Application of a nucleic acid aptamer in multiplex immunofluorescence detection

Abstract

The invention discloses a multiple immunofluorescence imaging application of a nucleic acid aptamer in malignant tumor tissue, and relates to the field of tissue immunofluorescence technology. The nucleic acid aptamer includes Sgc8c, SL1 or SYL3C. The invention discloses a nucleic acid aptamer for pathological detection of malignant tumors, which provides an effective detection method for pathological diagnosis of tumors; the method is simple, rapid, sensitive and accurate; the immunofluorescence technology has strong specificity, high sensitivity, simple operation and good positioning performance in tissues.

Description

Technical Field

[0001] The invention belongs to the technical field of tissue immunofluorescence, and in particular relates to an application of a nucleic acid aptamer in multiple immunofluorescence detection. Background Art

[0002] Cancer is one of the leading causes of death in humans, with 10 million deaths in 2021. Protein tyrosine kinase 7 (PTK7) is a member of the Wnt-related pseudokinases and has been identified as a highly expressed antigen enriched in cancer stem cells (CSCs) from a variety of solid tumors, including but not limited to triple-negative breast cancer, non-small cell lung cancer, and ovarian cancer. Epithelial cell adhesion molecule (EpCAM) is a type 1 transmembrane glycoprotein. EpCAM is often upregulated in various primary tumor types and metastases, especially in adenocarcinomas, certain squamous cell carcinomas, and retinoblastomas. Due to the overexpression of EpCAM in cancer and its accessibility on the cell surface, EpCAM can be used as a marker for diagnostic and therapeutic intervention. Mesenchymal epithelial transition factor (c-Met) is a member of the receptor tyrosine kinase family. Studies have shown that overactivation of c-Met signals may promote the transformation of normal cells into tumor cells. The c-Met signaling pathway is abnormally expressed or mutated in various types of solid tumors such as lung cancer, gastric cancer, liver cancer, breast cancer, skin cancer, and colorectal cancer, and plays an important role in the occurrence and development of various tumors.

[0003] Aptamers are a class of single-stranded DNA or RNA molecules that can specifically bind to target molecules and can be obtained through a simple in vitro screening technique, namely the systematic evolution of ligands by exponential enrichment (SELEX) technology. Aptamers specifically recognize targets through their unique three-dimensional conformation and shape complementarity. Aptamers, also known as "chemical antibodies", can specifically bind and have many advantages, including low immunogenicity, small batch-to-batch variability, low-cost large-scale synthesis, physical stability, and easy chemical synthesis modification. These advantages have pushed aptamers to the forefront of many practical applications, such as disease diagnosis.

[0004] Multiplex immunofluorescence technology is to combine probes labeled with fluorescent substances of different excitation wavelengths with different antigens to be detected to form immune complexes with fluorescent substances. Fluorescent substances of different wavelengths produce bright fluorescence of different colors when irradiated by excitation light, so that the properties, location, and quantitative analysis of multiple antigens can be determined on a tissue section. At present, there are few applications of nucleic acid aptamers for multiplex immunofluorescence detection. Summary of the invention

[0005] The purpose of the present invention is to provide an application of nucleic acid aptamers in multiple immunofluorescence detection. The nucleic acid aptamers are used for pathological detection of malignant tumors, providing an effective detection means for tumor diagnosis; the method is simple, rapid, sensitive and accurate; the immunofluorescence technology has strong specificity, high sensitivity, simple operation and good positioning performance in tissues.

[0006] The technical solution adopted by the present invention to achieve the above-mentioned purpose is:

[0007] The present invention discloses the application of nucleic acid aptamers in multiple immunofluorescence detection, and the nucleic acid aptamers include Sgc8c, SL1 or SYL3C. Based on the superiority of nucleic acid aptamers, the present invention uses nucleic acid aptamers for pathological imaging analysis of malignant tumors, and provides an effective detection method for tumor diagnosis, which can detect antigen expression of the same paraffin tissue section in a simple, rapid, sensitive, accurate, low-cost, and multi-target manner. The application of nucleic acid aptamers provided by the present invention in immunohistochemical staining does not require antibodies of different species and has low cost; does not require multiple rounds of elution and incubation, and takes a short time; is not affected by batch differences; immunofluorescence technology has strong specificity, high sensitivity, simple operation, simple equipment requirements, and good positioning performance in tissues. Paraffin sections have good long-term preservation of tissue specimens, and the morphological structure of tissue cells is well maintained.

