A SNP molecular marker tightly linked to the silique length and grain weight gene BnARF18 of Brassica napus and its application

Abstract

The invention belongs to the field of biotechnology, and discloses a SNP molecular marker closely linked to the silique length and grain weight gene BnARF18 of Brassica napus and its application. The SNP site of the SNP molecular marker is located in the silique length and grain weight gene BnARF18, and is used for the accurate identification of the mutant type of the silique length and grain weight gene BnARF18. This marker has high typing quality, single copy, high polymorphism, and a sample data detection rate of> 98%. It can be used for marker-assisted breeding for breeding improvement of silique length and grain weight of Brassica napus, and has wide application universality. Also disclosed is the application of KASP marker primers and kits for the above-mentioned SNP molecular markers to identify the silique length and grain weight gene BnARF18 of Brassica napus, and the method is simple, the degree of automation is high, the detection flux is high, the speed is fast, the detection result is accurate, and the repeatability and stability are good.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and particularly relates to a SNP molecular marker tightly linked to a Brassica napus silique length and grain weight gene BnARF18, a KASP marker primer, a kit and applications thereof. Background Art

[0002] Brassica napus is a plant of the genus Brassica in the family Cruciferae. The plant is medium or tall, with luxuriant branches and leaves, enlarged taproot, and well-developed lateral roots and fine roots. The leaves are similar to those of cabbage, and are blue-green. The leaves are thick, waxy, and notched at the margins. The base leaves are semi-erect or creeping, with obvious petioles. The stem moss leaves have no petioles, and the leaf base is semi-amplexicaul. The petals are large and dark yellow, and the siliques are large, often at right angles to the rachis. The seeds are black and large.

[0003] The silique of rapeseed is not only a storage organ, but also an important photosynthetic organ. It has a dual silique growth period of "source" and "sink". Most of the organic matter required for the growth of siliques and internal grains needs to be provided by silique photosynthesis. Many studies have shown that silique length is an important factor affecting rapeseed yield, and the heritability of silique length is very high. Ding Xiuqi used 29 Brassica rapa-type rapeseed to study silique and seed traits, indicating that silique length is mainly medium-long and short-horned varieties. Varieties with long-horned siliques (length ≥ 5.81 cm) and medium-width siliques (diameter 0.43~0.47 cm) have more grains per silique and higher yield per plant; silique length is extremely significantly positively correlated with silique area, 1000-grain weight and single-plant yield, positively and significantly correlated with the number of grains per silique, and significantly negatively correlated with fruit density.

[0004] Therefore, the silique length and grain weight traits of rapeseed are one of the most important traits for breeding. The development of functional linkage SNP markers for the silique length and grain weight gene BnARF18 based on KASP technology can be used as an efficient identification marker to support high-throughput, low-cost and high-precision identification of functional genes in the rapeseed breeding process, thereby accelerating the breeding selection of rapeseed. Summary of the invention

[0005] The technical problem to be solved by the present invention is to overcome the deficiencies and defects mentioned in the above background technology, and provide a SNP molecular marker, KASP marker primer, kit and application thereof that are tightly linked to the silique length and grain weight gene BnARF18 of Brassica napus, which can quickly, high-throughput and low-cost identify the genetic mutant type of the silique length and grain weight gene BnARF18.

[0006] In order to solve the above technical problems, the technical solution proposed by the present invention is:

[0007] A SNP molecular marker tightly linked to the Brassica napus silique length and grain weight gene BnARF18, with the Darmor-bzh genome version of Brassica napus as a reference, the SNP molecular marker has a polymorphism at the 3306817th base on the Brassica napus A09 chromosome, and the polymorphism is T or A.

[0008] The above application is preferably used for identifying the grain weight phenotype of Brassica napus; when the polymorphism is identified as A, the grain weight phenotype of Brassica napus is high thousand-grain weight; when the polymorphism is identified as T, the grain weight phenotype of Brassica napus is low thousand-grain weight.

[0009] Preferably, the nucleotide sequence of the KASP marker primer used to identify the Brassica napus grain weight phenotype is as follows from the 5' end to the 3' end:

[0010] Specific primer X: GCCTAACAACATACTCTTCTTCGAGTA (as shown in SEQ ID NO: 1);

[0011] Specific primer Y: GCCTAACAACATACTCTTCTTCGAGTT (as shown in SEQ ID NO: 2);

[0012] Universal primer C: GCAAATCAAGACGCTTGGGGTAT (as shown in SEQ ID NO: 3).

