A KASP molecular marker primer set for identifying five-leaf strawberry and its application

Abstract

The present invention relates to the field of molecular biotechnology, and specifically discloses a KASP molecular marker primer set for identifying five-leaf strawberry and an application thereof, wherein the KASP molecular marker primer set comprises F1, F2 and R primers, the nucleotide sequence of the F1 primer is shown in SEQ ID NO.1, the nucleotide sequence of the F2 primer is shown in SEQ ID NO.2, and the nucleotide sequence of the R primer is shown in SEQ ID NO.3. The KASP molecular marker primer set provided by the present invention can quickly and stably screen and identify five-leaf strawberry germplasm resources, significantly distinguish five-leaf strawberry resources, and effectively accelerate genetic diversity and genetic structure analysis.

Description

Technical Field

[0001] The invention relates to the field of molecular biotechnology, and in particular to a KASP molecular marker primer set for identifying five-leaf strawberry and an application thereof. Background Art

[0002] At present, molecular marker screening methods are developing rapidly. Genome-Wide Association Study (GWAS) is an analytical method that has gradually developed in recent years to study the association between variant sequences and phenotypes in the whole genome. It can analyze whether the allele frequency of SNP (single nucleotide polymorphism) is associated with the phenotypic trait value, so as to locate the gene or genomic region that causes phenotypic variation between individuals, and then screen out molecular markers associated with phenotypic variation of a certain trait. GWAS research can make full use of the recombination events that occur over thousands of generations during population evolution, increase positioning efficiency by breaking linkage disequilibrium or the correlation of polymorphic sites within a chromosome region, and become a hot spot in genomic research with its advantages such as simplicity, ease of operation and high throughput.

[0003] SNP molecular markers are numerous in the entire genome, distributed at a high density, have high sensitivity, low mutation frequency, and are easy to genotype. They are currently the most promising molecular markers. It is a dimorphic marker, and the ability to distinguish between single marker sites is weak. It is necessary to combine multiple specific sites to form a specific fingerprint to distinguish varieties, requiring a high-throughput detection platform. As a genetic marker widely present in animals and plants, SNP plays a great role in genetic variation linkage mapping, population analysis, and association analysis. Competitive allele-specific PCR (kompetitive allele-specific PCR, KASP) technology is a high-throughput genotyping technology mainly based on SNP that has been developed in recent years. This technology has attracted much attention in the field of genetic improvement of crop traits due to its advantages of high throughput, low cost and strong operability. At present, KASP molecular markers have been widely used in crops such as sweet peppers, wheat, and soybeans, mainly used in the construction of genetic maps and identification of germplasm resources, but there are few reports on their application in strawberries.

[0004] China is the country with the richest wild strawberry resources in the world, with 15 of the 26 species of the genus Fragaria, including 10 diploid and 5 tetraploid species. There are many species of wild strawberries, with rich phenotypic diversity. Some wild strawberry resources are difficult to distinguish in morphology, and the phenotypic traits of the plants will also vary due to ecological and environmental conditions. Five-leaf strawberry (Frageria pentaphylla Losinsk.) is a diploid species native to my country. It is widely distributed in Sichuan, Shaanxi, Gansu and other places centered on the Qinba Mountain area. It mostly grows on hillside grasslands at an altitude of 700 to 2300 meters. Compared with other diploid wild strawberry resources, it has stronger disease resistance and waterlogging resistance. Its fruit color, size, quality, fragrance, as well as leaves, runners, plants and other aspects vary greatly, and it has extensive genetic diversity. Traditional methods for identifying germplasm resources are mainly based on morphological trait surveys. However, China has abundant wild strawberry resources, and the distribution areas of different wild species overlap, making it difficult to distinguish between these resource types. Moreover, the distribution range of five-leaf strawberry itself is wide and its morphological traits vary greatly. Traditional methods for identifying germplasm resources are time-consuming and labor-intensive, which has become one of the bottlenecks in improving the efficiency of germplasm resource identification. Therefore, it is particularly important to screen out molecular markers that can identify five-leaf strawberry. Summary of the invention

[0005] In order to enrich the molecular markers for identifying five-leaf strawberry, the present invention provides a KASP molecular marker primer set for identifying five-leaf strawberry and an application thereof. The KASP molecular marker primer set provided by the present invention can quickly and stably screen and identify five-leaf strawberry germplasm resources, significantly distinguish five-leaf strawberry resources, and effectively accelerate genetic diversity and genetic structure analysis.

