A fluorescent primer for detecting JAK2 gene V617F mutation and its application

Abstract

The present application relates to the field of molecular biological gene detection, and specifically to a fluorescent primer for detecting the JAK2 gene V617F mutation and its application. More specifically, the present application discloses a mutant-specific upstream primer as shown in SEQ No. 1. The present application also provides a composition, which comprises a mutant-specific upstream primer SEQ No. 1, a universal downstream primer SEQ No. 2 and a detection housekeeping gene composition SEQ No. 3, SEQ No. 4 and SEQ No. 5. The upstream primer of the present application and / or the composition and kit comprising the above upstream primer have high sensitivity and strong specificity in identifying the V617F mutation.

Description

Technical Field

[0001] The present application relates to the field of molecular biological gene detection, and specifically to a fluorescent primer for detecting the JAK2 gene V617F mutation and its application. Background Art

[0002] Myeloproliferative neoplasms (MPNs) are a large class of malignant diseases that originate from hematopoietic stem cells and are characterized by excessive proliferation of one or more lineages of myeloid hematopoietic cells. They mainly include polycythemia vera (PV), essential thrombocythemia (ET), primary myelofibrosis (PMF), and chronic myeloid leukemia (CML).

[0003] Studies have shown that MPN is usually accompanied by a mutation at position 1849 (G / T) of the JAK2 gene, which causes the valine (V) at position 617 of the protein to change to phenylalanine (F), thus causing a series of lesions. In PV patients, the mutation rate of JAK2-V617F is about 90%-95%, while in ET and PMF, the mutation rate is about 50-60%. JAKs (Janus Kinase) is a family of non-receptor tyrosine protein kinases, which currently has four members: JAK1, JAK2, JAK3, and TYK2. JAK2, or Janus Kinase 2, is regulated by the coding of the JAK gene family. The JAK2 tyrosine kinase signaling pathway is a major cytokine signaling pathway in cell differentiation. Cytokines bind to JAK2 to activate it, thereby activating the downstream STAT protein, which then imports the signal into the cell nucleus, thereby regulating gene expression and participating in multiple signaling pathways such as the hematopoietic system and the immune system.

[0004] WHO (2008) clearly listed JAK2-V617F mutation as one of the main diagnostic indicators for MPN. In the WHO (2016) classification guidelines, JAK2 detection became the main criterion for diagnosing MPN. The NCCN (2021) guidelines and CSCO guidelines for the diagnosis and treatment of malignant hematological diseases (2021) clearly listed molecular diagnosis such as JAK2 V617F as detection content as a reference indicator for the diagnosis, prognosis grading, and treatment of PV, ET, and PMF.