[0008] According to a specific embodiment, the multiplex immunofluorescence detection object includes paraffin tissue sections.

[0009] The invention also discloses an application method of nucleic acid aptamers in multiple immunofluorescence detection, comprising: when paraffin is taken for immunostaining, the labeled nucleic acid aptamers are used as antibodies in the antibody incubation step.

[0010] According to a specific embodiment, the labeled nucleic acid aptamer includes nucleic acid aptamers labeled with Alexa Fluor 488, ATTO550 and Alexa Fluor 647.

[0011] According to a specific embodiment, the paraffin immunostaining process further includes a dewaxing and hydration step and an antigen retrieval step.

[0012] According to a specific embodiment, the dewaxing and hydrating step and the antigen retrieval step are completed in one step by using a dewaxing retrieval agent.

[0013] According to a specific embodiment, the dewaxing repair agent components include fatty acid derivatives, Tween-20, polyethylene glycol octylphenyl ether and antigen repair solution.

[0014] The dewaxing repair agent for paraffin sections comprises: by weight, 12 to 25 parts of fatty acid derivatives, 3 to 10 parts of Tween-20, 2 to 5 parts of polyethylene glycol octylphenyl ether, and 60 to 80 parts of antigen repair solution.

[0015] According to a specific embodiment, the antigen retrieval solution is selected from citric acid, EDTA, Tris, Tris-EDTA or citraconic anhydride antigen retrieval solution, and the pH is 6.0-10.0.

[0016] According to a specific embodiment, fatty acid derivatives include products of the reaction of 3-[[5-methyl-2-(1-methylethyl)cyclohexyl]oxy]-1,2-propanediol and sodium tetrahydrogeraniol. The present invention adopts 3-[[5-methyl-2-(1-methylethyl)cyclohexyl]oxy]-1,2-propanediol and sodium tetrahydrogeraniol to prepare fatty acid derivatives, and compound them with other components to obtain a dewaxing repair agent, which is applied to immunohistochemical staining, can effectively improve the staining effect, and does not cause damage to tissue cells and other components during use, thereby obtaining high-quality staining films. The dewaxing repair agent provided by the present invention does not include a xylene dewaxing process, but its staining effect is at least not lower than that of xylene dewaxing, and is even better than that of xylene dewaxing; and it has no effect on the health of operators, and can be used to replace xylene dewaxing; at the same time, the dewaxing repair agent provided by the present invention is used for pathological detection, and antigen repair is performed while dewaxing, and no special hydration operation is required, saving a lot of experimental time.

[0017] The preparation method of the above fatty acid derivatives comprises:

[0018] (1) 3-[[5-methyl-2-(1-methylethyl)cyclohexyl]oxy]-1,2-propanediol and dichlorothionyl are mixed and refluxed to obtain a dichloro intermediate product M;

[0019] (2) Under a nitrogen atmosphere, tetrahydrogeraniol is added with metallic sodium to react to obtain sodium tetrahydrogeraniol;

[0020] (3) Take sodium tetrahydrogeraniol and slowly add the dichloro intermediate product M, and heat the reaction to obtain fatty acid derivatives.

[0021] Specifically, the preparation method of the above fatty acid derivatives comprises the following steps:

[0022] (1) Take 3-[[5-methyl-2-(1-methylethyl)cyclohexyl]oxy]-1,2-propanediol and add dichlorothionyl, stir and reflux at 80-85°C for 4-6 hours, evaporate the dichlorothionyl by vacuum distillation, then add anhydrous chloroform, continue to evaporate the residual dichlorothionyl, and cool to obtain the dichloro intermediate product M;

[0023] (2) adding sodium metal to tetrahydrogeraniol and introducing nitrogen protection (maintaining the introduction of nitrogen throughout the reaction), and reacting while ensuring that the generated hydrogen is discharged and recovered in time; the reaction is terminated when the sodium block in the reaction system completely disappears, and the reaction is cooled to room temperature to obtain sodium tetrahydrogeraniol;

[0024] (3) Take sodium tetrahydrogeraniol and slowly add the dichloro intermediate product M, control the reaction temperature to 70-75°C in an oil bath, react for 7-10 hours, filter to remove salt, distill under reduced pressure, and then purify by distillation through a distillation tower, collect the fraction at 160-165°C under a pressure of 0.5 mmHg to obtain fatty acid derivatives.

