Application of transmembrane transport protein as growth regulation switch in genetically engineered bacteria
Patent Information
- Application Number
- CN202311820625.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-12-27
- Publication Date
- 2026-09-25
- Estimated Expiration
- 2043-12-27
AI Technical Summary
[0015](1)增强基因工程菌的安全性:基因工程菌可能存在外逸的潜在危险性,而本发明通过引入跨膜转运蛋白NPF/SWEET作为生长调控开关,可以在适当时机诱导表达该蛋白,从而清除或限制生长基因工程菌,减少其外逸的风险,进一步加强基因工程菌的安全管理工作,同时也可以通过控制生长从而控制细胞催化反应进程。
Smart Images

Figure CN117777249B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biotechnology, specifically relating to the application of transmembrane transport proteins as growth regulatory switches in genetically engineered bacteria. Background Technology
[0002] Genetically engineered bacteria are microorganisms that have been directionally modified using genetic engineering techniques. Their genomes contain foreign genes or modified endogenous genes to achieve specific purposes. These microorganisms are typically single-celled organisms such as bacteria or yeast, and they are designed and modified to produce specific proteins, metabolites, or other useful compounds.
[0003] Currently, genetically engineered bacteria have been widely used in pollution control, including in solid waste landfills, sewage treatment plants, oil depots, underground pipelines, and for the degradation of hazardous compounds and the remediation of soil, groundwater, and coastal contamination caused by oil tanker accidents. The introduction of genetically engineered bacteria can not only accelerate the degradation process of pollutants but also minimize additional environmental damage. Escherichia coli is one of the most commonly used host bacteria in genetic engineering, characterized by rapid growth and simple culture conditions. Its biological properties have been studied in detail, and it possesses a wide range of expression systems and genetic tools. Researchers can use various promoters, terminators, and expression vectors to precisely regulate gene expression levels and predict and control the expression of target genes.
[0004] To protect the health of the public and genetic engineering workers, prevent environmental pollution, and maintain ecological balance, genetic engineering work requires strict safety management. Furthermore, due to limitations in nutrient substrates or the demands of certain reaction stages, controllable cessation of cell growth is necessary in other cellular catalysis processes. Among these measures, implementing restrictive measures on genetically engineered bacteria and properly inactivating them after use are crucial steps in preventing their uncontrolled spread. Therefore, developing a novel, non-toxic, and low-cost method for regulating the growth of genetically engineered bacteria is of great significance for the safe conduct of genetic engineering work. Summary of the Invention
[0005] To further strengthen the safety management of genetically engineered bacteria, this invention provides an application of transmembrane transport proteins as growth regulatory switches in genetically engineered bacteria. By introducing the gene encoding the transmembrane transport protein into the genetically engineered bacteria as a growth regulatory switch, its expression can be induced at appropriate times using inducers or other induction methods to regulate the growth of the genetically engineered bacteria, thereby inhibiting or killing the growth of the genetically engineered bacteria and reducing the potential danger of the genetically engineered bacteria escaping.
