with deprotecting activity, capable of removing the 2' hydroxyl protecting group to obtain the 2' hydroxyl group, and the dimethylethanolamine is used to provide a suitable buffer environment.

[0009] As a further aspect of the present invention, the dimethylethanolamine hydrofluoric acid salt is synthesized via the following steps:

[0010] Dimethylethanolamine was added to a sealed reaction vessel, cooled in an acetone dry ice bath for 10-20 min, and then anhydrous hydrogen fluoride was introduced into the condenser. The mixture was then heated in an acetone dry ice bath for 10-15 min and heated to 25±2℃ at a heating rate of 0.5-1℃ / min to obtain dimethylethanolamine hydrofluoric acid salt.

[0011] As a further embodiment of the present invention, the mass ratio of dimethylethanolamine to anhydrous hydrogen fluoride is 42.5:87.5-100.

[0012] As a further aspect of the present invention, the application of the RNA deprotecting agent to RNA deprotection includes the following steps:

[0013] Step 1: Synthesis of crude RNA: RNA was synthesized using the solid-phase phosphoramidite method to obtain crude RNA.

[0014] Step 2, Ammonolysis in a water bath: Put the crude RNA into a spiral tube, add 400 μL of 50% methylamine aqueous solution, and ammonoly hydrate in a water bath at 65℃ for 1.5 h. After cooling to 25±5℃, transfer to a filter tube and centrifuge at 13000 r / min for 2 min. Transfer the filtered crude RNA to a centrifuge tube and place it in a dehydrator for drying. After the RNA is dried, dehydrate for another 20 min to ensure there is no ammonia odor.

[0015] Step 3: Add 1000 μL of RNA deprotecting agent to the centrifuge tube from Step 2 after drying, heat in a 65°C water bath for 3 hours, cool to 25±5°C, add 1000 μL of n-butanol, let stand at 4°C for 1 hour, centrifuge at 13000 r / min for 20 minutes, discard the supernatant, place in a desiccator for drying, dissolve in 200 μL of LEPC water to obtain crude RNA with the 2' end silane protecting group removed, thus completing RNA deprotection.

[0016] As a further embodiment of the present invention, the RNA deprotectant in step three is prepared by the following steps: mixing 1-methyl-2-pyrrolidone, dimethylethanolamine hydrofluoric acid and dimethylethanolamine in a volume ratio of 6:3:4 and stirring to obtain the RNA deprotectant.

[0017] The beneficial effects of this invention are:

[0018] This invention synthesizes dimethylethanolamine hydrofluoric acid from dimethylethanolamine and anhydrous hydrogen fluoride. Dimethylethanolamine hydrofluoric acid is used as an active compound to remove the 2'-terminal silane protecting group of RNA. Dimethylethanolamine hydrofluoric acid is an acidic compound with deprotection activity, which can remove the 2'-hydroxyl protecting group to obtain the 2'-hydroxyl group. Dimethylethanolamine provides a suitable buffer environment. 1-methyl-2-pyrrolidone, dimethylethanolamine hydrofluoric acid and dimethylethanolamine are mixed in a volume ratio of 6:3:4 to prepare an RNA deprotecting agent, which can be applied to the deprotection of the 2'-terminal silane protecting group of crude RNA synthesized by solid-phase phosphoramidite method and subjected to water bath ammonolysis.

[0019] The RNA deprotectant of this invention, compared with existing RNA deprotectants using triethylamine trihydrofluoride and triethylamine as raw materials, can reduce the degree of RNA depurination, reduce the generation of by-products, improve the purity of RNA synthesis, and increase the success rate of RNA synthesis. The main reasons are as follows:

[0020] The methyl group in triethylamine is an electron-donating group, resulting in a higher electron cloud density on the nitrogen atom and thus a stronger basicity. In contrast, the oxygen group in dimethylethanolamine is an electron-withdrawing group, making dimethylethanolamine weaker in basicity than triethylamine. This reduces the degree of depurination, thereby decreasing the production of byproducts, increasing the purity of RNA synthesis, and improving the success rate of RNA synthesis. Detailed Implementation

[0021] The technical solutions of the present invention will be clearly and completely described below with reference to the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative effort are within the scope of protection of the present invention.

[0022] Example 1

[0023] An RNA deprotectant is prepared by the following steps:

[0024] Step 1: Add 42.5g of dimethylethanolamine to a sealed reaction vessel, cool in an acetone dry ice bath for 10 min, then condense and pass in 87.5g of anhydrous hydrogen fluoride, then heat in an acetone dry ice bath for 10 min, and heat to 25±2℃ at a heating rate of 0.5℃ / min to obtain dimethylethanolamine hydrofluoric acid salt.

