A method for establishing a mouse model of intestinal source cognitive impairment

The Rank CKO homozygous mouse model was constructed through CRISPR Cas9 technology, and the intestinal M cells were specifically knocked out, which solved the lack of intestinal cognitive impairment model and achieved scientific research on intestinal and cognitive impairment.

CN117121876BActive Publication Date: 2025-07-22AFFILIATED HOSPITAL OF GUANGDONG MEDICAL UNIV
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202211383631.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-11-07
Publication Date
2025-07-22
Estimated Expiration
2042-11-07

AI Technical Summary

Technical Problem

There is currently a lack of effective animal models of intestinal cognitive impairment, which limits scientific research on the relationship between intestinal tract and cognitive impairment.

Method used

Using CRISPR Cas9 technology, a homozygous mouse model of Rank CKO was constructed by crossing Vil1in-Cre transgenic mice and Tnfrsf11a Flox transgenic mice, specifically knocking out intestinal M cells to simulate intestinal cognitive impairment.

Benefits of technology

A stable mouse model of intestinal cognitive impairment was successfully established for scientific research, and scientific research on the intestinal and cognitive directions was realized, which improved the success rate of the research.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN117121876B_ABST
    Figure CN117121876B_ABST
Patent Text Reader

Abstract

The present invention relates to a method for establishing a mouse model of intestinal source cognitive impairment, belonging to the field of biotechnology. Based on Vil1in-Cre transgenic mice and Tnfrsf11a Flox transgenic mice, using the Cre-Loxp conditional gene knockout technology, after hybridizing the two types of mice, homozygous mice with specific knockout of intestinal M cells (Rank CKO) are obtained, solving the limitation of the current lack of animal models of intestinal source cognitive impairment for scientific research. The mouse model of intestinal source cognitive impairment obtained by this method can be used for scientific research in the direction of intestine and cognition, and realizes stable model establishment with a high success rate.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to a method for establishing a mouse model, specifically to a method for establishing a mouse model of intestinal source cognitive impairment, and belongs to the field of biotechnology. Background Art

[0002] Cognitive function is a set of functions, including memory, general intelligence, learning, language, orientation, perception, attention, judgment, and concentration. Cognitive dysfunction, also known as cognitive decline, generally refers to a state in which cognitive function is damaged to varying degrees due to various reasons, such as various types of dementia in severe cases and mild cognitive impairment in mild cases. With the increasingly serious aging phenomenon in China, its incidence rate also increases year by year.

[0003] In recent years, a large number of studies have focused on the relationship between the intestine and the brain. The gut microbiota conducts bidirectional regulation with the brain through the "microbiota-gut-brain axis", and this pathway involves the nervous system, endocrine system, immune system, etc., and such a relationship also exists in cognitive impairment.

[0004] Intestinal microfold cells (M cells) are a unique subset of intestinal epithelial cells in Peyer's patches (PPs), which transport antigens and are the most important first step in initiating mucosal immune responses. They can directly present antigens to B cells to produce SIgA antibodies and maintain intestinal homeostasis. PPs are the most activated sites of systemic B cells.

[0005] "Nature" reported that IgA plasma cells derived from the intestine can migrate to the dura mater of the brain and play a protective role. Under disease conditions, elevated levels of IgG and IgA antibodies have been observed in cerebrospinal fluid in many studies. Some researchers found differences in salivary IgA between Alzheimer's disease (AD) patients and normal controls; among mild, moderate, and severe AD patients, mild AD patients had the highest salivary IgA expression, and severe AD patients had the lowest salivary IgA expression. The study proposed that the M cell-B cell axis in PPs is disrupted, and the intestinal mucosal immune response will be severely reduced. After specifically knocking out M cells, small intestine GC is weakened and intestinal IgA is reduced.

[0006] The invention patent with the application number 202210062246.6 provides a construction and application of a GRIN2A gene mutation cognitive impairment mouse model. Based on the family data of clinical findings that a mutation at the 2636th gene locus in the coding region of the GRIN2A gene leads to a mutation of the 879th amino acid (K879R, lysine mutated to arginine) resulting in global developmental delay, a new cognitive impairment mouse model is established; it provides a suitable tool for the neurobiological pathogenesis of cognitive impairment and a new idea for the clinical development and intervention of drugs for cognitive impairment.