[0006] This invention provides the application of transmembrane transporters as growth regulatory switches in genetically engineered bacteria. The transmembrane transporters are selected from at least one protein in the NPF and SWEET protein families. Transporters are a class of non-permeable biological membranes composed of lipid bilayers, capable of mediating processes including electrochemical potential generation, energy production, metabolism, and signal transduction. The transmembrane transporter Nucleobase Ascorbate Transporter Proton Symporter (NPF) found in Arabidopsis thaliana belongs to the Peptide Transporter (PTR) family and is responsible for mediating the transmembrane transport of nucleotides and ascorbic acid, playing an important regulatory role in cell metabolism, growth, and immunity. Also found in Arabidopsis thaliana, the transmembrane transporter Sugars Will Eventually be Exported Transporters (SWEET) is a class of proteins widely distributed in plants and closely related to the transmembrane transport of carbohydrates, responsible for the transmembrane transport of sugars such as glucose, fructose, and sucrose. The inventors discovered in their experiments that inducing the expression of transmembrane transport proteins NPF or SWEET, reverse-transcribed from Arabidopsis thaliana, into *E. coli* via vectors led to inhibited growth or death of the bacteria. Experimental results showed that after expressing transmembrane transport proteins NPF1.2, NPF2.5, NPF8.1, SWEET1, and SWEET5 in shake-flask cultured *E. coli*, their OD... 800Compared to the control, all showed significant reductions; simultaneously, the growth ability of *E. coli* expressing the relevant transport proteins in LB-Kana solid medium also decreased substantially. Based on this, the inventors proposed using transmembrane transport proteins as growth regulatory switches to inhibit the growth of genetically engineered bacteria or cause their death. Here, transmembrane transport proteins, acting as growth regulatory switches, can be activated through various means to achieve expression. For example, they can be activated by adding inducers to induce the corresponding promoters to drive the expression of the transmembrane transport protein encoding genes, or by physical methods such as light and temperature. For instance, after transforming *E. coli* with a vector containing a transmembrane transport protein encoding gene, the expression of the transmembrane transport protein encoding gene can generally be induced by adding inducers, such as the most common inducer IPTG. IPTG can mimic the function of lactose, binding to the repressor protein on the lac operator. Without IPTG, the lac repressor protein prevents RNA polymerase from binding and initiating transcription of a specific gene. However, with the addition of IPTG, the repression of the lac operator by the lac repressor is lifted, allowing RNA polymerase to bind and initiate transcription of the specific gene (i.e., the transmembrane transport protein encoding gene), thus enabling its expression. Alternatively, arabinose or rhamnose can be used as inducers. Arabinose is commonly used to induce the expression of target genes driven by the arabinose promoter. Rhamnose is also frequently used as a gene expression inducer, especially in yeast expression systems, where it can activate rhamnosase activity, thereby inducing the expression of the target protein. Using inducers as a growth control switch is generally suitable for eliminating genetically engineered bacteria in large-scale open environments. For example, spraying / adding inducers can induce the expression of transmembrane transport proteins contained in the vector plasmids of genetically engineered bacteria used for wastewater treatment, thereby achieving "growth regulation" of the genetically engineered bacteria. Genetically engineered bacteria used for degrading and deodorizing kitchen waste can also use light as a means of turning on growth regulation. These genetically engineered bacteria generally work in a sealed, opaque container. When kitchen waste is poured out of the container and exposed to sunlight outdoors, the growth regulation switch of the genetically engineered bacteria is turned on, driving the expression of transmembrane transport proteins contained in its vector plasmid, thereby achieving "growth regulation" of the genetically engineered bacteria and preventing its escape.
[0007] Preferably, the transmembrane transport protein NPF is selected from at least one of NPF1.2, NPF2.5, and NPF8.1, more preferably NPF1.2 and NPF8.1. More preferably, the amino acid sequence of NPF1.2 is as shown in SEQ ID NO. 1, the amino acid sequence of NPF2.5 is as shown in SEQ ID NO. 2, and the amino acid sequence of NPF8.1 is as shown in SEQ ID NO. 3.
[0008] Preferably, the transmembrane transport protein SWEET is selected from at least one of SWEET1 and SWEET5, more preferably SWEET1. More preferably, the amino acid sequence of SWEET1 is shown in SEQ ID NO. 4, and the amino acid sequence of SWEET5 is shown in SEQ ID NO. 5.
[0009] Preferably, the application includes: constructing the encoding gene of the transmembrane transporter into a genetically engineered bacterium, and inducing the expression of the encoding gene to inhibit the growth of the genetically engineered bacterium or cause its death. Specifically, the encoding gene of the transmembrane transporter can be constructed into a vector and then transformed into a genetically engineered bacterium. The vector contains a polynucleotide operably linked to a control sequence suitable for guiding expression in a host cell, such as various plasmids, bacteriophages, or viral vectors. For example, plasmid pET-28a can be used as a vector to construct the transmembrane transporter NPF or SWEET into pET-28a to obtain a recombinant plasmid. The recombinant plasmid is then transformed into a genetically engineered bacterium using Escherichia coli as the host bacterium. After the genetically engineered bacterium completes its specific function, a corresponding inducer is added to induce the expression of the transmembrane transporter, thereby inhibiting the growth of the genetically engineered bacterium and ultimately causing its death, thus achieving the elimination of the genetically engineered bacterium.