[0025] According to a specific implementation, in step (1), the ratio of 3-[[5-methyl-2-(1-methylethyl)cyclohexyl]oxy]-1,2-propanediol to dithionyl chloride is 0.7~1mmol:1mL; and the volume ratio of anhydrous chloroform to dithionyl chloride is 1:0.8~1.1.

[0026] According to a specific implementation manner, in step (2), the molar ratio of tetrahydrogeraniol to metallic sodium is 2.5-3.5:1.

[0027] According to a specific implementation manner, in step (3), the molar ratio of sodium tetrahydrogeraniol to dichloro intermediate product M is 2.1-2.5:1.

[0028] The preparation method of the above-mentioned dewaxing repair agent comprises: taking various raw materials and stirring and mixing them, stirring for 35 to 45 minutes at 45 to 50° C. and 400 to 500 r / min, and adjusting the pH to 6.0 to 10.0 to obtain the dewaxing repair agent.

[0029] The present invention also discloses the above-mentioned dewaxing and repairing and its application as a dewaxing agent and antigen repairing solution in immunohistochemical experiments, specifically including:

[0030] The dewaxing, hydration and antigen repair steps used for immunostaining of paraffin sections are specifically performed as follows: the paraffin section tissue is placed in the dewaxing repair agent prepared in this embodiment, microwaved at 85-95°C for 15-20 minutes, cooled at room temperature and washed with water for 3-5 times.

[0031] Another object of the present invention is to disclose the use of the above-mentioned dewaxing repair agent in immunohistochemical staining.

[0032] Compared with the prior art, the present invention has the following beneficial effects:

[0033] The present invention provides an effective detection method for the diagnosis of tumors, and applies nucleic acid aptamers to immunohistochemical staining, which is low in cost and time-consuming; it is not affected by batch differences; the immunofluorescence technology has strong specificity, high sensitivity, simple operation, simple equipment requirements, and good positioning performance in tissues. At the same time, the present invention uses 3-[[5-methyl-2-(1-methylethyl)cyclohexyl]oxy]-1,2-propanediol and sodium tetrahydrogeraniol to react to prepare fatty acid derivatives, and compound to obtain a dewaxing repair agent, which is applied to immunohistochemical staining, can effectively improve the staining effect, and the use process does not cause damage to tissue cells and other components, so as to obtain high-quality staining films. The dewaxing repair agent provided by the present invention is used for pathological detection, and antigen repair is performed while dewaxing, and no special hydration operation is required, saving a lot of experimental time.

[0034] The present invention can detect antigen expression of the same paraffin tissue section simply, quickly, sensitively, accurately, at low cost and with multiple targets.

[0035] Therefore, the present invention provides the application of nucleic acid aptamers in multiple immunofluorescence detection, and the nucleic acid aptamers are used for pathological detection of malignant tumors, providing an effective detection means for tumor diagnosis; the method is simple, rapid, sensitive and accurate; the immunofluorescence technology has strong specificity, high sensitivity, simple operation and good positioning performance in tissues. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] Figure 1 Schematic diagram of aptamer-based immunofluorescence imaging of paraffin-embedded tissue sections;

[0037] Figure 2 This is the imaging effect of nucleic acid aptamer Sgc8c on mouse transplanted tumor tissue;

[0038] Figure 3 This is the effect of using three nucleic acid aptamers to simultaneously image mouse transplanted tumor tissue;

[0039] Figure 4 This is the imaging effect of nucleic acid aptamer Sgc8c on human triple-negative breast cancer tissue sections;

[0040] Figure 5 These are the infrared test results of fatty acid derivatives. DETAILED DESCRIPTION

[0041] In order to make the purpose, technical scheme and advantages of the embodiments of the present invention clearer, each embodiment of the present invention will be described in detail below in conjunction with the embodiments. However, it will be appreciated by those skilled in the art that in each embodiment of the present invention, many technical details are proposed in order to enable the reader to better understand the present application. However, even without these technical details and various changes and modifications based on the following embodiments, the technical scheme claimed in the present application can be implemented.