[0025] Step 2: Mix 1-methyl-2-pyrrolidone, dimethylethanolamine hydrofluoric acid and dimethylethanolamine in a volume ratio of 6:3:4 and stir to obtain RNA deprotectant.

[0026] Example 2

[0027] An RNA deprotectant is prepared by the following steps:

[0028] Step 1: Add 42.5g of dimethylethanolamine to a sealed reaction vessel, cool in an acetone dry ice bath for 20min, condense and pass in 100g of anhydrous hydrogen fluoride, then heat in an acetone dry ice bath for 10-15min, and heat to 25±2℃ at a heating rate of 0.5-1℃ / min to obtain dimethylethanolamine hydrofluoric acid salt.

[0029] Step 2: Mix 1-methyl-2-pyrrolidone, dimethylethanolamine hydrofluoric acid and dimethylethanolamine in a volume ratio of 6:3:4 and stir to obtain RNA deprotectant.

[0030] Comparative Example 1

[0031] An RNA deprotectant is prepared by the following steps:

[0032] 1-Methyl-2-pyrrolidone, triethylamine hydrofluoric acid and triethylamine were mixed and stirred in a volume ratio of 6:3:4 to obtain an RNA deprotectant.

[0033] Comparative Example 2

[0034] An RNA deprotectant is prepared by the following steps:

[0035] Step 1: Add 42.5g of dimethylethanolamine to a sealed reaction vessel, cool in an acetone dry ice bath for 10 min, then condense and pass in 87.5g of anhydrous hydrogen fluoride, then heat in an acetone dry ice bath for 10 min, and heat to 25±2℃ at a heating rate of 0.5℃ / min to obtain dimethylethanolamine hydrofluoric acid salt.

[0036] Step 2: Mix 1-methyl-2-pyrrolidone, dimethylethanolamine hydrofluoric acid and triethylamine in a volume ratio of 6:3:4 and stir to obtain RNA deprotectant.

[0037] Compared with Example 1, this comparative example only replaces "dimethylethanolamine" with "triethylamine", and all other steps and parameters are the same.

[0038] Example 3

[0039] An RNA deprotectant is applied to RNA deprotection, comprising the following steps:

[0040] Step 1, Crude RNA Synthesis: RNA (nucleotide sequence of RNA is: UAUAUAUAUAUAUAGAGAUAUAUAUAUAUAUA) is synthesized using the solid-phase phosphoramide triester method to obtain crude RNA;

[0041] Step 2, Ammonolysis in a water bath: Put the crude RNA into a spiral tube, add 400 μL of 50% methylamine aqueous solution, and ammonoly hydrate in a water bath at 65℃ for 1.5 h. After cooling to 25±5℃, transfer to a filter tube and centrifuge at 13000 r / min for 2 min. Transfer the filtered crude RNA to a centrifuge tube and place it in a dehydrator for drying. After the RNA is dried, dehydrate for another 20 min to ensure there is no ammonia odor.

[0042] Step 3: Add 1000 μL of the RNA deprotecting agent prepared in Example 1 to the centrifuge tube after drying in Step 2. Heat in a water bath at 65°C for 3 hours, cool to 25±5°C, add 1000 μL of n-butanol, let stand at 4°C for 1 hour, centrifuge at 13000 r / min for 20 minutes, remove the supernatant, place in a desiccator for drying, add 200 μL of LEPC water to dissolve, and obtain crude RNA with the 2' end silane protecting group removed, thus completing RNA deprotection.

[0043] Example 4

[0044] An RNA deprotectant is applied to RNA deprotection, comprising the following steps:

[0045] Step 1, Crude RNA Synthesis: RNA (nucleotide sequence of RNA is: UAUAUAUAUAUAUAGAGAUAUAUAUAUAUAUA) is synthesized using the solid-phase phosphoramide triester method to obtain crude RNA;

[0046] Step 2, Ammonolysis in a water bath: Put the crude RNA into a spiral tube, add 400 μL of 50% methylamine aqueous solution, and ammonoly hydrate in a water bath at 65℃ for 1.5 h. After cooling to 25±5℃, transfer to a filter tube and centrifuge at 13000 r / min for 2 min. Transfer the filtered crude RNA to a centrifuge tube and place it in a dehydrator for drying. After the RNA is dried, dehydrate for another 20 min to ensure there is no ammonia odor.