[0006] The invention provides a KASP molecular marker primer set for identifying five-leaf strawberry, wherein the molecular marker is A05C22779367, and the primer set comprises an F1 primer, an F2 primer and an R primer;

[0007] The nucleotide sequence of the F1 primer is shown in SEQ ID NO.1;

[0008] The nucleotide sequence of the F2 primer is shown in SEQ ID NO.2;

[0009] The nucleotide sequence of the R primer is shown in SEQ ID NO.3.

[0010] The present invention also provides a chip, comprising the KASP molecular marker primer set.

[0011] The present invention also provides a detection kit, comprising the KASP molecular marker primer set.

[0012] Furthermore, the primer set is in a powder solid or liquid state.

[0013] The present invention also provides a method for genotyping five-leaf strawberry germplasm resources using the KASP molecular marker primer set for identifying five-leaf strawberry, comprising the following steps:

[0014] S1, using the DNA of Fragaria quinquefolia as a template and using the primer set to perform PCR amplification;

[0015] S2, reading and processing fluorescence values: reading the fluorescence values ​​of the system after PCR amplification, standardizing the data fluorescence values, obtaining the relative fluorescence values ​​corresponding to VIC and FAM of each system after PCR amplification, clustering the samples according to the relative fluorescence values, and determining the genotype according to the sample clusters and fluorescence types;

[0016] S3, Genotyping verification: Genotyping verification is carried out on different diploid wild strawberry resources to screen out target molecular markers and primer pairs.

[0017] Furthermore, in S2, the fluorescence value result data read were analyzed using the genotype reading software of LGC_OMEGA, and the genotyping data were drawn using the genotype reading software of Douglas.

[0018] The present invention also provides the application of the KASP molecular marker primer set in identifying wild strawberry germplasm resources.

[0019] Furthermore, the wild strawberry germplasm resources include five-leaf strawberry, Chinese strawberry, Tibetan strawberry, yellow-haired strawberry, Emei strawberry, Northeast strawberry, green strawberry and forest strawberry.

[0020] Furthermore, the criteria for judging the results of the wild strawberry germplasm resource identification are:

[0021] For the molecular marker A05C22779367, if the genotype of the detection site is T / T or T / C (C / T), the identification category of the wild strawberry germplasm resource is five-leaf strawberry.

[0022] The present invention also provides application of the chip or detection kit in identifying wild strawberry germplasm resources.

[0023] Compared with the prior art, the present invention has the following beneficial effects:

[0024] 1. The present invention provides a core KASP molecular marker A05C22779367 for identification of five-leaf strawberry germplasm resources developed based on GWAS analysis and SNP technology. It can quickly, accurately and effectively identify and evaluate germplasm resource materials, is not restricted by the environment, season and gene expression, and can be identified from the seedling stage of five-leaf strawberry plants. It can solve the problems of resource redundancy, inconvenient storage and management, and intellectual property disputes caused by the accumulation of a large amount of germplasm. It provides molecular markers for the construction of genetic maps, gene positioning, molecular-assisted breeding, etc., and lays a good foundation for the establishment of a standardized, high-throughput, low-cost molecular detection technology platform;