[0005] At present, there are many technologies used for JAK2 gene V617F mutation detection, including Sanger sequencing, second-generation sequencing (NGS), digital PCR, high-resolution melting curve method and allele-specific primer PCR (AS-PCR). Sanger sequencing is the gold standard for SNP detection, but the detection process is long, the operation is cumbersome, and the detection sensitivity is low. It can only detect mutations with a mutation ratio of more than 20%. This method is complicated to operate, has a long cycle, and is an open-tube operation, which greatly increases the possibility of contamination. At the same time, expensive sequencing instruments are required, and the instrument maintenance and maintenance are cumbersome. The second-generation sequencing (NGS), also known as massively parallel sequencing (MPS), includes a variety of sequencing technologies that can generate a large number of digital gene sequences at one time. It is a revolutionary progress following Sanger sequencing. It adopts the concept of parallel sequencing and can sequence millions or even billions of DNA molecules at the same time, achieving the goal of large-scale, high-throughput sequencing. Although NGS sequencing technology has the advantages of high throughput and can detect all mutations within the range, it is costly for a small number of sites, cumbersome operation, long time, strict quality control requirements, and complex data analysis and interpretation. Digital PCR is a technology for absolute quantification of nucleic acid molecules. Compared with qPCR, digital PCR can directly count the number of DNA molecules and absolutely quantify the starting sample. By dividing a sample into tens of thousands to millions of copies and assigning them to different reaction units, each unit contains one or more copies of the target molecule (DNA template), and PCR amplifying the target molecule in each reaction unit, the fluorescence signal of each reaction unit is statistically analyzed after the amplification. Advantages: The sensitivity can reach 0.001-0.0001%, with high specificity, and can detect target sequences in complex backgrounds; it can be highly tolerant to PCR reaction inhibitors; it does not need to rely on reference substances or standards, and can directly and accurately identify the target copy number and analyze small concentration differences; the experimental data analysis is convenient, the detection results of each droplet are interpreted as negative or positive, and the data analysis is automated; the mutation rate can be counted, and the mutation rate of the target point can be obtained through statistical analysis. Disadvantages: low throughput and high cost. High Resolution Melting (HRM) includes dye method and fluorescence resonance energy transfer (FRET) double probe method. The dye method has high requirements for fluorescent dyes and PCR instruments and is rarely used in clinical testing. Advantages: Detection sensitivity is 1%, high specificity, and good repeatability. Disadvantages: The high-resolution melting curve method has a long reaction time, and it is not easy to interpret the difference in Tm values ​​based on the HRM melting curve. The difference in the melting curve peaks of different genotypes is not obvious, so it is not widely used in clinical practice.Allele-specific primer PCR amplification method (AS-PCR) or amplification retardation mutation system (ARMS-PCR) utilizes the lack of 3'→5' exonuclease activity of Taq DNA polymerase. Only when the 3' terminal base of the allele-specific primer is completely complementary to the corresponding allele template, the PCR amplification reaction can proceed normally to obtain a specific product and generate a fluorescent signal. This method is currently the simplest and fastest method for detecting gene mutations or polymorphisms. Although the principle of this method is simple, mismatched primers will still cause non-specific amplification, and the amplification situation depends on the type of mutation and the base sequence around the detection site. Introducing mutant bases at the second to last or third position of the 3' can indeed increase the specificity of the reaction, but in some cases it is still impossible to completely eliminate non-specific amplification. In order to improve specificity, it may be necessary to introduce additional mismatches at other positions of the primer, and a large number of primers need to be screened. Sometimes the specificity is achieved, but the amplification efficiency is reduced too much and the sensitivity requirements cannot be met. Cast-PCR (Competitive allele specific Taqman PCR) invented by LIFE Company in the United States uses MGB-labeled Blocker to block background sequences that do not need to be detected, and uses allele-specific primers to amplify the target sequence. Although this improves the specificity of the test, the addition of an extra MGB blocking probe will inevitably increase the cost, and the addition of Blocker may reduce the reaction efficiency. Summary of the invention

[0006] In order to solve at least one of the above technical problems, a fluorescent primer for detecting the JAK2 gene V617F mutation and its application are developed.

[0007] In a first aspect, the present application provides a fluorescent primer for detecting the JAK2 gene V617F mutation, wherein the sequence of the fluorescent primer is shown in SEQ No. 1, the 5' end of the fluorescent primer is connected to a fluorescent reporter group, and the sixth nucleotide from the 3' end is connected to a fluorescent quencher group;

[0008] SEQ No.1:

[0009] 5'-GCAGAACGTTCTCACAAGCATTTGGTTTTAAATTCGTTCTGCTGTTTC-3'.

[0010] The above technical solution of the present application can specifically identify the JAK2 gene V617F mutation, has no specific amplification for the wild-type plasmid, and can detect genomic DNA samples with a mutation ratio of 0.1%, and can also detect whole blood samples without DNA extraction.

[0011] In the preferred embodiment of the present application, the fluorescent primer comprises 6 parts, as shown in the attachedFigure 1 As shown, they are respectively the first part: TGTTTC, the second part: fluorescence quenching group, the third part: CGTTCTGC, the fourth part: TTCTCACAAGCATTTGGTTTTAAATT, the fifth part: GCAGAACG and the sixth part: fluorescence reporter group.

[0012] In a preferred embodiment of the present application, the third part: CGTTCTGC and the fifth part: GCAGAACG are reverse complementary.

[0013] The fluorescent primers of the present application are specially designed, and the fluorescent reporter group and the fluorescent quencher group are introduced into the primers for modification. When amplification does not occur, the third part of the primer itself is complementary to the fifth part to form a partial double strand, and the fluorescent reporter group and the fluorescent quencher group are close to each other, and no fluorescence is emitted. When specific amplification occurs, the double strands of the complementary part of the primer itself are untied, and the fluorescent reporter group and the fluorescent quencher group are far apart, and fluorescence is emitted, thereby indicating the occurrence of amplification.

[0014] In a preferred embodiment of the present application, the fluorescent reporter group is selected from FAM, VIC, HEX, TET, JOE, ROX, CY3 and CY5.

[0015] In a preferred embodiment of the present application, the fluorescence quenching group is selected from BHQ or TAMRA.