[0047] Step 3: Add 1000 μL of the RNA deprotecting agent prepared in Example 2 to the centrifuge tube after drying in Step 2, heat in a water bath at 65°C for 3 hours, cool to 25±5°C, add 1000 μL of n-butanol, let stand at 4°C for 1 hour, centrifuge at 13000 r / min for 20 minutes, remove the supernatant, place in a desiccator for drying, add 200 μL of LEPC water to dissolve, and obtain crude RNA with the 2' end silane protecting group removed, thus completing RNA deprotection.

[0048] Comparative Example 3

[0049] An RNA deprotectant is applied to RNA deprotection, comprising the following steps:

[0050] Step 1, Crude RNA Synthesis: RNA (nucleotide sequence of RNA is: UAUAUAUAUAUAUAGAGAUAUAUAUAUAUAUA) is synthesized using the solid-phase phosphoramide triester method to obtain crude RNA;

[0051] Step 2, Ammonolysis in a water bath: Put the crude RNA into a spiral tube, add 400 μL of 50% methylamine aqueous solution, and ammonoly hydrate in a water bath at 65℃ for 1.5 h. After cooling to 25±5℃, transfer to a filter tube and centrifuge at 13000 r / min for 2 min. Transfer the filtered crude RNA to a centrifuge tube and place it in a dehydrator for drying. After the RNA is dried, dehydrate for another 20 min to ensure there is no ammonia odor.

[0052] Step 3: Add 1000 μL of the freshly prepared RNA deprotecting agent from Comparative Example 1 to the centrifuge tube after drying in Step 2. Heat in a water bath at 65°C for 3 hours, cool to 25±5°C, add 1000 μL of n-butanol, let stand at 4°C for 1 hour, centrifuge at 13000 r / min for 20 minutes, remove the supernatant, place in a desiccator for drying, dissolve in 200 μL of LEPC water to obtain crude RNA with the 2' end silane protecting group removed, thus completing RNA deprotection.

[0053] Compared with Example 3, this comparative example only replaces "1000 μL of RNA deprotectant prepared freshly in Example 1" with "1000 μL of RNA deprotectant prepared freshly in Comparative Example 1". All other steps and parameters are the same.

[0054] Comparative Example 4

[0055] An RNA deprotectant is applied to RNA deprotection, comprising the following steps:

[0056] Step 1, Crude RNA Synthesis: RNA (nucleotide sequence of RNA is: UAUAUAUAUAUAUAGAGAUAUAUAUAUAUAUA) is synthesized using the solid-phase phosphoramide triester method to obtain crude RNA;

[0057] Step 2, Ammonolysis in a water bath: Put the crude RNA into a spiral tube, add 400 μL of 50% methylamine aqueous solution, and ammonoly hydrate in a water bath at 65℃ for 1.5 h. After cooling to 25±5℃, transfer to a filter tube and centrifuge at 13000 r / min for 2 min. Transfer the filtered crude RNA to a centrifuge tube and place it in a dehydrator for drying. After the RNA is dried, dehydrate for another 20 min to ensure there is no ammonia odor.

[0058] Step 3: Add 1000 μL of the freshly prepared RNA deprotecting agent from Comparative Example 2 to the centrifuge tube after drying in Step 2. Heat in a water bath at 65°C for 3 hours, cool to 25±5°C, add 1000 μL of n-butanol, let stand at 4°C for 1 hour, centrifuge at 13000 r / min for 20 minutes, remove the supernatant, place in a desiccator for drying, dissolve in 200 μL of LEPC water to obtain crude RNA with the 2' end silane protecting group removed, thus completing RNA deprotection.

[0059] Compared with Example 3, this comparative example only replaces "1000 μL of RNA deprotectant prepared freshly in Example 1" with "1000 μL of RNA deprotectant prepared freshly in Comparative Example 2". All other steps and parameters are the same.

[0060] The following performance tests were performed on Examples 3-4 and Comparative Examples 3-4:

[0061] The degree of adenine removal and the purity of the crude RNA after the removal of the 2'-terminal silane protecting group were determined using a Ultivo UHPLC-QQQ / MS triple quadrupole tandem mass spectrometer (Agilent Technologies, USA).