[0010] This invention also provides the application of transmembrane transporter protein encoding genes in the preparation of a genetically engineered bacterial growth regulation kit. The transmembrane transporter protein is selected from at least one protein in the NPF or SWEET protein family. The encoding genes of the transmembrane transporter protein NPF or SWEET can be used to prepare a genetically engineered bacterial growth regulation kit, acting as a growth regulation switch introduced into the genetically engineered bacteria. After the genetically engineered bacteria complete a specific task, the expression of the transmembrane transporter protein encoding gene is driven by a corresponding switch activation mechanism, thereby achieving the elimination or restriction of the genetically engineered bacteria's growth. This meets the need for controllable cessation of cell growth during cellular catalysis due to nutrient substrate limitations or reaction stages.
[0011] This invention also provides the application of a vector containing a transmembrane transporter protein encoding gene in the preparation of a genetically engineered bacterial growth regulation kit. The transmembrane transporter protein is selected from at least one protein in the NPF or SWEET protein family. The encoding gene of the transmembrane transporter protein NPF or SWEET is constructed into the vector as a growth regulatory switch. The resulting vector containing the corresponding transmembrane transporter protein encoding gene can be used to prepare a genetically engineered bacterial growth regulation kit. After the vector is introduced into the genetically engineered bacteria, once the bacteria have completed a specific task, the expression of the transmembrane transporter protein encoding gene is driven by the corresponding switch activation mechanism, thereby achieving the elimination or restriction of the genetically engineered bacteria's growth.
[0012] This invention also provides a kit for regulating the growth of genetically engineered bacteria. The kit includes a gene encoding a transmembrane transporter, wherein the transmembrane transporter is selected from at least one protein in the NPF or SWEET protein family. The gene encoding the transmembrane transporter can be stored in a corresponding vector. After the vector containing the transmembrane transporter encoding gene is introduced into the genetically engineered bacteria, and the bacteria complete a specific task, the expression of the transmembrane transporter encoding gene is driven by a corresponding switch-on mechanism to achieve the elimination or restriction of the growth of the genetically engineered bacteria.
[0013] Preferably, the host bacteria of the genetically engineered bacteria are selected from any one of *Escherichia coli*, yeast, and *Bacillus subtilis*. The range of host bacteria that can be selected for genetically engineered bacteria is wide, depending on the researcher's needs and experimental objectives. *Escherichia coli* is one of the most commonly used host bacteria, with various genetic engineering tools and techniques available, such as expression vectors and plasmid transformation; its rapid growth rate and ease of handling make it a common choice. Yeast is a commonly used eukaryotic host, possessing high genetic manipulation and expression levels. It is widely used in protein expression, gene knockout, and functional studies. *Bacillus subtilis*, as a common Gram-positive bacterium, has a relatively mature gene expression system, high genetic transformation efficiency, and strong metabolic and fermentation characteristics. It can be used as an expression host for the efficient expression of exogenous proteins for the production of biosynthetic compounds, such as biopesticides, enzymes, and antibiotics.
[0014] This invention provides a method for regulating the growth of genetically engineered bacteria by using transmembrane transport proteins as growth control switches, which has the following beneficial effects:
[0015] (1) Enhance the safety of genetically engineered bacteria: Genetically engineered bacteria may pose a potential risk of leakage. This invention introduces the transmembrane transport protein NPF / SWEET as a growth control switch, which can induce the expression of this protein at the appropriate time, thereby clearing or limiting the growth of genetically engineered bacteria, reducing the risk of leakage, and further strengthening the safety management of genetically engineered bacteria. At the same time, the process of cellular catalytic reaction can be controlled by controlling growth.