[0016] In a preferred embodiment of the present application, the above-mentioned fluorescent reporter group and fluorescent quencher group are selected from one of the following combinations: FAM-BHQ, VIC-BHQ, HEX-BHQ, TET-BHQ, JOE-BHQ, ROX-BHQ, CY3-BHQ, CY5-BHQ, FAM-TAMRA, VIC-TAMRA, HEX-TAMRA, TET-TAMRA and JOE-TAMRA.

[0017] In a preferred embodiment of the present application, the fluorescent BHQ is selected from BHQ1, BHQ2 and BHQ3, preferably BHQ1.

[0018] The BHQ series fluorescent quencher group is a non-fluorescent dye that does not produce fluorescence itself, and can completely absorb the fluorescent signal emitted by the fluorescent reporter group within a certain range, greatly reducing the fluorescent background signal. Selecting the appropriate fluorescent quencher group according to the type of fluorescent reporter group can effectively reduce the impact of nonspecific amplification and further improve the accuracy of the data. Specifically, the BHQ series includes BHQ-0 (430-520nm), BHQ-1 (480-580nm), BHQ-2 (550-650nm), and BHQ-3 (620-730nm). The absorption spectrum range is very wide, from 430nm to near-infrared light, so a variety of fluorescent reporter groups can be used in combination.

[0019] In a preferred embodiment of the present application, the fluorescent reporter group is selected from FAM, and the fluorescent quencher group is selected from BHQ1.

[0020] FAM is a fluorescent reporter group, commonly used in TaqMan probes, molecular beacons and scorpion primers as a fluorescent reporter group, and is widely used in real-time PCR. In this application, FAM is usually used in combination with the fluorescent quencher group BHQ1. Using FAM as a fluorescent reporter group and BHQ1 as a fluorescent quencher group can firstly improve the sensitivity and specificity of the PCR reaction, which helps to ensure the accuracy of the experimental results. Secondly, this combination can effectively reduce the impact of nonspecific amplification, further improving the accuracy of the data.

[0021] In a second aspect, the present application provides a composition for detecting the V617F mutation of the JAK2 gene, wherein the composition comprises the fluorescent primer defined in any of the above technical solutions as an upstream primer.

[0022] In a preferred embodiment of the present application, the above composition further comprises a universal downstream primer shown in SEQ No. 2: SEQ No. 2: 5'-TGAGAAAGGCATTAGAAAGCCTGT-3'.

[0023] In a preferred embodiment of the present application, the above composition further comprises a detection housekeeping gene composition.

[0024] In a preferred embodiment of the present application, the above-mentioned detection housekeeping gene is selected from the ACTB gene.

[0025] In a preferred embodiment of the present application, the above-mentioned detection housekeeping gene composition comprises an upstream primer as shown in SEQ No.3, a downstream primer as shown in SEQ No.4 and a probe sequence as shown in SEQ No.5.

[0026] SEQ No.3: 5'-ACACTGTGCCCATCTACGAGG-3';

[0027] SEQ No.4: 5'-CGCGCTCGGTGAGGATCT-3';

[0028] SEQ No.5: 5'-CCCCATGCCATCCTGCGTCTG-3';

[0029] The 5' end of the SEQ No. 5 is connected to a fluorescent reporter group, and the 3' end of the SEQ No. 5 is connected to a fluorescent quencher group.

[0030] In a preferred embodiment of the present application, the fluorescent reporter group is selected from FAM, VIC, HEX, TET, JOE, ROX, CY3 and CY5.

[0031] In a preferred embodiment of the present application, the fluorescence quenching group is selected from BHQ or TAMRA.

[0032] In a preferred embodiment of the present application, the above-mentioned fluorescent reporter group and fluorescent quencher group are selected from one of the following combinations: FAM-BHQ, VIC-BHQ, HEX-BHQ, TET-BHQ, JOE-BHQ, ROX-BHQ, CY3-BHQ, CY5-BHQ, FAM-TAMRA, VIC-TAMRA, HEX-TAMRA, TET-TAMRA and JOE-TAMRA.

[0033] In a preferred embodiment of the present application, the fluorescent BHQ is selected from BHQ1, BHQ2 and BHQ3, preferably BHQ1.

[0034] In a preferred embodiment of the present application, the combination of the fluorescent reporter group and the fluorescent quencher group is different from the fluorescent reporter group and the fluorescent quencher group in the fluorescent primer in the first aspect of the present application, and preferably the color of the fluorescent reporter group is different.