[0007] Currently, the gut-brain axis and cognitive impairment have become research hotspots. Successfully establishing and selecting a suitable animal model is the key to carrying out relevant experimental studies, providing a new model tool for the drug development of cognitive impairment. The experimental animal model of cognitive impairment is consistent with the phenotypes and mechanisms of human cognitive impairment. Therefore, studying the mechanism of cognitive impairment has important clinical significance. Rank, as a gene specifically expressed in M cells, is usually used as the target for specifically knocking out M cells. Therefore, constructing a conditional gene knockout (Cas9-CKO) Rank (Tnfrsf11a) mouse model based on CRISPR Cas9 technology is an effective method to explore the gut-brain axis. Summary of the Invention

[0008] The purpose of the present invention is to provide a method for establishing a mouse model of gut-originated cognitive impairment. This method involves mating C57BL / 6 mice with F0 generation Tnfrsf11a Flox mice and Vil1in-Cre tool mice to obtain F3 generation (flox / flox, Cre), that is, Rank CKO homozygotes, and constructing a conditional gene knockout (Cas9-CKO) Rank (Tnfrsf11a) mouse model based on CRISPR Cas9 technology. The method of the present invention has been systematically studied and demonstrated in 6-month-old Rank CKO mice, with accurate results and convenient methods.

[0009] To achieve the above purpose, the technical solution adopted by the present invention is:

[0010] Based on Vil1in-Cre transgenic mice and Tnfrsf11a Flox transgenic mice, using the Cre-Loxp conditional gene knockout technology, the two types of mice are hybridized to obtain homozygous mice with specific knockout of intestinal M cells (Rank CKO), that is, (flox / flox, Cre).

[0011] The specific modeling method is based on CRISPR Cas9 technology. C57BL / 6 mice are mated with F0 generation Tnfrsf11a Flox mice and Vil1in-Cre tool mice to increase the number of Flox mice and Cre tool mice, that is, to obtain F1 generation heterozygotes (flox / +). Then, the F1 generation heterozygotes (flox / +) are mated with each other and simultaneously with Vil1in-Cre tool mice to obtain F2 generation (flox / flox), (flox / +, Cre) mice. The F2 generation homozygotes (flox / flox) are mated with (flox / +, Cre) to obtain F3 generation (flox / flox, Cre), that is, Rank CKO homozygotes.

[0012] Further prove the deletion of related expressions in intestinal M cells of Rank CKO mice.

[0013] Detection of Peyer's patches in the small intestine of the above-mentioned Rank CKO mice found that the expression of M cell-related genes Tnfaip2 、 Rank 、m GP2 、 SpiB, Sox8 decreased, and the specific expression protein GP2 decreased.

[0014] Detection of the intestinal mucus barrier function of the above-mentioned Rank CKO mice - ileum and colon IgA, MUC2 immunofluorescence experiments, and the results showed that: the intestinal mucus barrier of Rank CKO mice was damaged.

[0015] The above-mentioned Rank CKO mice showed typical cognitive impairment manifestations such as decreased learning and memory ability at 6 months of age.

[0016] The above-mentioned Rank CKO mice showed changes in Tau phosphorylation in the hippocampus and cortex of the brain at 6 months of age, accompanied by a decrease in the number of neurons.

[0017] Compared with the prior art, the present invention has the following beneficial effects:

[0018] The present invention provides a method for establishing a mouse model of intestinal source cognitive impairment to solve the limitation of the current lack of animal models of intestinal source cognitive impairment for scientific research. Therefore, an intestinal source cognitive impairment mouse model is invented for scientific research in the field of intestine and cognition, and the model establishment is stable and the success rate is high. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 is the modeling process of Rank CKO homozygous mice;

[0020] Figure 2 is the result of mouse tail PCR gene identification of Rank CKO mice, WT represents wild-type mice; F / +, represents Tnfrsflla Flox heterozygous mice; F / F, represents Tnfrsflla Flox homozygous mice; Villin-Cre+, represents Villin-Cre positive mice;

[0021] Figure 3 is the expression of Peyer's patch M cells of Rank CKO mice and wild-type mice at the gene and protein levels. Among them, A is the qPCR result of M cell-related genes, B is the M cell immunofluorescence result, and C is the M cell Western bolt result;

[0022] Figure 4 is the detection result of the intestinal mucus barrier of Rank CKO mice and wild-type mice;

[0023] Figure 5 Results of the novel object recognition experiment for Rank CKO mice and wild-type mice;

[0024] Figure 6 Results of the Y-maze experiment for Rank CKO mice and wild-type mice;

[0025] Figure 7 Results of the water maze experiment for Rank CKO mice and wild-type mice;

[0026] Figure 8 Tau protein expression in the cerebral cortex and hippocampus of Rank CKO mice and wild-type mice;

[0027] Figure 9 Map2 expression in the brains of Rank CKO mice and wild-type mice. Detailed implementation manners

[0028] The following further elaborates on the solution of the present invention in conjunction with the accompanying drawings and specific embodiments. These embodiments are only used to illustrate the present invention and do not limit the scope of the present invention.