[0042] Embodiment 1:

[0043] Immunostaining imaging of mouse transplanted tumor tissues using nucleic acid aptamer Sgc8c

[0044] In this example, the nucleic acid aptamer was synthesized according to the following sequence (5'-3): the nucleic acid aptamer Sgc8c sequence is: ATCTAACTGCTGCGC CGCCGGGAAAATACTGTACGGTTAGA, and the specific synthesis methods are conventional methods and operation steps that can be understood by those skilled in the art.

[0045] 1. Preparation of Tissue Paraffin Sections

[0046] After the mouse tumor tissue was removed, it was fixed, dehydrated, wax-impregnated, embedded, sliced, and baked according to the conventional process to obtain paraffin sections;

[0047] 2. Immunostaining of paraffin sections with aptamer Sgc8c

[0048] (1) Place the paraffin sections in an oven at 65°C for 30 minutes to make the sections adhere more firmly;

[0049] (2) Dewaxing and hydration: Immerse the paraffin sections in xylene twice, 3 min each time;

[0050] (3) Immerse the dewaxed sections in 100% ethanol for 1 min, 100% ethanol for 1 min, 95% ethanol for 40 s, 95% ethanol for 40 s, 75% ethanol for 1 min, and then wash with water for 1 min.

[0051] (4) Antigen repair: Immerse the sections in antigen repair solution (EDTA, PH = 9), boil for about 20 minutes, cool, and wash with water three times;

[0052] (5) The binding buffer was prepared with 1 mg / mL BSA, 0.1 mg / mL tRNA, 5 mM MgCl2, 4.5 g / L glucose and 1×DPBS buffer. The nucleic acid aptamer Sgc8c was diluted to 150 nM in the binding buffer. The blocking solution was prepared with 1% BSA, 0.1 mg / mL tRNA, 0.05% sodium dextran sulfate and 1×DPBS buffer.

[0053] (6) Block with blocking solution at room temperature for 30 min, then wash three times with washing solution (Leica), 3 min each time;

[0054] (7) Add Alexa Fluor 647-labeled nucleic acid aptamer Sgc8c at a concentration of 150 nM, incubate at room temperature for 20 min, and wash three times with washing solution (Leica), each time for 3 min;

[0055] (8) Stain the cell nucleus with DAPI (1 μg / mL) for 5 min, then wash three times with washing solution (Leica), 3 min each time; after immunostaining, spin dry the slides and seal them with anti-fluorescence quenching sealing medium;

[0056] (9) After sealing, observe under a fluorescence microscope; Figure 1 A is a schematic diagram of the present invention; Figure 1 B is the classic immunohistochemistry of PTK7. Figure 1 C is a schematic diagram of immunofluorescence imaging of paraffin-embedded tissue sections based on aptamers; the detection results are shown in Figure 2 As shown, Figure 2 A is the Sgc8c detection result, Figure 2 B is the result of PTK7 antibody detection. Figure 2 C is the detection result without adding aptamer, Figure 2 D is the co-localization analysis of Sgc8c and PTK7 antibody detection results. Figure 2 The results showed that the detection results of nucleic acid aptamer Sgc8c were similar to those of PTK7 antibody, with good co-localization results, while there was basically no signal when no aptamer was added.

[0057] Embodiment 2:

[0058] Multicolor immunofluorescence imaging of paraffin tissue sections using nucleic acid aptamers Sgc8c, SL1, and SYL3C

[0059] In this example, the aptamer was synthesized according to the following sequence (5'-3'):

[0060] PTK7 Aptamer (Sgc8c):

[0061] ATCTAACTGCTGCGCCGCGGGAAAATACTGTACGGTTAGA;

[0062] EpCAM aptamer (SYL3C): CACTACAGAGGTTGCGTCTGTCCCACGTTGTCATGGGGGGTTGGCCTG;

[0063] C-Met nucleic acid aptamer (SL1): ATCAGGCTGGATGGTAGCTCGGTCGGGGTGGGTGGGTTGGCAAGTCTGAT;

[0064] The specific synthesis methods are all conventional methods and operation steps that can be understood by those skilled in the art.