[0035] In a preferred embodiment of the present application, the fluorescent reporter group is selected from VIC, and the fluorescent quencher group is selected from BHQ1.

[0036] VIC emits fluorescence in the green-yellow part of the visible spectrum and is often used on fluorescently labeled oligonucleotides at the 5' end. It can be used as a probe in various biomedical research such as real-time fluorescence PCR, hybridization, and fluorescence-based genetic analysis. VIC is often used in combination with fluorescence quenching groups such as BHQ1. First, it can improve the accuracy and stability of the experiment. Second, this combination can effectively reduce the impact of nonspecific amplification and further improve the accuracy of the data.

[0037] The third aspect of the present application provides a kit for detecting the JAK2 gene V617F mutation, the kit comprising:

[0038] (1) The composition defined in any of the above technical solutions;

[0039] (2) PCR reaction solution;

[0040] (3) a positive quality control product, which is a plasmid mixture containing the JAK2-V617F mutant sequence and the housekeeping gene ACTB sequence;

[0041] (4) A blank control substance, wherein the blank control substance is TE buffer.

[0042] In a preferred embodiment of the present application, the above composition comprises:

[0043] 1) An upstream fluorescent primer for detecting the JAK2 gene V617F mutation, the sequence of the upstream fluorescent primer is shown in SEQ No. 1, the 5' end of the upstream fluorescent primer is connected to a fluorescent reporter group, and the sixth nucleotide from the 3' end is connected to a fluorescent quencher group;

[0044] SEQ No.1:

[0045] 5'-GCAGAACGTTCTCACAAGCATTTGGTTTTAAATTCGTTCTGCTGTTTC-3'.

[0046] 2) Universal downstream primer shown in SEQ No.2:

[0047] SEQ No. 2: 5'-TGAGAAAGGCATTAGAAAGCCTGT-3'.

[0048] 3) Upstream primers for the detection housekeeping gene shown in SEQ No.3:

[0049] SEQ No.3: 5'-ACACTGTGCCCATCTACGAGG-3';

[0050] 4) Downstream primers for the detection housekeeping gene shown in SEQ No.4:

[0051] SEQ No.4: 5'-CGCGCTCGGTGAGGATCT-3';

[0052] 5) The detection housekeeping gene probe sequence shown in SEQ No.5:

[0053] SEQ No.5: 5'-CCCCATGCCATCCTGCGTCTG-3', the 5' end of SEQ No.5 is connected to a fluorescent reporter group, and the 3' end of SEQ No.5 is connected to a fluorescent quencher group.

[0054] In a preferred embodiment of the present application, the PCR reaction solution comprises a buffer, dNTP, Taq enzyme and UNG enzyme.

[0055] In a preferred embodiment of the present application, the final concentration of the JAK2 gene V617F mutant-specific upstream fluorescent primer and downstream primer in the reaction system is 200 nM.

[0056] In a preferred embodiment of the present application, in the reaction system, the final concentrations of the upstream primer, downstream primer and probe for detecting the housekeeping gene ACTB are all 100 nM.

[0057] In the preferred embodiment of the present application, the final concentration of dNTPs in the PCR reaction solution is 200 nM, the dosage of Taq enzyme is 1-2 U / reaction, and the dosage of UNG enzyme is 0.2 U / reaction.

[0058] In the preferred embodiment of the present application, the conditions of the PCR reaction are: 37°C for 2 min; pre-denaturation at 95°C for 2 min; denaturation at 95°C for 5 s, annealing at 60°C for 30 s (collecting fluorescence signals), and 50 cycles.

[0059] A fourth aspect of the present application provides a method for detecting the JAK2 gene V617F mutation, the method comprising the following steps:

[0060] (1) The samples to be tested are ready for use;

[0061] (2) performing PCR amplification using the kit defined in the above protocol;

[0062] (3) Signal acquisition and analysis.

[0063] In a preferred embodiment of the present application, the sample to be tested is selected from a peripheral blood genomic DNA sample or an unextracted whole blood sample.

[0064] In a preferred embodiment of the present application, the sample amount of peripheral blood genomic DNA is 10-100 ng, preferably 10 ng, 20 ng, 30 ng, 40 ng, 50 ng, 60 ng, 70 ng, 80 ng, 90 ng, 100 ng.

[0065] In the preferred embodiment of the present application, the PCR amplification procedure is:

[0066] Phase 1: UNG treatment, conditions were 37°C: 2 min, cycle number was 1;

[0067] The second stage: pre-denaturation, the condition is 95℃: 2min. The number of cycles is 1;

[0068] The third stage was PCR reaction with the conditions of 95°C: 5s, 60°C: 30s and 50 cycles.