[0029] Example 1

[0030] Establishment of a mouse model of cognitive impairment

[0031] Based on the CRISPR Cas9 technology, C57BL / 6 mice were mated with F0 generation Tnfrsf11a Flox mice and Vil1in-Cre tool mice to increase the number of Flox mice and Cre tool mice, thereby obtaining F1 generation heterozygotes (flox / +); then the F1 generation heterozygotes (flox / +) were mated with each other and simultaneously with Vil1in-Cre tool mice to obtain F2 generation (flox / flox), (flox / +, Cre) mice; the F2 generation homozygotes (flox / flox) were mated with (flox / +, Cre) to obtain F3 generation (flox / flox, Cre), namely Rank CKO homozygotes. The modeling process is as Figure 1 shown.

[0032] PCR gene identification of mouse tissues: When the mice were 5 - 7 days old after birth, the mice were marked by the toe clipping method, and the tail tissues were cut and the DNA was extracted using a rapid mouse tail genotype identification kit (Beyotime, China) for identification.

[0033] The specific primers are as follows:

[0034] (1) Primers (F1 / R1) for identifying Tnfrsf11a positive homozygotes (flox / flox) obtained by self-crossing Tnfrsf11a positive heterozygotes (flox / +):

[0035] Tnfrsf11a F: TTCTACAAACTCCCTAAGCAGC;

[0036] Tnfrsf11a R: CACGGTCCCACTTACTCCAC;

[0037] (2)Primers for identifying Cre gene carriers:

[0038] Vil1in-Cre P1: TCGATGCAACGAGTGATGAG;

[0039] Vil1in-Cre P2: TCCATGAGTGAACGAACCTG;

[0040] Vil1in-Cre P3: CAAATGTTGCTTGTCTGGTG;

[0041] Vil1in-Cre P4: GTCAGTCGAGTGCACAGTTT.

[0042] Vil1in-Cre+ shows a specific band of 403 bp, Tnfrsf11a (flox / flox) shows a specific band of 417 bp, and WT shows a specific band of 337 bp; Mice with Vil1in-Cre+ and Tnfrsf11a (flox / flox) are Rank (flox / flox, Cre) mice, that is, Rank CKO homozygotes ( Figure 2 ), indicating successful gene knockout.

[0043] Detect the gene expression levels of Peyer's patch M cells in Rank CKO mice and wild-type mice by qPCR method: Extract mouse RNA, reverse transcribe it into cDNA for real-time fluorescence quantitative PCR (qPCR) reaction, and finally perform statistical calculations.

[0044] The specific primers are as follows:

[0045] β-Actin F: GGCTGTATTCCCCTCCATCG;

[0046] β-Actin R: CCAGTTGGTAACAATGCCATGT;

[0047] mGp2 F: GATACTGCACAGACCCCTCCA;

[0048] mGp2 R: GCAGTTCCGGTCATTGAGGTA;

[0049] Rank F: ATGCGAACCAGGAAAGT;

[0050] Rank R: TGCCTGCATCACAGACT;

[0051] Tnfaip2 F: TACTGCCCTCTCCTTCCTCA;

[0052] Tnfaip2 R: TTGAAAGCCCATGTGAAACA;

[0053] Spib F: GCCCACACTTAAGCTGTTTGTA;

[0054] Spib R: CTGTCCAGCCCCATGTAGAG;

[0055] Sox8 F: ACCCGCATCTCCATAACGCA;

[0056] Sox8 R: TGGT GGCCCAGTTCAGTACC.

[0057] Expression of protein levels in Peyer's patch M cells of Rank CKO mice and wild-type mice: Fresh mouse small intestinal Peyer's patches were taken, tissues were lysed to extract proteins, and after BCA quantification, the expression of the M cell-specific protein GP2 in mouse Peyer's patches was detected by western blot; after the mice were anesthetized, intestinal tissue frozen sections were prepared after perfusion, fixation, dehydration, and OCT embedding. The section thickness was 10 μm, and the expression of GP2 in mouse Peyer's patches was detected by immunofluorescence experiments to observe the number of M cells.