[0013] In the above application, preferably, the application method comprises the following steps:

[0014] (1) Extracting total DNA from Brassica napus samples;

[0015] (2) Using the DNA extracted in step (1) as a template, PCR amplification is performed using the KASP labeled primers, and then fluorescence signal scanning and genotyping are performed; if only the fluorescence of specific primer X is detected in the sample, the genotype of the sample is homozygous allele X; if only the fluorescence of specific primer Y is detected, the genotype of the sample is homozygous allele Y; if the fluorescence of specific primers X and Y is detected at the same time, the genotype of the sample is heterozygous;

[0016] (3) Data analysis was performed based on the genotyping results to obtain the typing of the silique length and grain weight gene BnARF18 of the Brassica napus samples to be tested.

[0017] Preferably, the method is performed using the Douglas Array Tape platform.

[0018] Preferably, the PCR amplification system includes: 100 μM universal primer C, 100 μM specific primer X, 100 μM specific primer Y, 2×KASP Master Mix, DNA of the Brassica napus sample to be tested, and ultrapure water.

[0019] Preferably, SOELLEX is used for PCR amplification, and the amplification conditions are as follows: 94°C for 15 minutes; 94°C for 20 seconds, 65°C-57°C for 60 seconds, 10 cycles; 94°C for 20 seconds, 57°C for 60 seconds, 33 cycles.

[0020] Based on a general inventive concept, the present invention also provides a KASP marker primer for identifying the Brassica napus silique length and grain weight gene BnARF18, wherein the nucleotide sequence of the KASP marker primer from the 5' end to the 3' end is as follows:

[0021] Specific primer X: GCCTAACAACATACTCTTCTTCGAGTA (as shown in SEQ ID NO: 1);

[0022] Specific primer Y: GCCTAACAACATACTCTTCTTCGAGTT (as shown in SEQ ID NO: 2);

[0023] Universal primer C: GCAAATCAAGACGCTTGGGGTAT (as shown in SEQ ID NO: 3).

[0024] Based on a general inventive concept, the present invention also provides a kit for identifying the Brassica napus silique length and grain weight gene BnARF18, comprising the above-mentioned KASP marker primers.

[0025] In the above-mentioned kit, preferably, the concentration ratio of the specific primer X, the specific primer Y, and the universal primer C in the PCR reaction system is 10-12: 10-12: 25-30.

[0026] Preferably, the kit further comprises 2×KASP Master Mix and ultrapure water.

[0027] Based on a general inventive concept, the present invention also provides an application of the KASP marker primer or the kit in identifying the Brassica napus silique length and grain weight gene BnARF18.

[0028] Compared with the prior art, the present invention has the following beneficial effects:

[0029] (1) The present invention screened out a SNP molecular marker closely linked to the Brassica napus silique length and grain weight gene BnARF18 and its KASP marker primer set and kit for accurate identification of mutant types of the Brassica napus silique length and grain weight gene BnARF18. This marker has high typing quality, single copy, and high polymorphism (the PIC value in the existing Brassica napus resources is higher than >0.3), and the sample data detection rate is >98%. It can be used for marker-assisted breeding for the improvement of Brassica napus silique length and grain weight breeding, and has wide application universality.

[0030] (2) The present invention also provides an application method of the above-mentioned KASP marker primers and kit for identifying the Brassica napus silique length and grain weight gene BnARF18. The detection method is simple and has an automation degree of up to 90%; the detection throughput is high and the speed is fast (122,880 data points can be obtained in 8 hours, which is 10 times that of the traditional 96-well plate SNP genotyping method); the detection counter-reagent usage is small (only 0.8 uL / reaction), and the reagent and consumables cost is low (compared with the traditional 96-well plate SNP genotyping method, the reagent and consumables cost is reduced by 70%-90%); the detection results are accurate, reproducible and stable, and the data results of different testing laboratories can be compared and verified with each other, and the data have universal comparability; the present invention provides a rapid, efficient, low-cost, and accurate universal detection method. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0032] Figure 1 It is a schematic diagram of genotyping of the SNP molecular markers in the embodiment of the present invention in rapeseed diversity materials. DETAILED DESCRIPTION

[0033] In order to facilitate the understanding of the present invention, the present invention will be described more comprehensively and meticulously below in conjunction with the accompanying drawings and preferred embodiments of the present invention, but the protection scope of the present invention is not limited to the following specific embodiments.