[0069] In a preferred embodiment of the present application, the signal acquisition includes JAK2 V617F mutation signal acquisition and internal control gene signal acquisition.

[0070] In a preferred embodiment of the present application, the JAK2 V617F mutation signal acquisition is selected from the FAM channel to acquire the fluorescence signal.

[0071] In a preferred embodiment of the present application, the internal control gene signal acquisition is selected from the VIC channel to acquire the fluorescence signal.

[0072] Definition and Description

[0073] Unless otherwise indicated, the following terms and phrases used herein are intended to have the following meanings. A particular term or phrase should not be considered to be indefinite or unclear in the absence of a special definition, but should be understood according to the meaning understood by a person of ordinary skill in the art. When a trade name appears in this article, it is intended to refer to the corresponding commercial product or its active ingredient.

[0074] In the present invention, unless otherwise specified, the terms "comprise, include and contain" or equivalents are open expressions, which mean that in addition to the listed elements, components or steps, other unspecified elements, components or steps may also be included.

[0075] Unless otherwise specified, the term "multiple" in the present invention refers to an integer greater than or equal to 2, including but not limited to 2, 3, 4, 5, 6, 7, 8, 9 and 10, up to the maximum number of items in the optional items.

[0076] Unless otherwise specified, the term "optional" and / or "optionally" in the present application means that it can be selected or not selected. When it is not selected, it means that the step, the limitation or the component does not exist. When it is selected, it means that the relevant operation or limitation is performed according to the subsequent description.

[0077] In summary, the present invention includes at least one of the following beneficial effects:

[0078] 1. The present application is a fluorescent primer for detecting the JAK2 gene V617F mutation. When the JAK2 gene V617F mutation is not present in the sample, no amplification occurs, the primer forms a hairpin structure, the fluorescent reporter group and the fluorescent quencher group are close to each other and no fluorescence is emitted through fluorescence resonance energy transfer (FRET); when the JAK2 gene V617F mutation is present in the sample, the specific primer is amplified, the primer structure is opened to generate a fluorescent signal, and there is no need to add an additional target probe. Since there is no need to generate fluorescence by hydrolyzing the probe, the signal value is higher.

[0079] 2. The fluorescent primers of this application have good specificity and can detect 2×10 6There was no non-specific amplification when copying wild-type plasmid DNA, and there was no non-specific amplification when detecting 50ng / reaction of wild-type genomic DNA.

[0080] 3. The fluorescent primers of the present application have high sensitivity and can detect different JAK2-V617F mutation ratios in 10 ng of genomic DNA samples, and the detected mutation ratio can be as low as 0.1%.

[0081] 4. Using the fluorescent primers, compositions and / or kits of the present application, whole blood samples can be directly amplified without extraction, which greatly simplifies the detection process and shortens the detection time. BRIEF DESCRIPTION OF THE DRAWINGS

[0082] Figure 1 Schematic diagram of the structure of the JAK2 gene V617F mutant-specific upstream fluorescent primer when there is no amplification (1a) and when amplification occurs (1b);

[0083] Figure 2 To detect 2×10 6 PCR amplification curves of wild-type plasmid and internal reference ACTB plasmid DNA of the JAK2 gene copy;

[0084] Figure 3 This is the PCR amplification curve for testing multiple negative samples;

[0085] Figure 4 This is the PCR amplification curve for detecting 10 ng of genomic DNA samples containing different mutation ratios;

[0086] Figure 5 This is the PCR amplification curve for detecting 0.1% mutation in 10ng genomic DNA;

[0087] Figure 6 This is the PCR amplification curve of direct amplification of whole blood samples. DETAILED DESCRIPTION

[0088] The present invention is described in detail below by way of examples, but it is not intended to impose any adverse limitations on the present invention. The present invention has been described in detail herein, and specific embodiments thereof are also disclosed therein. It will be apparent to those skilled in the art that various changes and modifications may be made to the specific embodiments of the present invention without departing from the spirit and scope of the present invention.

[0089] Example 1 Preparation of composition

[0090] SEQ No. 1, SEQ No. 2, SEQ No. 3, SEQ No. 4 and SEQ No. 5 were chemically synthesized using a DNA synthesizer.