[0058] As Figure 3 shown, compared with wild-type mice, the expression of genes related to M cells in the small intestinal Peyer's patches of Rank CKO mice was down-regulated, and its specific protein GP2 disappeared significantly, indicating that homozygous mice with specific knockout of intestinal M cells were successfully constructed.

[0059] Example 2

[0060] Detection of intestinal mucus barrier in cognitively impaired mice

[0061] Immunofluorescence assay for detecting the expression of intestinal IgA and MUC2: After anesthetizing the mice, open the thoracic cavity to expose the heart, cut open the right auricle, and perfuse 40 mL of normal saline to wash away the blood. Then, perfuse approximately 40 mL of pre-cooled 4% paraformaldehyde at a speed that is first fast and then slow. After perfusion, quickly isolate the ileum and colon and place them in 4% paraformaldehyde (4 °C) for fixation for 24 h. Subsequently, place the post-fixed tissues in 20% sucrose (4 °C) for soaking. After the tissues sink to the bottom, transfer them to 30% sucrose (4 °C) for soaking. Once the tissues sink to the bottom, they can be embedded in OCT. Subsequently, section the tissues using a cryostat, and set the section thickness to 10 μm. Perform IgA and MUC2 immunofluorescence staining. Observe the staining results using an Olympus confocal fluorescence microscope.

[0062] Figure 4 As shown, the expressions of IgA and MUC2 in the ileum and colon of 6-month-old Rank CKO mice decreased.

[0063] Example 3

[0064] Behavioral tests related to cognitive impairment

[0065] 1. Novel object recognition test: Place the camera system vertically above the novel object recognition box (50 cm × 50 cm × 50 cm, length × width × height). Preparation stage: Before the test, gently stroke the mice every day to avoid irritating them during the operation. On the first day, the adaptation period, the mice are allowed to move freely in the novel object recognition box (without objects) for 10 min. On the second day, the familiarization period, first place two identical objects at the left and right ends on one side of the novel object recognition box, with the objects 10 cm away from the two side walls. Place the mice with their backs facing the objects at an equal distance from the objects and let them freely explore for 10 min. Use the camera and software to record the exploration time of the mice on each object (any contact with the object by the mouth or nose and approaching the object within a range of about 3 cm is considered exploration of the object). After each mouse has completed the recognition, clean the objects and the bottom of the box with 75% ethanol to reduce residual odors. On the third day, the test period, replace one of the objects with a novel object of a different shape and test for 10 min. Analyze the time the mice spend recognizing the novel object and the old object, and calculate the mouse cognitive index (recognition index, RI). The calculation formula is: RI = novel object / (novel object + old object) × 100%.

[0066] The results of the novel object recognition test for 6-month-old Rank CKO mice and wild-type mice (WT) are as Figure 5 shown. Compared with WT mice, Rank CKO mice showed a significantly reduced preference for the novel object, indicating a decline in their memory function.

[0067] 2. Y-maze test: Spontaneous alternation response: Place the mouse at the end of any arm of the Y-maze facing the center of the maze and let it freely explore within the three arms of the Y-maze for 10 min. The camera system records the behavioral changes of the animal for 10 min, and the following indicators are recorded: (1) The total number of entries: The number of times the animal enters the arms of the maze (with the standard that all four feet of the mouse enter the arm as one entry); (2) An alternation: Enter all three arms of the Y-maze continuously in sequence once. (3) The number of maximum alternations: The total number of entries - 2. The spontaneous alternation behavior score = The total number of alternations / The number of maximum alternations * 100%, and the calculated result is used for statistical analysis.

[0068] The results of the Y-maze experiments of 6-month-old Rank CKO mice and WT mice are as Figure 6 shown, and the results indicate that the working memory of Rank CKO mice is impaired compared to wild-type mice.