[0034] Unless otherwise defined, all professional terms used below have the same meanings as those generally understood by those skilled in the art. The professional terms used herein are only for the purpose of describing specific embodiments and are not intended to limit the scope of protection of the present invention.

[0035] Unless otherwise specified, various raw materials, reagents, instruments and equipment used in the present invention can be purchased from the market or prepared by existing methods.

[0036] Example:

[0037] The present invention develops a SNP molecular marker that is tightly linked to the silique length and grain weight gene BnARF18 of Brassica napus. This molecular marker is developed and verified by extracting gene sequences and comparing alleles of the gene interval of the silique length and grain weight gene BnARF18 of Brassica napus, and is tightly linked to the silique length and grain weight gene BnARF18, and can quickly select whether the breeding material contains the silique length and grain weight gene BnARF18 according to the genotype.

[0038] Compared with the previous breeding process of Brassica napus, which required length measurement and grain weight detection after harvest in the field to obtain phenotypic data for silique length and grain weight of Brassica napus, the SNP markers developed in the present invention can be directly detected and typed, greatly improving the selection efficiency of breeding; the SNP marker detection used in the present invention is based on the KASP (Kompetitive Allele Specific PCR, competitive allele-specific PCR) detection technology of the Douglas Array Tape platform, which has a simple detection method, high degree of automation, high throughput, fast speed, low reagent usage, and low detection cost, and can be widely promoted for use in breeding selection. The specific research and development process is as follows:

[0039] 1. Construction of the core germplasm resource database of Brassica napus

[0040] The Brassica napus germplasm database was constructed by using the publicly available rapeseed germplasm resources and selecting 60 rapeseed core germplasm resources resequencing data based on the classification of spring rapeseed, semi-winter rapeseed and winter rapeseed.

[0041] 2. Information mining of the cloned silique length and seed weight gene BnARF18

[0042] Through a large number of literature searches, it was determined that the silique length and grain weight gene BnARF18 was located on the A09 chromosome of Brassica napus, with the gene symbol BnaA09g55580D, and the reference genome version of Brassica napus is Darmor-bzh.

[0043] 3. Extraction of SNP loci and sequence acquisition in Brassica napus

[0044] The data of 60 core germplasm resources were used to extract the sequence of gene BnaA09g55580D, and the gene sequence was analyzed for SNP polymorphism. The interval of this gene was relatively conservative, and finally one high-quality SNP site was obtained (the 3306817th base on the A09 chromosome of Brassica napus). The SNP site was extracted and about 100bp before and after its flanking sequence were obtained.

[0045] 4. Label design and synthesis

[0046] For the SNP sites obtained above, KASP primers were designed based on the reference genome Darmor-bzh of Brassica napus using the online primer design website BatchPrimer3 (http: / / probes.pw.usda.gov / batchprimer3 / ). There are three primers, two of which are connected to the FAM and HEX fluorescent sequences at the 5' end. After the design is completed, the primer sequence is further analyzed for the whole genome copy number, and finally a high-quality single-copy KASP marker site is obtained. The information is as follows in Table 1:

[0047] Table 1: Site information and primer sequences of KASP markers for silique length and seed weight gene BnARF18 (sequences from left to right are shown in SEQ ID NO: 1-3)

[0048]

[0049] 5. Detection and verification of labels

[0050] The quality verification of the KASP marker genotyping for Brassica napus detection was performed using 94 materials with different oil contents to verify the KASP marker, including the following steps:

[0051] (1) Extract the total DNA of the Brassica napus sample.

[0052] (2) Using the DNA extracted in step (1) as a template, PCR amplification was performed using the KASP marker primers, and after the PCR reaction was completed, the reaction system fluorescence signal was scanned using ARAYA; then genotyping and data analysis were performed using INTELLICS; in the KASP marker genotyping test, the genotypes of the samples were divided into three clusters, namely, cluster X, cluster Y, and heterozygous genotype cluster; cluster X indicated that the sample contained a homozygous X allele at this KASP marker site (marked in red in the genotyping diagram, located in the upper left corner of the diagram), cluster Y indicated that the sample contained a homozygous Y allele at this KASP marker site (marked in blue in the genotyping diagram, located in the lower right corner of the diagram), and heterozygous genotype cluster indicated that the sample contained a heterozygous X and Y allele at this KASP marker site (marked in purple in the genotyping diagram);

[0053] The validation and detection of KASP markers were performed using the Douglas Scientific Array Tape system. The ArrayTape genotyping platform includes NEXAR for PCR amplification system assembly, SOELLEX for PCR amplification, ARAYA for fluorescence signal scanning, and INTELLICS for data analysis.