[0016] (2) Efficient elimination of genetically engineered bacteria: The introduction of the transmembrane transporter NPF / SWEET as a growth regulatory switch can lead to the inhibition or death of the growth of genetically engineered bacteria. Experimental results show that only IPTG at a final concentration of 0.1 mmol / L is needed to induce the expression of the transporter, thereby reducing the OD of the host bacterium *Escherichia coli*. 800 The values were significantly lower than those of the control, indicating that growth was significantly inhibited; at the same time, the growth ability of the expression strain in LB-Kana solid medium was greatly reduced.
[0017] (3) Multiple activation methods: This invention provides multiple activation methods, such as adding an inducer, changing light, temperature, etc., which makes the application of transmembrane transport protein NPF / SWEET as a growth regulation switch more flexible and controllable.
[0018] (4) Wide applicability: The transmembrane transport proteins provided in this invention are selected from the NPF and SWEET families. These two types of transmembrane transport proteins play important regulatory roles in cell metabolism, growth, and immunity. Therefore, this method is not only applicable to common host bacteria such as Escherichia coli, but can also be applied to other genetically engineered bacteria. Attached Figure Description
[0019] Figure 1 This is a schematic diagram illustrating the construction of pET-28a-NPF1.2, pET-28a-NPF2.5, pET-28a-NPF8.1, pET-28a-SWEET1, and pET-28a-SWEET5 in embodiments of the present invention.
[0020] Figure 2 Gel images validating the NPF1.2, NPF2.5, NPF8.1, SWEET1, and SWEET5 encoding genes.
[0021] Figure 3 The figure shows the plate experiment results of the growth regulation effect of Escherichia coli in the experimental group and the control group.
[0022] Figure 4 The start-up growth curves for expressing the growth regulation mechanism of transmembrane transport proteins NPF1.2, NPF2.5, NPF8.1, SWEET1, and SWEET5. Detailed Implementation
[0023] The following specific embodiments illustrate the implementation of the present invention. Those skilled in the art can easily understand other advantages and effects of the present invention from the content disclosed in this specification. The present invention can also be implemented or applied through other different specific embodiments, and various details in this specification can be modified or changed based on different viewpoints and applications without departing from the spirit of the present invention. It should be noted that, unless otherwise specified, the following embodiments and features can be combined with each other. Unless otherwise specified, the methods used in the embodiments of the present invention are conventional methods, and the reagents used are commercially available.
[0024] Example 1:
[0025] [Constructing genetically engineered bacteria containing growth regulatory switches]
[0026] To verify the biological functions of transmembrane transport proteins, PCR was performed using the primers shown in Table 1 from plasmids pUC-fFuCas9-HTBNLS-hph-NPF1.2, pUC-fFuCas9-HTBNLS-hph-NPF2.5, pUC-fFuCas9-HTBNLS-hph-NPF8.1, pUC-fFuCas9-HTBNLS-hph-SWEET1, and pUC-fFuCas9-HTBNLS-hph-SWEET5 (preparation method referred to Chinese Patent 2023110326389) to obtain the encoding genes of the corresponding target transmembrane transport proteins NPF1.2, NPF2.5, NPF8.1, SWEET1, and SWEET5. Figure 2 Next, using a one-step cloning method, the transmembrane transport protein encoding genes were ligated into the linearized plasmid pET-28a, respectively. After colony PCR verification and screening, recombinant plasmids containing growth regulatory switches, pET-28a-NPF1.2, pET-28a-NPF2.5, pET-28a-NPF8.1, pET-28a-SWEET1, and pET-28a-SWEET5, were obtained. The recombinant plasmids include target transport proteins, lactose operon elements, and kanamycin resistance selection tags, among other DNA elements. Figure 1 The recombinant plasmids containing growth regulatory switches were transformed into competent Escherichia coli BL21 to obtain genetically engineered bacteria containing growth regulatory switches.
[0027] The PCR reaction system consisted of 50 μL: 2 μL template, 25 μL 2×Phanta Mix Buffer, 2 μL each of forward and reverse primers, 1 μL dNTP Mix, 1 μL Phanta Mix Super-Fidelity, and ddH2O to bring the total to 50 μL (reagents used in the PCR reaction were purchased from Novizan Biosciences Co., Ltd.). The PCR reaction conditions were: 95℃ for 10 min, (95℃ for 30 s, 60℃ for 30 s, 72℃ for 1 min, 30 cycles), followed by a 72℃ extension for 10 min.