[0091] The 5' end of SEQ No. 1 is connected to the fluorescent reporter group FAM, and the sixth nucleotide from the 3' end is connected to the fluorescent quencher group BHQ1; the 5' end of SEQ No. 5 is connected to the fluorescent reporter group VIC, and the 3' end is connected to the fluorescent quencher group BHQ1.

[0092] SEQ No. 1 is subjected to annealing treatment to allow its third part and fifth part to be complementary to each other.

[0093] The synthesized primer and probe powders were diluted with TE buffer to a concentration of 100 μM, respectively, and mixed for later use.

[0094] Test Example 1 JAK2 gene wild-type plasmid and internal reference ACTB plasmid DNA amplification experiment

[0095] 1. Experimental instruments

[0096] 1. Test sample: the composition prepared in Example 1;

[0097] 2. Experimental instrument: ABI7500 real-time fluorescence quantitative PCR instrument;

[0098] 2. Experimental methods:

[0099] (1) Prepare 2×10 6 Copy the JAK2 gene wild-type plasmid and the internal reference ACTB plasmid DNA mixture for later use;

[0100] (2) using the composition prepared in Example 1 and a PCR reaction solution to prepare a PCR reaction system, the composition of which is shown in Table 1, and performing PCR amplification;

[0101] Table 1 PCR reaction system

[0102] Components Final concentration JAK2 gene V617F mutation-specific upstream fluorescent primer 200nM JAK2 gene V617F mutant downstream primers 200nM Upstream primer of ACTB 100nM Upstream primer of ACTB 100nM ACTB probe 100nM dNTPs 200nM Taq enzyme 2U / reaction UNG enzyme 0.2U / reaction TE buffer margin

[0103] The PCR amplification procedure is:

[0104] Phase 1: UNG treatment, conditions: 37°C for 2 min, cycle number 1;

[0105] The second stage: pre-denaturation, the condition is 95℃ for 2min. The number of cycles is 1;

[0106] The third stage: PCR reaction, the conditions are 95℃5s, 60℃30s; the number of cycles is 50;

[0107] (3) Signal acquisition and analysis: Collect fluorescence signals from the FAM channel and VIC channel.

[0108] 3. Experimental Results

[0109] After amplification, the results were analyzed as follows Figure 2 Results shown.

[0110] 4. Experimental Conclusion

[0111] Figure 2 The results show that as the number of cycles increases, the fluorescence signal (green) of the housekeeping gene ACTB gradually increases to a constant value, while the signal (blue) of the wild-type plasmid amplification of the JAK2 gene has been maintained at a low level. The internal control ACTB amplification is normal, and there is no non-specific amplification of the target. The wild-type plasmid of the JAK2 gene and the V617F mutant gene have only one base mutation, that is, the sequences have a high degree of similarity, and the fluorescent primer pair 2×10 6 When the wild-type plasmid of the copied JAK2 gene is detected, the fluorescent primers of the present application will not recognize and amplify the wild-type plasmid.

[0112] Test Example 2: Negative human peripheral blood genomic DNA sample amplification experiment

[0113] 1. Experimental instruments

[0114] 1. Test sample: the composition prepared in Example 1;

[0115] 2. Experimental instrument: ABI7500 real-time fluorescence quantitative PCR instrument

[0116] 2. Experimental methods:

[0117] (1) Prepare multiple negative human peripheral blood genomic DNA samples without JAK2 gene V617F mutation, with a sample volume of 20-100 ng genomic DNA, for future use;

[0118] (2) The composition prepared in Example 1 and the PCR reaction solution were used to prepare a PCR reaction system for PCR amplification. The PCR amplification procedure was as follows:

[0119] Phase 1: UNG treatment, conditions: 37°C for 2 min, cycle number 1;

[0120] The second stage: pre-denaturation, the condition is 95℃ for 2min. The number of cycles is 1;

[0121] The third stage: PCR reaction, the conditions are 95℃5s, annealing at 60℃30s; the number of cycles is 50;

[0122] (3) Signal acquisition and analysis: Collect fluorescence signals from the FAM channel and VIC channel.

[0123] 3. Experimental Results

[0124] After amplification, the results were analyzed as follows Figure 3 Results shown.

[0125] 4. Experimental Conclusion

[0126] Figure 3 It is shown that with the increase of cycle number, the fluorescence signal (green) of the housekeeping gene ACTB is gradually enhanced to a constant value, while the signal amplified by the negative human peripheral blood genomic DNA sample is maintained at a low level, indicating that the composition of the present application will not recognize and amplify negative human peripheral blood genomic DNA.