[0025] 2. The present invention provides a method for rapidly, effectively and stably identifying five-leaf strawberry germplasm resources. The identification of samples can be completed by simple DNA extraction, PCR specific amplification and KASP genotyping detection. No restriction endonuclease digestion is required, the marker has strong specificity and high stability, and the marker screening method is simple and fast to operate, has the advantages of small amount of test reagents, high speed, low cost, suitability for large batches, high throughput and automation, and is very suitable for the realization of modern agricultural molecular breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0027] Figure 1 This is the typing diagram of KASP marker A05C22779367 in the present invention. DETAILED DESCRIPTION

[0028] The specific embodiments of the present invention are described in detail below, but it should be understood that the protection scope of the present invention is not limited by the specific embodiments. Based on the embodiments in the present invention, all other embodiments obtained by ordinary technicians in this field without creative work belong to the scope of protection of the present invention. The experimental methods described in the embodiments of the present invention are conventional methods unless otherwise specified, and the materials, reagents, etc. used in the following embodiments can be obtained from commercial channels unless otherwise specified.

[0029] Example 1: Screening of KASP primer sets for identifying Fragaria quinquefolia.

[0030] 1. Obtaining the genomic DNA of Fragaria quinquefolia

[0031] The young leaves of Strawberry were used as materials and the genomic DNA was extracted by the modified CTAB method. The specific steps are as follows:

[0032] 1. Grind the young leaves into powder in liquid nitrogen, quickly put them into a sterilized 2 mL centrifuge tube, and temporarily store them in liquid nitrogen.

[0033] 2. Preheat the water bath to 65°C and preheat 600 μL 2% CTAB and 2 μL β-agarose acetate.

[0034] 3. Mix the powder quickly with the solution, shake well, and place in a 65°C water bath for 30 minutes. Take it out and shake it every 5 minutes, and let it stand at room temperature for the last 5 minutes.

[0035] 4. Centrifuge at 10,000 rpm for 10 min at 4°C. Prepare a new centrifuge tube, aspirate the supernatant, add 612 μL of chloroform-isoamyl alcohol (24:1), and shake and mix at room temperature for 5 min.

[0036] 5. Centrifuge at 10,000 rpm for 10 min at 4°C. Prepare a new centrifuge tube, aspirate 250 μL of the supernatant, add 30 μL of NaAc and twice the volume of 500 μL of ice ethanol, and let it settle at -80°C for 2 h (or at -20°C overnight).

[0037] 6. Take out the precipitated DNA, centrifuge at 10000rpm for 10min, discard 500μL of supernatant and keep the precipitate.

[0038] 7. Add 500 μL of 75% ethanol to the precipitate, mix by pipetting, and centrifuge at 8000 rpm for 3 min.

[0039] 8. Discard the supernatant, add 500 μL of 100% ice-cold ethanol, pipette and mix, and centrifuge at 8000 rpm for 3 min.

[0040] 9. Aspirate the residual liquid in the tube, add 45 μL ddH2O and centrifuge instantly.

[0041] 10. Detect concentration, dilute DNA to 10 ng / μL and store at -20℃.

[0042] 11. DNA concentration detection: Randomly select several DNA working solutions, use NanoDrop 2000 to measure the concentration, and dilute the DNA stock solution to 10 ng / μL.

[0043] 2. Genome-wide association study (GWAS) of natural wild strawberry populations

[0044] Using widely collected wild strawberry germplasm materials as natural populations, through phenotypic observation and recording, whole genome resequencing of 118 wild strawberries was performed, combined with previous phenotypic data, whole genome association analysis was carried out, and trait-related molecular markers were developed. Based on resequencing, a total of 830,537 SNPs were obtained through sequencing data quality control and sequence alignment analysis.

[0045] 3. SNP site screening

[0046] Combined with genome-wide SNP markers and wild strawberry germplasm phenotypic survey data, the MLM (QK) model in gemma software was used, and the population structure matrix corresponding to the optimal K value of Admixture was used as the Q matrix of the corresponding model, and the kinship matrix between samples calculated by gcta software was used as the K matrix of the corresponding model for association analysis. When the threshold was 0.05, a total of 117 SNPs may be associated with the identification of five-leaf strawberry germplasm resources, of which 8 were located on chromosome 1, 16 were located on chromosome 2, 18 were located on chromosome 3, 12 were located on chromosome 4, 16 were located on chromosome 5, 19 were located on chromosome 6, and 28 were located on chromosome 7. With 50kb as the annotation interval size, 1563 candidate genes were included.