[0028] The preparation method of competent Escherichia coli BL21 cells is as follows: Place the strain stored at −80℃ on ice. After thawing, take a small amount of bacterial cells and streak them in three zones on an antibiotic-free plate. Incubate overnight at 37℃. Select morphologically correct single colonies and inoculate them into 10 mL LB tubes. Incubate at 37℃ and 200 rpm for 12 h. Take 200 μL of the bacterial culture from the tube and inoculate it into 50 mL LB shake flask medium. Incubate at 37℃ and 200 rpm until OD... 600 =0.4~0.6; Remove the shake flask and pre-cool on ice for 15~30 min, centrifuge at 4℃, 4500 Xg for 5 min, and collect the cells; discard the supernatant, add an appropriate amount of pre-cooled 0.1 M CaCl2 solution, resuspend the cells on ice, and incubate on ice for 30 min; centrifuge at 4℃, 4500 Xg for 6 min to collect the cells, add 1~2 mL of pre-cooled mixed solution containing 0.1 M CaCl2 and 15% glycerol, and resuspend the cells on ice; aliquot the suspended competent cells into sterile and pre-cooled EP tubes. For short-term use, store at −80℃.
[0029] The chemical transformation method for *E. coli* is as follows: Thaw competent *E. coli* cells BL21 on ice; inject 10 μL of recombinant plasmid into 100 μL of competent cells, mix the liquid by pipetting or gently tapping the tube wall, and incubate on ice for 30 min; heat shock in a 42℃ water bath for 90 s, and incubate on ice for 5 min; add 600 μL of sterile liquid LB medium, mix by pipetting, and incubate at 37℃ and 180 rpm for 1 h; spread 200 μL of the cultured bacterial solution onto LB plates containing kanamycin resistance; invert the plates in a 37℃ incubator for 12–16 h, and then verify the presence and sequence correctness of the plasmid by colony PCR.
[0030] Table 1. Primer Table
[0031] NPF1.2-F AGAAGGAGATATACCATGGAGAACCCTCCCAATGAAAC NPF1.2-R GTGGTGGTGGTGGTGATTGGTTTTAACAACTGGACTTA NPF2.5-F AGAAGGAGATATACCATGGCTGATTCAAAATCTGGTGAC NPF2.5-R GTGGTGGTGGTGGTGGGTTTTAACATCTTTAGGATCTT NPF8.1-F AGAAGGAGATATACCATGGAAGAAAAAGATGTGTATACGCAAGA NPF8.1-R TGGTGGTGGTGGTGATGTGCTCGACCAACAGCTTTCTT SWEET1-F AGAAGGAGATATACCATGAACATCGCTCACACTATCTTC SWEET1-R GTGGTGGTGGTGGTGAACTTGAAGGTCTTGCTTTCCAT SWEET5-F AGAAGGAGATATACCATGACCGACCCTCACACCGCTC SWEET5-R GTGGTGGTGGTGGTGAGCCTGACCGAGCTCGATGC pET-28a-F TGAGATCCGGCTGCTAACAAAGC pET-28a-R CATGGTATATCTCCTTCTTAAAGTTAAACAAAA
[0032] [Detection of Inducible Growth Regulation Capacity]
[0033] The empty vector pET-28a without transmembrane transport protein was used as the control group, and the transformed strain containing the transmembrane transport protein gene was used as the experimental group to evaluate the induced growth regulation ability of the strain.
[0034] The control strain and recombinant strain were cultured in test tubes at 37℃ and 180 rpm for 10 h, then inoculated into 10 mL LB shake flasks and cultured at 37℃ and 180 rpm for 2 h. The culture was continued until the OD reached... 800 When the concentration was approximately 0.6, 20 μL of IPTG was added to bring the final IPTG concentration in the LB shake flask to 0.1 Mmol / L. Induction culture was then performed under the following conditions: 20℃ for 20 h.