[0069] 3. Morris water maze test: The camera system is placed vertically about 3 meters above the pool. The pool (with a diameter of 120 cm, a height of 50 cm, and a water depth of 30 cm) is divided into four quadrants: east, west, south, and north. The platform (with a diameter of 12 cm and a height of 29 cm) is placed at the central position of the north quadrant. Different colored and shaped markers are pasted around the pool and remain unchanged for the mice to locate the platform. On the first day, the platform is visible, 1 cm above the water surface. Each mouse is placed into the water with its back facing the platform from the center of the north, east, west, and south quadrants along the pool edge, and the time it takes for each mouse to find the platform is recorded. If this time exceeds 60 s, the mouse is guided to the platform and allowed to stay on the platform for 15 s. On the second to sixth days, the platform is made invisible, 1 cm below the water surface. Each mouse is placed into the water for training four times every day in different quadrant sequences for 5 days. On the seventh day, the platform is removed for the spatial exploration test. The mouse is released from the opposite side of the original platform quadrant. Within 60 s, the time it takes for the mouse to first reach the original platform position, as well as the time the mouse stays in the platform area and the number of times it crosses the platform area, are recorded.

[0070] The results of the water maze experiments of 6-month-old Rank CKO mice and WT mice are as Figure 7 shown, and the results indicate that the learning and memory ability of Rank CKO mice has decreased compared to wild-type mice.

[0071] Example 4

[0072] Related neuropathological changes in cognitive impairment

[0073] 1. Using western blot, detect Tau46, pTau S396, pThr231, pTau (Ser202, Thr205) in the cerebral cortex and hippocampus of 6-month-old Rank CKO mice and WT mice, mainly to evaluate the Tau phosphorylation in the mouse brain.

[0074] After anesthetizing the mice, dissect the cerebral cortex and hippocampal tissues. Add RIPA lysis buffer containing PMSF and protease phosphatase inhibitors, lyse with a tissue freezing grinder, and centrifuge at 4°C and 12,000 rpm for 20 minutes. Take the supernatant. Determine the protein standard curve by BCA protein quantification analysis kit and calculate the protein concentration of the sample. Add 5X loading buffer, boil the sample at 95°C for 5 min, and store at -20°C for later use. Use the CFAS Any KD PAGE protein electrophoresis gel preparation kit type II to prepare the gel, load 45 μg per well, and perform electrophoresis at a constant voltage of 250 V for 30 minutes. After electrophoresis, take out the gel and place it in the transfer buffer. Immerse the PVDF membrane in methanol for 1 min to activate the PVDF membrane. Install in the order of (+) pole - sponge pad - filter paper - PVDF membrane - gel - filter paper - sponge pad - (-) pole, and transfer at a constant current of 390 mA for 30 min. Take out the membrane, block it in 5% non-fat milk powder at room temperature for 1 h, add Tau46, pTau S396, pThr231, pTau (Ser202, Thr205) and GAPDH antibodies to detect the changes in protein expression.

[0075] 2. Observe the expression of microtubule-associated protein 2 (MAP2) through immunofluorescence experiments on mouse brain sections to evaluate the loss of brain nerve damage.

[0076] After anesthetizing the mice, after perfusion, fixation, dehydration, and OCT embedding, perform frozen sections of brain tissues with a thickness of 20 μm. After rinsing the brain sections with PBS, block them at room temperature for 1 h, discard the blocking solution, directly add the appropriate dilution of the primary antibody (MAP2), and incubate overnight at 4°C; discard the primary antibody, rinse thoroughly with PBST (PBS + 0.3% Triton X-100), and then add the corresponding fluorescent secondary antibody respectively, and incubate at room temperature in the dark for 1 h; discard the secondary antibody, rinse thoroughly with PBST, stain the nucleus with Hochest33342 in the dark at room temperature for 8 min; rinse with PBST for 5 min × 2 times, seal with an anti-fluorescence quenching agent, and take pictures with an Olympus confocal fluorescence microscope.

[0077] As Figure 8 shown, changes in Tau phosphorylation occur in the cerebral cortex and hippocampal regions of 6-month-old Rank CKO mice. As Figure 9 shown, the number of nerves in the cerebral cortex and hippocampus of 6-month-old Rank CKO mice decreases.