[0047] 4. Development of KASP Marker for Five-Leaf Strawberry

[0048] According to the GWAS results, SNP sites were selected to develop markers into KASP markers. The selected sequences were compared with the diploid forest strawberry genome, and qualified sequences were selected to develop KASP markers.

[0049] Based on the above results, 14 SNP sequences were selected for KASP marker development and design according to the specific information of the SNP markers, such as the chromosomal position and flanking sequences. Only SNP sites with successful primer design were considered qualified KASP markers, and qualified KASP markers were used for subsequent verification and analysis.

[0050] 5. KASP genotyping

[0051] The whole genome DNA of young leaf tissue of Strawberry quinquefolia was extracted according to the method of Example 1 and set aside.

[0052] 1. Primer dilution

[0053] Dilute the primer powder to 100 μL / mL, and then dilute the three sequences according to the ratio of F1:F2:R:water=24:24:48:100.

[0054] 2. DNA dilution

[0055] The DNA was uniformly diluted to 10 ng / μL.

[0056] 3. PCR reaction system

[0057] The PCR reaction system is shown in Table 1.

[0058] Table 1 PCR reaction system

[0059] name 384-well plate (4 μL system) 2xTaq DNA Polymerase Mix 2μL SNP Primer Mix (4x) 1μL DNA samples 2μL

[0060] 4. PCR amplification system

[0061] SNP site detection uses a set of thermal cycling conditions including two temperature steps, rather than the traditional three steps. In the present invention, DNA is denatured at a higher temperature and then annealed and extended at a lower temperature. The specific PCR thermal cycling conditions are shown in the table. PCR thermal cycle amplification can be performed on any suitable PCR gene amplifier, and the PCR amplification system is shown in Table 2.

[0062] Table 2 PCR amplification system

[0063]

[0064] 5. Fluorescence value reading

[0065] After the PCR amplification cycle is completed, the fluorescence value is read using a fluorescence quantitative PCR instrument in an environment below 40°C. In this method, SNP site detection uses fluorophores FAM and VIC to distinguish two isogenic loci. Passive reference dye ROX is used to correct the signal difference between wells due to reaction volume errors. The relevant excitation and emission wavelengths are shown in Table 3 below. The reading software is LGC's OEM equipment. The fluorescence value reading wavelength is shown in Table 3.

[0066] Table 3 Fluorescence value reading wavelength

[0067] Fluorophore Excitation light (nm) Emitted light (nm) FAM 485 520 VIC 535 556 ROX 575 610

[0068] Note: If the fluorescence scanning instrument uses the HEX fluorophore as the detection signal, no modification of the setup is required because the excitation and emission values ​​of VIC and HEX are very similar.

[0069] 6. Data analysis and genotype data acquisition

[0070] (1) Douglas gene analysis results

[0071] The result data of the fluorescence value reading in 5 was analyzed using Douglas' genotype reading software. In this software, VIC and FAM data are plotted on the x-axis and y-axis respectively. The VIC and FAM values ​​of each reaction well are corrected by the value of the reference dye (ROX) of the specific well, and the data fluorescence value is standardized to obtain the relative fluorescence value corresponding to VIC and FAM of each PCR reaction well (PCR amplification system). According to the relative fluorescence value, the samples are clustered and further determined according to the sample cluster and fluorescence type.

[0072] Genotyping data plotted by Douglas' Genotype Reader software. Genotyped samples marked in red are homozygous for the VIC-marked allele, samples marked in blue are homozygous for the FAM-marked allele, and samples marked in green are heterozygous.