[0065] (1) Place the paraffin sections in an oven at 65°C for 30 minutes to make the sections adhere more firmly;

[0066] (2) Dewaxing and hydration: Immerse the paraffin sections in xylene twice, 3 min each time;

[0067] (3) Immerse the dewaxed sections in 100% ethanol for 1 min, 100% ethanol for 1 min, 95% ethanol for 40 s, 95% ethanol for 40 s, 75% ethanol for 1 min, and then wash with water for 1 min.

[0068] (4) Antigen repair: Immerse the sections in antigen repair solution (EDTA, PH = 9), boil for about 20 minutes, cool, and wash with water three times;

[0069] (5) Binding buffer was prepared with 1 mg / mL BSA, 0.1 mg / mL tRNA, 5 mM MgCl2, 4.5 g / L glucose and 1×DPBS buffer. The nucleic acid aptamer Sgc8c was diluted to 150 nM in the binding buffer, and the blocking solution was prepared with 1% BSA, 0.1 mg / mL tRNA, 0.05% sodium dextran sulfate and 1×DPBS buffer;

[0070] (6) Block with blocking solution at room temperature for 30 min, then wash three times with washing solution (Leica), 3 min each time;

[0071] (7) Add 200 nM Alexa Fluor 647-labeled Sgc8c, 150 nM Alexa Fluor 488-labeled SL1, and 100 nM ATTO 550-labeled SYL3C, incubate at room temperature for 20 min, and wash three times with washing solution (Leica), 3 min each time;

[0072] (8) Stain the cell nucleus with DAPI (1 μg / mL) for 5 min, then wash three times with washing solution (Leica), 3 min each time; after immunostaining, spin dry the slides and seal them with anti-fluorescence quenching sealing medium;

[0073] (9) After sealing, observe under a fluorescence microscope. Figure 3 As shown, Figure 3 A is the multicolor imaging result of three aptamers. Figure 3 B is a control experiment using 0 nM aptamer, Figure 3 C Single aptamer imaging. The results showed that adding three aptamers simultaneously could enable multicolor imaging, and the imaging effect was not significantly different from that of single-color aptamers.

[0074] Embodiment 3:

[0075] Aptamer Sgc8c for detection of human triple-negative breast cancer tissue sections

[0076] In this example, the aptamer was synthesized according to the following sequence (5'-3): nucleic acid aptamer Sgc8c: ATCTAACTGCTGCGCCGCCGGGAAAATACTGTACGGTTAGA.

[0077] The specific synthesis methods are all conventional methods and operation steps that can be understood by those skilled in the art.

[0078] 1. Preparation of Tissue Paraffin Sections

[0079] After the mouse tumor tissue was removed, it was fixed, dehydrated, wax-impregnated, embedded, sliced, and baked according to the conventional process to obtain paraffin sections;

[0080] 2. Immunostaining of paraffin sections with aptamer Sgc8c

[0081] (1) Place the paraffin sections in an oven at 65°C for 30 minutes to make the sections adhere more firmly;

[0082] (12) Dewaxing and hydration: Immerse the paraffin sections in xylene twice, 3 min each time;

[0083] (13) Immerse the dewaxed sections in 100% ethanol for 1 min, 100% ethanol for 1 min, 95% ethanol for 40 s, 95% ethanol for 40 s, 75% ethanol for 1 min, and then wash with water for 1 min.

[0084] (2) Antigen repair: Immerse the sections in antigen repair solution (EDTA, PH = 9), boil for about 20 minutes, cool, and wash with water three times;

[0085] (3) The binding buffer was prepared with 1 mg / mL BSA, 0.1 mg / mL tRNA, 5 mM MgCl2, 4.5 g / L glucose and 1×DPBS buffer. The nucleic acid aptamer Sgc8c was diluted to 150 nM in the binding buffer, and the blocking solution was prepared with 1% BSA, 0.1 mg / mL tRNA, 0.05% sodium dextran sulfate and 1×DPBS buffer;

[0086] (4) Block with blocking solution at room temperature for 30 min, then wash three times with washing solution (Leica), 3 min each time;

[0087] (5) Add 150 nM Alexa Fluor 647-labeled Sgc8c, incubate at room temperature for 20 min, and wash three times with washing solution (Leica), 3 min each time;

[0088] (6) Stain the cell nuclei with DAPI (1 μg / mL) for 5 min, and then wash three times with washing solution (Leica), 3 min each time. After immunostaining, spin dry the slides and seal them with anti-fluorescence quenching sealing medium.