[0127] Test Example 3 Amplification experiment of genomic DNA samples with different V617F mutation ratios

[0128] 1. Experimental instruments

[0129] 1. Test sample: the composition prepared in Example 1;

[0130] 2. Experimental instrument: ABI7500 real-time fluorescence quantitative PCR instrument

[0131] 2. Experimental methods:

[0132] (1) preparing 10 ng genomic DNA samples containing different JAK2-V617F mutation ratios, wherein the mutation ratios were: 0.1% in 1 sample, 0.2% in 3 samples, 0.5% in 1 sample, 1% in 1 sample, 2% in 1 sample, 5% in 1 sample, 10% in 1 sample, and 20% in 1 sample; (2) preparing a PCR reaction system using the composition prepared in Example 1 and a PCR reaction solution, and performing PCR amplification on each sample in step (1), respectively, and the PCR amplification procedure was as follows:

[0133] Phase 1: UNG treatment, conditions: 37°C for 2 min, cycle number 1;

[0134] The second stage: pre-denaturation, the condition is 95℃ for 2min, the number of cycles is 1;

[0135] The third stage: PCR reaction, the conditions are 95℃5s, 60℃30s; the number of cycles is 50;

[0136] (3) Signal acquisition and analysis: Collect fluorescence signals from the FAM channel and VIC channel.

[0137] 3. Experimental Results

[0138] After amplification, the results were analyzed as follows Figure 4 Results shown.

[0139] 4. Experimental Conclusion

[0140] Figure 4It is shown that as the number of cycles increases, the amplification signals of the target genes in samples with different mutation ratios all increase with the increase in the number of cycles. On the one hand, it shows that the fluorescent primers of the present application can specifically identify the mutant gene and effectively amplify it. On the other hand, it also shows that the fluorescent primers of the present application can stably identify test samples containing different mutation ratios. Combined with the results shown in Test Examples 1-2, it can be shown that the fluorescent primers of the present application can highly specifically identify and amplify samples containing both mutant genes and negative genes, indicating that the fluorescent primers of the present application can be used for the detection of V617F gene mutations, and the detection results are accurate and reliable.

[0141] Test Example 4 Amplification experiment of genomic DNA sample containing 0.1% V617F mutation

[0142] 1. Experimental instruments

[0143] 1. Test sample: the composition prepared in Example 1;

[0144] 2. Experimental instrument: ABI7500 real-time fluorescence quantitative PCR instrument

[0145] 2. Experimental methods:

[0146] (1) Prepare 10 ng of genomic DNA sample, in which the mutation rate of V617F is 0.1%, and 20 replicate wells.

[0147] (2) The composition prepared in Example 1 and the PCR reaction solution were used to prepare a PCR reaction system, and the sample in step (1) was tested 20 times in parallel to perform PCR amplification. The PCR amplification procedure was as follows:

[0148] Phase 1: UNG treatment, conditions: 37°C for 2 min, cycle number 1;

[0149] The second stage: pre-denaturation, the condition is 95℃ for 2min, the number of cycles is 1;

[0150] The third stage: PCR reaction, the conditions are 95℃5s, 60℃30s; the number of cycles is 50;

[0151] (3) Signal acquisition and analysis: Collect fluorescence signals from the FAM channel and VIC channel.

[0152] 3. Experimental Results

[0153] After amplification, the results were analyzed as follows Figure 5 Results shown.

[0154] 4. Experimental Conclusion

[0155] Figure 5It is shown that as the number of cycles increases, the sample amplification signal in each duplicate well increases with the increase in the number of cycles, indicating that the fluorescent primers of the present application can identify and amplify 0.1% of mutant genes in 10ng of genomic DNA. For samples with low concentration, low content or low mutation ratio, the fluorescent primers of the present application can stably identify and amplify, proving that the fluorescent primers of the present application have high sensitivity. Using the composition containing the fluorescent primers of the present application for V617F gene mutation detection can help detect the disease as early as possible and obtain key information for diagnosis, which can guide clinical treatment and medication.

[0156] Test Example 5 Whole Blood Sample Amplification Experiment

[0157] 1. Experimental instruments

[0158] 1. Test sample: the composition prepared in Example 1;

[0159] 2. Experimental instrument: ABI7500 real-time fluorescence quantitative PCR instrument

[0160] 2. Experimental methods:

[0161] (1) Prepare a whole blood sample with a mutation ratio of 0.18%.