[0073] (2) Explanation of LGC_OMEGA gene analysis results

[0074] The result data of the fluorescence value reading was analyzed using the genotype reading software (Kluster Caller) of LGC_OMEGA. In this software, VIC and FAM data are plotted on the x-axis and y-axis, respectively. The VIC and FAM values ​​of each reaction well are corrected by the value of the reference dye (ROX) of the specific well, and the data fluorescence values ​​are standardized to obtain the relative fluorescence values ​​corresponding to VIC and FAM of each PCR reaction well. According to the relative fluorescence values, the samples are clustered and further determined according to the sample clusters and fluorescence types.

[0075] 7. SNP molecular marker genotyping verification

[0076] According to the specific information of SNP markers such as chromosome location and flanking sequence, 14 SNPs were selected for KASP marker development and design. The KASP markers obtained by screening were used for genotyping verification on different diploid wild strawberry resources, including 21 samples of five-leaf strawberry (Table 4), 11 samples of Chinese strawberry, 7 samples of Tibetan strawberry, 10 samples of yellow-haired strawberry, 2 samples of Emei strawberry, 2 samples of southwest strawberry, 2 samples of northeast strawberry, 1 sample of oriental strawberry, 1 sample of green strawberry and 5 samples of forest strawberry. The test results showed that 8 SNP molecular markers such as A02A15848237 and A06T7059184 were successfully typed in 62 samples, and the typing results of the remaining 6 markers were not different and were discarded. Finally, the KASP primers that locked 1 SNP molecular marker were related to the identification of five-leaf strawberry germplasm resources (Table 5). The site base type of the SNP molecular marker and its upstream and downstream sequences are shown in Table 6 (for primer design).

[0077] Table 4 21 five-leaf strawberry germplasm resources

[0078]

[0079]

[0080] Table 5 SNP molecular markers and KASP primers related to identification of five-leaf strawberry germplasm resources

[0081]

[0082] SEQ ID NO.1:

[0083] GAAGGTCGGAGTCAACGGATTTCCAGTCAGATTGTTTTTCTCAAA;

[0084] SEQ ID NO.2:

[0085] GAAGGTGACCAAGTTCATGCTTCCAGTCAGATTGTTTTTCTCAAG;

[0086] SEQ ID NO.3:

[0087] TTCCTTCAGAGCTTGGTTCCT.

[0088] Table 6 Base types of SNP marker sites and their upstream and downstream sequences

[0089]

[0090] The results of KASP molecular marker detection developed for target genes are as follows Figure 1 As shown in the figure, the horizontal axis is the fluorescence intensity of the FAM label, and the vertical axis is the fluorescence intensity of the VIC label. Different SNP genotypes in the same locus are distinguished respectively. The upper left and lower right ends have relatively high single-channel fluorescence values, which can be considered as homozygotes of different SNPs, and the middle ones are heterozygotes with both genotypes.

[0091] Example 2: Application of the KASP primer set for identifying five-leaf strawberry in identification of five-leaf strawberry germplasm resources.

[0092] The KASP primer set obtained above was used to identify the five-leaf strawberry germplasm resources.

[0093] 1. Samples to be tested

[0094] The information of 62 wild strawberry samples (wild strawberry germplasm resources) to be tested in this embodiment is shown in Table 7.

[0095] Table 7 62 wild strawberry germplasm resources (collected and preserved in the laboratory)

[0096]

[0097]

[0098]

[0099] 2. Identification Process

[0100] 1. Extract DNA from young leaves of five-leaf strawberry

[0101] The young leaves of five-leaf strawberry were used as materials, and the genomic DNA was extracted by the modified CTAB method. The specific steps are shown in Example 1. The DNA was uniformly diluted to 10 ng / μL.

[0102] 2. Primer dilution

[0103] Dilute the primer powder to 100 μL / mL, and then dilute the three sequences according to the ratio of F1:F2:R:water=24:24:48:100.