[0078] Sequence Listing

[0079] <110>Affiliated Hospital of Guangdong Medical University

[0080] <120>A method for establishing a mouse model of intestinal source cognitive impairment

[0081] <210>1

[0082] <211>22

[0083] <212>DNA

[0084] <213>Artificial Sequence

[0085] <400>1

[0086] TTCTACAAAC TCCCTAAGCA GC 22

[0087] <210>2

[0088] <211>20

[0089] <212>DNA

[0090] <213>Artificial Sequence

[0091] <400>2

[0092] CACGGTCCCA CTTACTCCAC 20

[0093] <210>3

[0094] <211>20

[0095] <212>DNA

[0096] <213>Artificial Sequence

[0097] <400>3

[0098] TCGATGCAAC GAGTGATGAG 20

[0099] <210>4

[0100] <211>20

[0101] <212>DNA

[0102] <213>Artificial Sequence

[0103] <400>4

[0104] TCCATGAGTG AACGAACCTG 20

[0105] <210>5

[0106] <211>20

[0107] <212>DNA

[0108] <213>Artificial sequence

[0109] <400>5

[0110] CAAATGTTGC TTGTCTGGTG 20

[0111] <210>6

[0112] <211>20

[0113] <212>DNA

[0114] <213>Artificial sequence

[0115] <400>6

[0116] GTCAGTCGAG TGCACAGTTT 20

[0117] <210>7

[0118] <211>20

[0119] <212>DNA

[0120] <213>Artificial sequence

[0121] <400>7

[0122] GGCTGTATTC CCCTCCATCG 20

[0123] <210>8

[0124] <211>22

[0125] <212>DNA

[0126] <213>Artificial sequence

[0127] <400>8

[0128] CCAGTTGGTA ACAATGCCAT GT 22

[0129] <210>9

[0130] <211>21

[0131] <212>DNA

[0132] <213>Artificial sequence

[0133] <400>9

[0134] GATACTGCAC AGACCCCTCC A 21

[0135] <210>10

[0136] <211>21

[0137] <212>DNA

[0138] <213>Artificial Sequence

[0139] <400>10

[0140] GCAGTTCCGG TCATTGAGGT A 21

[0141] <210>11

[0142] <211>17

[0143] <212>DNA

[0144] <213>Artificial Sequence

[0145] <400>11

[0146] ATGCGAACCA GGAAAGT 17

[0147] <210>12

[0148] <211>17

[0149] <212>DNA

[0150] <213>Artificial Sequence

[0151] <400>12

[0152] TGCCTGCATC ACAGACT 17

[0153] <210>13

[0154] <211>20

[0155] <212>DNA

[0156] <213>Artificial Sequence

[0157] <400>13

[0158] TACTGCCCTC TCCTTCCTCA 20

[0159] <210>14

[0160] <211>20

[0161] <212>DNA

[0162] <213>Artificial Sequence

[0163] <400>14

[0164] TTGAAAGCCC ATGTGAAACA 20

[0165] <210>15

[0166] <211>22

[0167] <212>DNA

[0168] <213>Artificial Sequence

[0169] <400>15

[0170] GCCCACACTT AAGCTGTTTG TA 22

[0171] <210>16

[0172] <211>20

[0173] <212>DNA

[0174] <213>Artificial Sequence

[0175] <400>16

[0176] CTGTCCAGCC CCATGTAGAG 20

[0177] <210>17

[0178] <211>20

[0179] <212>DNA

[0180] <213>Artificial Sequence

[0181] <400>17

[0182] ACCCGCATCT CCATAACGCA 20

[0183] <210>18

[0184] <211>20

[0185] <212>DNA

[0186] <213>Artificial Sequence

[0187] <400>18

[0188] TGGTGGCCCA GTTCAGTACC 20

Claims

1. A method for establishing a mouse model of intestinal source cognitive impairment, characterized in that: The method includes the following steps: Based on the CRISPR Cas9 technology, C57BL / 6 mice are mated with F0 generation Tnfrsf11a Flox mice and Vil1in-Cre tool mice to increase the number of Flox mice and Cre tool mice, that is, the F1 generation heterozygotes flox / + are obtained; then the F1 generation heterozygotes flox / + are mated with each other and simultaneously mated with Vil1in-Cre tool mice to obtain F2 generation flox / flox, flox / +, Cre mice; the F2 generation homozygotes flox / flox are mated with flox / +, Cre to obtain the F3 generation flox / flox, Cre, that is, the Rank CKO homozygotes.

Citation Information

Patent Citations

  • Construction and application of GRIN2A gene mutation cognitive disorder mouse model

    CN114480491A

  • Humanized antibody targeted to RANKL (Receptor Activator Of Nuclear Factor Kappa B Ligand) and TNF-alpha (Tumor Necrosis Factor) and application of humanized antibody

    CN104004080A

  • Method for constructing mouse model for conditional knockout of CCR5 gene of endothelial cell

    CN107858373A