[0089] (7) After sealing, observe under a fluorescence microscope. The test results are as follows: Figure 4 As shown, the results of nucleic acid aptamer Sgc8c detection were similar to those of PTK7 antibody IHC.

[0090] Embodiment 4:

[0091] A dewaxing repair agent for paraffin sections comprises: by weight, 20 parts of fatty acid derivatives, 6 parts of Tween-20, 3 parts of polyethylene glycol octylphenyl ether, and 70 parts of antigen repair solution (citric acid repair solution, pH 9.0).

[0092] Preparation of fatty acid derivatives:

[0093] (1) Take 3-[[5-methyl-2-(1-methylethyl)cyclohexyl]oxy]-1,2-propanediol and add dithionyl chloride (the ratio of the two is 0.85 mmol:1 mL), stir and reflux at 82°C for 5 h, distill off the dithionyl chloride under reduced pressure, then add anhydrous chloroform (the volume ratio of chloroform to dithionyl chloride is 1:0.95), continue to distill off the residual dithionyl chloride, and cool to obtain the dichloro intermediate product M;

[0094] (2) adding sodium metal to tetrahydrogeraniol at a molar ratio of 3.1:1, and introducing nitrogen protection (maintaining the introduction of nitrogen throughout the reaction), and reacting while ensuring that the generated hydrogen is discharged and recovered in time; the reaction is terminated when the sodium block in the reaction system completely disappears, and the reaction is cooled to room temperature to obtain sodium tetrahydrogeraniol;

[0095] (3) Take sodium tetrahydrogeraniol and slowly add the dichloro intermediate product M (the molar ratio of the two is 2.3:1), control the reaction temperature to 73°C in an oil bath, react for 9 hours, filter to remove salt, distill under reduced pressure, and then purify by distillation through a distillation tower, collect the fraction at 162~165°C under a pressure of 0.5 mmHg to obtain fatty acid derivatives.

[0096] The preparation method of the above-mentioned dewaxing repairing agent comprises: taking various raw materials and stirring and mixing them, stirring for 42 minutes at 47° C. and 460 r / min, and adjusting the pH to 9.0 to obtain the dewaxing repairing agent.

[0097] In immunohistochemistry experiments, it is used as a dewaxing agent and antigen repair solution as follows:

[0098] The specific process is the same as that of Example 1, except that the specific operations of the dewaxing, hydrating, and antigen repairing steps (i.e., steps (2) to (4)) of the immunostaining of paraffin sections are as follows: the paraffin section tissue is placed in the dewaxing repair agent prepared in this example, maintained at 90° C. for 18 min in a microwave oven, cooled at room temperature, and washed with water three times.

[0099] Embodiment 5:

[0100] The difference between a dewaxing repair agent for paraffin sections and Example 4 is that the fatty acid derivatives are prepared in this example.

[0101] The difference between the preparation of fatty acid derivatives and Example 4 is that an equal molar amount of 1,2-octanediol is used to replace 3-[[5-methyl-2-(1-methylethyl)cyclohexyl]oxy]-1,2-propanediol.

[0102] The preparation method of the dewaxing repair agent is the same as that of Example 4.

[0103] The difference between the use of the dewaxing agent and antigen repair solution in the immunohistochemistry experiment and that in Example 4 is that the dewaxing repair agent is prepared in this example.

[0104] Embodiment 6:

[0105] The difference between a dewaxing repair agent for paraffin sections and Example 5 is that it further comprises 2 to 8 parts by weight of diethylenetriaminepentaacetic acid dianhydride and 1 to 5 parts by weight of ethylthiocyanate. The present invention adds diethylenetriaminepentaacetic acid dianhydride and ethylthiocyanate to the dewaxing repair agent, and the simultaneous use of the two has a synergistic enhancement effect; the combination with other components is applied to immunohistochemical staining to further enhance the staining effect and obtain a better quality section.

[0106] In this embodiment, 5 parts by weight of diethylenetriaminepentaacetic acid dianhydride and 4 parts by weight of ethyl thiocyanate are added to the dewaxing repair agent.

[0107] The preparation method of the dewaxing repair agent is the same as that in Example 5.