[0162] (2) The composition prepared in Example 1 and the PCR reaction solution were used to prepare a PCR reaction system, and PCR amplification was performed on the sample. The PCR amplification procedure was as follows:

[0163] Phase 1: UNG treatment, conditions: 37°C for 2 min, cycle number 1;

[0164] The second stage: pre-denaturation, the condition is 95℃ for 2min, the number of cycles is 1;

[0165] The third stage: PCR reaction, the conditions are 95℃5s, 60℃30s; the number of cycles is 50;

[0166] (3) Signal acquisition and analysis: Collect fluorescence signals from the FAM channel and VIC channel.

[0167] 3. Experimental Results

[0168] After amplification, the analysis was performed to obtain Figure 6 Results shown.

[0169] 4. Experimental Conclusion

[0170] Figure 6It is shown that as the number of cycles increases, the amplification signal of the whole blood sample in this example increases as the number of cycles increases, indicating that the fluorescent primers of the present application can identify and amplify the V617F mutant gene in the whole blood sample, and can identify and amplify the whole blood sample with a mutation ratio as low as 0.18%. The PCR reaction solution can lyse the whole blood sample when pre-denatured and heated at 95°C to release the DNA, and the Taq enzyme has a strong anti-inhibition ability and can tolerate the inhibition of the PCR reaction by multiple components in the whole blood sample. When the fluorescent primers of the present application are used to detect the V617F gene mutation, unextracted whole blood samples can be used, which greatly simplifies the detection operation and improves the detection speed, so that the test results can be obtained more quickly.

[0171] The above are all preferred embodiments of the present application, and the protection scope of the present application is not limited thereto. Therefore, any equivalent changes made according to the structure, shape, and principle of the present application should be included in the protection scope of the present application.

Claims

1. A composition for detecting the JAK2 gene V617F mutation, characterized in that: The composition comprises a fluorescent primer as shown in SEQ No. 1 as an upstream primer, a fluorescent reporter group is connected to the 5' end of the fluorescent primer, a fluorescent quencher group is connected to the sixth nucleotide from the 3' end, and further comprises a downstream primer as shown in SEQ No. 2: SEQ No.1: 5'-GCAGAACGTTCTCACAAGCATTTGGTTTTAAATTCGTTCTGCTGTTTC-3'; SEQ No. 2: 5'-TGAGAAAGGCATTAGAAAGCCTGT-3'.

2. The composition according to claim 1, characterized in that The fluorescent reporter group is selected from FAM, VIC, HEX, TET, JOE, ROX, CY3 and CY5, and the fluorescent quencher group is selected from BHQ and TAMRA.

3. The composition according to claim 2, characterized in that The fluorescent reporter group and the fluorescent quencher group are selected from one of the following combinations: FAM-BHQ, VIC-BHQ, HEX-BHQ, TET-BHQ, JOE-BHQ, ROX-BHQ, CY3-BHQ, CY5-BHQ, FAM-TAMRA, VIC-TAMRA, HEX-TAMRA, TET-TAMRA and JOE-TAMRA.

4. The composition according to claim 2 or 3, characterized in that The fluorescence quenching group BHQ is selected from BHQ1, BHQ2 and BHQ3.

5. The composition according to any one of claims 1 to 3, characterized in that The fluorescent reporter group is selected from FAM, and the fluorescent quencher group is selected from BHQ1.

6. The composition according to claim 1, characterized in that The composition also includes a detection housekeeping gene composition.

7. The composition according to claim 6, characterized in that The detection housekeeping gene composition comprises an upstream primer as shown in SEQ No. 3, a downstream primer as shown in SEQ No. 4 and a probe sequence as shown in SEQ No. 5, wherein the 5' end of the probe sequence is connected to a fluorescent reporter group, and the 3' end of the probe sequence is connected to a fluorescent quencher group. SEQ No.3: 5'-ACACTGTGCCCATCTACGAGG-3'; SEQ No.4: 5'-CGCGCTCGGTGAGGATCT-3'; SEQ No. 5: 5'-CCCCATGCCATCCTGCGTCTG-3'.

8. A kit for detecting the JAK2 gene V617F mutation, characterized in that: The kit comprises: (1) The composition according to any one of claims 6 to 7; (2) PCR reaction solution; (3) Positive quality control product, which is a recombinant plasmid mixture containing the JAK2-V617F mutant sequence and the housekeeping gene ACTB sequence; (4) A blank control, wherein the blank control is TE buffer.

9. The kit according to claim 8, characterized in that The PCR reaction solution comprises a buffer, dNTP, Taq enzyme and UNG enzyme.

Images