[0054] PCR amplification system: NEXAR was used to automatically assemble the PCR amplification system, which is shown in Table 2 below.

[0055] Table 2: PCR amplification system for KASP marker genotyping

[0056]

[0057] PCR amplification: PCR was performed using SOELLEX, and the amplification conditions were as follows: 94°C for 15 min; 94°C for 20 sec, 65°C-57°C (annealing temperature decreased by 0.8°C each cycle) for 60 sec, 10 cycles; 94°C for 20 sec, 57°C for 60 sec, 33 cycles.

[0058] Advantages of KASP marker detection based on the Douglas Array Tape platform: The automation level of KASP marker detection based on the Douglas Array Tape platform reaches 90%, which greatly reduces the manpower and human errors in the laboratory. The detection throughput is high, and 122,880 data points can be obtained in 8 hours, which is 10 times that of the traditional 96-well plate SNP genotyping method. The detection reaction volume is low (only 0.8 uL / reaction), and the cost of reagents and consumables is reduced by 70% - 90% compared with the traditional 96-well plate SNP genotyping method. (3) Data analysis is performed based on the KASP marker typing results and phenotypic results to select the optimal site for subsequent applications.

[0059] According to the results of the marker detection (see Figure 1 ), the typing of KASP markers is good and compact, and the detection rate is higher than 98%, which can accurately detect the silique length and grain weight gene BnARF18 of Brassica napus.

[0060] From the corresponding results of the phenotypic data and genotypic data of the material (see Table 3), when the genotype of the material is A, the phenotype of the material is high 1000-grain weight, when the genotype is T, the phenotype of the material is low 1000-grain weight, and when the genotype is A / T, the phenotype of the material is high 1000-grain weight. The correspondence between the phenotype and the genotype is highly consistent, and the genotype can be accurately used to identify whether the material contains the silique length and grain weight gene BnARF18. Therefore, BN900114 can be selected as a subsequent auxiliary marker application.

[0061] Table 3 Statistics of phenotypic and genotypic data of varieties

[0062]

Claims

1. A KASP marker primer for identifying the thousand-grain weight phenotype of Brassica napus, characterized in that: The nucleotide sequence of the KASP labeled primer from 5' to 3' is as follows: Specific primer X: GCCTAACAACATACTCTTCTTCGAGTA; Specific primer Y: GCCTAACAACATACTCTTCTTCGAGTT; Universal primer C: GCAAATCAAGACGCTTGGGGTAT.

2. A kit for identifying the thousand-grain weight phenotype of Brassica napus, characterized in that: The method comprises the KASP labeling primer as claimed in claim 1.

3. The kit according to claim 2, characterized in that The kit also contains 2×KASP MasterMix and ultrapure water.

4. Use of the KASP marker primer according to claim 1 or the kit according to claim 2 or 3 in identifying the thousand-grain weight phenotype of Brassica napus.

5. The use according to claim 4, characterized in that: When the polymorphism is A, the thousand-grain weight of Brassica napus is high; when the polymorphism is T, the thousand-grain weight of Brassica napus is low.

6. The use according to claim 5, characterized in that: The method of application comprises the following steps: (1) Extracting total DNA from Brassica napus samples; (2) Using the DNA extracted in step (1) as a template, PCR amplification is performed using the KASP labeled primers, and then fluorescence signal scanning and genotyping are performed; if only the fluorescence of the specific primer X is detected in the sample, the genotype of the sample is homozygous allele T; if only the fluorescence of the specific primer Y is detected, the genotype of the sample is homozygous allele A; if the fluorescence of both the specific primers X and Y is detected, the genotype of the sample is heterozygous; (3) Perform data analysis based on the genotyping results to obtain the thousand-grain weight phenotype of the Brassica napus sample to be tested.

7. The use according to claim 6, characterized in that: The method is performed using the Douglas Array Tape platform; The PCR amplification system includes: 100 μM universal primer C, 100 μM specific primer X, 100 μM specific primer Y, 2×KASP Master Mix, DNA of the Brassica napus sample to be tested, and ultrapure water.

Images