[0062] Chromatographic conditions: Zorbax Eclipse Plus C18 column (100 mm × 2.1 mm, 1.8 μm, Agilent Technologies); guard column: C18 guard column (5.0 mm × 2.1 mm, 1.8 μm, Agilent Technologies); column temperature: 30 °C; injection volume: 1 μL; mobile phase A: 20 mmol / L ammonium formate; mobile phase B: methanol; flow rate: 0.3 mL / min; gradient elution program: 0–2.0 min, 5% B; 2.0–2.5 min, 5%–12% B; 2.5–5.0 min, 12% B; 5.0–5.5 min, 12%–100% B; 5.5–8.0 min, 100% B; 8.0–8.1 min, 100%–5% B; 8.1–8.4 min, 5% B.

[0063] Mass spectrometry conditions: capillary voltage 4.0 kV; gas temperature 350 °C; drying gas nitrogen, flow rate 10 L / min; nebulizing gas nitrogen, pressure 30 psi (1 psi = 6.89 kPa); ionization method electrospray ionization (ESI), positive ion mode; ion detection method multiple reaction monitoring (MRM) mode.

[0064] The test results are shown in Table 1.

[0065] Table 1

[0066] project Example 3 Example 4 Comparative Example 3 Comparative Example 4 Purity of crude RNA (%) 70.8 71.4 65.8 58.2 Purine content / % 1.1 1.2 4.6 5.2

[0067] As can be seen from Table 1, the purity of the crude RNA with the 2' end silane protecting group removed in Examples 3-4 of the present invention is higher than that of the crude RNA with the 2' end silane protecting group removed in Comparative Examples 3-4, and the degree of depurination is lower.

[0068] It should be noted that, in this document, relational terms such as "first" and "second" are used only to distinguish one entity or operation from another, and do not necessarily require or imply any such actual relationship or order between these entities or operations. Furthermore, the terms "comprising," "including," or any other variations thereof are intended to cover non-exclusive inclusion, such that a process, method, article, or apparatus that comprises a list of elements includes not only those elements but also other elements not expressly listed, or elements inherent to such process, method, article, or apparatus.

[0069] Although embodiments of the invention have been shown and described, it will be understood by those skilled in the art that various changes, modifications, substitutions and alterations can be made to these embodiments without departing from the principles and spirit of the invention, the scope of which is defined by the appended claims and their equivalents.

Claims

1. An RNA deprotectant, characterized in that, It comprises the following components by volume: 60 parts 1-methyl-2-pyrrolidone, 30 parts dimethylethanolamine hydrofluoric acid, and 40 parts dimethylethanolamine.

2. The RNA deprotectant according to claim 1, wherein the dimethylethanolamine hydrofluoric acid is synthesized via the following steps: Dimethylethanolamine was added to a sealed reaction vessel, cooled in an acetone dry ice bath for 10-20 min, and then anhydrous hydrogen fluoride was introduced into the condenser. The mixture was then heated in an acetone dry ice bath for 10-15 min and heated to 25±2℃ at a heating rate of 0.5-1℃ / min to obtain dimethylethanolamine hydrofluoric acid salt.

3. The RNA deprotectant according to claim 2, characterized in that, In the synthesis of dimethylethanolamine hydrofluoric acid, the mass ratio of dimethylethanolamine to anhydrous hydrogen fluoride is 42.5:87.5-100.

4. The application of an RNA deprotectant according to any one of claims 1-3, characterized in that, The procedure for deprotecting RNA includes the following steps: Step 1: Synthesis of crude RNA: RNA was synthesized using the solid-phase phosphoramidite method to obtain crude RNA. Step 2, Ammonolysis in a water bath: The crude RNA was packed into a spiral tube, and 400 μL of 50% methylamine aqueous solution was added. After ammonolysis in a water bath at 65°C for 1.5 h, the mixture was cooled to 25±5°C and transferred to a filter tube. The mixture was centrifuged at 13000 r / min for 2 min. The filtered crude RNA was then transferred to a centrifuge tube and placed in a desiccator for further desiccation. After the RNA was desiccated, the desiccator was desiccated for another 20 min. Step 3: Add 1000 μL of RNA deprotectant to the centrifuge tube from Step 2 after drying, heat in a 65°C water bath for 3 hours, cool to 25±5°C, add 1000 μL of n-butanol, let stand at 4°C for 1 hour, centrifuge at 13000 r / min for 20 minutes, discard the supernatant, place in a desiccator for drying, add 200 μL of LEPC water to dissolve, and complete the RNA deprotection.

Citation Information

Patent Citations

  • Method for removal of nucleic acid-protecting group

    CN101421289A

  • Graphene electronic biosensor based on nucleic acid aptamer modification as well as preparation method and application of graphene electronic biosensor

    CN114624297A