[0104] 3. PCR and real-time fluorescence quantitative detection

[0105] PCR was performed according to the reaction system in Table 2 and the amplification program in Table 3 in Example 1.

[0106] 4. Fluorescence value reading

[0107] Fluorescence readings were performed according to the method described in Example 1.

[0108] 5. Data analysis and genotype data acquisition

[0109] Data analysis and genotype data acquisition were performed according to the method described in Example 1.

[0110] 3. Experimental Results

[0111] The test results are shown in Table 8.

[0112] Table 8 Identification results of wild strawberry germplasm resources

[0113]

[0114]

[0115]

[0116] Note: “-” in the table means no results were detected.

[0117] From the above results, we can get;

[0118] For marker A05C22779367-T / C, if the genotype of the detection site is T / T or T / C (C / T), the identification category of the wild strawberry germplasm resource is five-leaf strawberry.

[0119] Although the preferred embodiments of the present invention have been described, those skilled in the art may make other changes and modifications to these embodiments once they have learned the basic creative concept. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments and all changes and modifications that fall within the scope of the present invention.

[0120] Obviously, those skilled in the art can make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if these modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalents, the present invention is also intended to include these modifications and variations.

Claims

1. A KASP molecular marker primer set for identifying five-leaf strawberry, characterized in that: The molecular marker is A05C22779367, and the primer set includes F1 primer, F2 primer and R primer; The nucleotide sequence of the F1 primer is shown in SEQ ID NO.1; The nucleotide sequence of the F2 primer is shown in SEQ ID NO.2; The nucleotide sequence of the R primer is shown in SEQ ID NO.3; The nucleotide sequence of the molecular marker A05C22779367 is shown in SEQ ID NO.4, wherein "n" represents "C" or "T".

2. A chip, characterized in that: The invention comprises the KASP molecular marker primer set as claimed in claim 1.

3. A detection kit, characterized in that: The invention comprises the KASP molecular marker primer set as claimed in claim 1.

4. The chip according to claim 2 or the detection kit according to claim 3, characterized in that: The primer set is in powder solid or liquid state.

5. A method for genotyping five-leaf strawberry germplasm resources using the KASP molecular marker primer set for identifying five-leaf strawberry according to claim 1, characterized in that: The steps include: S1, using the DNA of Fragaria quinquefolia as a template and using the primer set to perform PCR amplification; S2, reading and processing fluorescence values: reading the fluorescence values ​​of the system after PCR amplification, standardizing the data fluorescence values, obtaining the relative fluorescence values ​​corresponding to VIC and FAM of each system after PCR amplification, clustering the samples according to the relative fluorescence values, and determining the genotype according to the sample clusters and fluorescence types.

6. The method according to claim 5, characterized in that In S2, the fluorescence value result data were analyzed using the LGC_OMEGA genotype reading software, and the genotyping data were drawn using the Douglas genotype reading software.

7. An application of the KASP molecular marker primer set according to claim 1 in identifying Fragaria quinquefolia in wild strawberry germplasm resources, characterized in that: The wild strawberry germplasm resource species are selected from five-leaf strawberry, Chinese strawberry, Tibetan strawberry, yellow-haired strawberry, Emei strawberry, Northeast strawberry, green strawberry and forest strawberry.

8. The use according to claim 7, characterized in that: The five-leaf strawberry germplasm resource identification result judgment standard is: For the molecular marker A05C22779367, if the genotype of the detection site is T / T or T / C (C / T), the identification category of the wild strawberry germplasm resource is five-leaf strawberry.

9. Use of the chip according to claim 2 or the detection kit according to claim 3 in identifying five-leaf strawberry in wild strawberry germplasm resources, characterized in that: The wild strawberry germplasm resource species are selected from five-leaf strawberry, Chinese strawberry, Tibetan strawberry, yellow-haired strawberry, Emei strawberry, Northeast strawberry, green strawberry, and forest strawberry.

Images