[0035] To understand the growth status of E. coli, samples were taken every 4 hours, and the OD values of the experimental and control groups were measured. 800 The effect of transporter protein expression as a growth regulatory switch on the growth of *E. coli* was assessed by evaluating bacterial cell concentration. Figure 4 ).
[0036] After the culture was completed, 100 μL of bacterial culture from each of the control and experimental groups was diluted 1000 times and then plated on LB-Kana solid medium for incubation at 37°C for 10 h. Colonies on the plates were then counted, and the results are shown below. Figure 3 The control group plates were densely covered with colonies, with more than 10,000 colonies; while the experimental group plates with the growth regulation switch activated had significantly fewer colonies than the control group plates, with a number of about 100 to 500. The calculated lethality / growth inhibition rate was about 95% to 98%, which is similar to the effect of traditional inactivation methods such as 75% alcohol.
[0037] pass Figure 4 The growth curve shown is Figure 3 The plate experiment shown demonstrates that transmembrane transport proteins NPF1.2, NPF2.5, NPF8.1, SWEET1, and SWEET5 can be expressed under low-concentration IPTG (0.1 mmol / L) induction conditions. Furthermore, their expression significantly inhibits or kills the growth of Escherichia coli, further illustrating that transmembrane transport proteins NPF / SWEET can serve as a growth regulatory switch for genetically engineered bacteria using Escherichia coli as the host.
[0038] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope of the present invention.
Claims
1. The application of transmembrane transport proteins as growth regulatory switches in genetically engineered bacteria, characterized in that, The transmembrane transporter protein is selected from at least one of NPF1.2, NPF2.5, NPF8.1, SWEET1, and SWEET5; the amino acid sequence of NPF1.2 is shown in SEQ ID NO. 1, the amino acid sequence of NPF2.5 is shown in SEQ ID NO. 2, the amino acid sequence of NPF8.1 is shown in SEQ ID NO. 3, the amino acid sequence of SWEET1 is shown in SEQ ID NO. 4, and the amino acid sequence of SWEET5 is shown in SEQ ID NO.
5.
2. The application as described in claim 1, characterized in that, The application includes: constructing the encoding gene of the transmembrane transporter into genetically engineered bacteria, and inducing the expression of the encoding gene of the transmembrane transporter to inhibit the growth of the genetically engineered bacteria or cause its death.
3. The application of transmembrane transport protein encoding genes in the preparation of genetically engineered bacteria removal kits, characterized in that, The transmembrane transporter is selected from at least one of NPF1.2, NPF2.5, NPF8.1, SWEET1, and SWEET5; the coding gene for NPF1.2 encodes the amino acid sequence shown in SEQ ID NO. 1, the coding gene for NPF2.5 encodes the amino acid sequence shown in SEQ ID NO. 2, the coding gene for NPF8.1 encodes the amino acid sequence shown in SEQ ID NO. 3, the coding gene for SWEET1 encodes the amino acid sequence shown in SEQ ID NO. 4, and the coding gene for SWEET5 encodes the amino acid sequence shown in SEQ ID NO.
5.
4. The application of a vector containing a transmembrane transporter protein encoding gene in the preparation of a genetically engineered bacterial growth regulation kit, characterized in that, The transmembrane transporter is selected from at least one of NPF1.2, NPF2.5, NPF8.1, SWEET1, and SWEET5; the coding gene for NPF1.2 encodes the amino acid sequence shown in SEQ ID NO. 1, the coding gene for NPF2.5 encodes the amino acid sequence shown in SEQ ID NO. 2, the coding gene for NPF8.1 encodes the amino acid sequence shown in SEQ ID NO. 3, the coding gene for SWEET1 encodes the amino acid sequence shown in SEQ ID NO. 4, and the coding gene for SWEET5 encodes the amino acid sequence shown in SEQ ID NO.
5.
5. The application as described in any one of claims 1, 3, and 4, characterized in that, The host bacteria of the genetically engineered bacteria are selected from Escherichia coli.