[0108] The difference between the use of the dewaxing agent and antigen repair solution in the immunohistochemistry experiment and that in Example 4 is that the dewaxing repair agent is prepared in this example.

[0109] Embodiment 7:

[0110] The dewaxing repair agent for paraffin sections is different from Example 6 in that diethylenetriaminepentaacetic acid dianhydride is used instead of ethylthiocyanate.

[0111] The preparation method of the dewaxing repair agent is the same as that of Example 6.

[0112] The difference between the use of the dewaxing agent and antigen repair solution in the immunohistochemistry experiment and Example 6 is that the dewaxing repair agent is prepared in this example.

[0113] Embodiment 8:

[0114] The dewaxing repair agent for paraffin sections is different from Example 6 in that ethylthiocyanate is used instead of diethylenetriaminepentaacetic dianhydride.

[0115] The preparation method of the dewaxing repair agent is the same as that of Example 6.

[0116] The difference between the use of the dewaxing agent and antigen repair solution in the immunohistochemistry experiment and Example 6 is that the dewaxing repair agent is prepared in this example.

[0117] Test Example 1:

[0118] Infrared characterization

[0119] The test was conducted using a Fourier infrared spectrometer with a test range of 500~4000cm -1 .

[0120] The fatty acid derivatives prepared in Example 4 were subjected to the above test, and the results were as follows: Figure 5 As shown in the figure, in the infrared spectrum of fatty acid derivatives, 3000~2800cm -1 The characteristic absorption peaks of methyl and methylene appear in the range of 1107cm -1 The characteristic absorption peak of the CO bond appears near the surface of the carbon monoxide bond. The above results indicate that the fatty acid derivatives in Example 4 were successfully prepared.

[0121] Test Example 2:

[0122] Dyeing effect determination

[0123] Result judgment criteria: localized in the cell nucleus, 0% of the positive cells were recorded as "-", 1-10% of the positive cells were recorded as "+", 11-50% of the positive cells were recorded as "++", 51-80% of the positive cells were recorded as "+++", and >80% of the positive cells were recorded as "++++".

[0124] The dyeing results in Examples 4 to 8 are shown in Table 1:

[0125] Table 1 Staining test results

[0126]

[0127] From the data analysis in Table 1, it can be seen that the dewaxing repair agent provided in Example 4 of the present invention is used for immunohistochemical staining, and its staining effect is significantly better than that of Example 5, indicating that the use of 3-[[5-methyl-2-(1-methylethyl)cyclohexyl]oxy]-1,2-propanediol and sodium tetrahydrogeraniol to prepare fatty acid derivatives and apply them to dewaxing repair agents can effectively enhance the immunohistochemical staining effect. The effect of Example 6 is significantly better than that of Example 7 and Example 8, and the effects of Example 7 and Example 8 are not significantly improved compared with Example 6, indicating that the use of diethylenetriamine pentaacetic acid dianhydride and ethylthiocyanate in combination and added to the dewaxing repair agent has a synergistic enhancement effect and can significantly improve the immunohistochemical staining effect.

[0128] The conventional techniques in the above embodiments are prior arts known to those skilled in the art, and thus will not be described in detail here.

[0129] The above is only a specific embodiment of the present invention, but the protection scope of the present invention is not limited thereto. Any person skilled in the art can easily think of changes or substitutions within the technical scope disclosed by the present invention, which should be included in the protection scope of the present invention. Therefore, the protection scope of the present invention should be based on the protection scope of the claims.

[0130] The embodiments and / or implementation methods described above are only used to illustrate the preferred embodiments and / or implementation methods for realizing the technology of the present invention, and are not intended to limit the implementation methods of the technology of the present invention in any form. Any technical personnel in this field may make slight changes or modifications to other equivalent embodiments without departing from the scope of the technical means disclosed in the content of the present invention, but they should still be regarded as technologies or embodiments that are essentially the same as the present invention.

[0131] This article uses specific examples to illustrate the principles and implementation methods of this application. The description of the above embodiments is only used to help understand the method and its core ideas of this application. The above is only the preferred implementation method of this application. It should be pointed out that due to the limitations of textual expression and the objective existence of infinite specific structures, ordinary technicians in this technical field can make several improvements, modifications or changes without departing from the principles of this application, and can also combine the above technical features in an appropriate manner; these improvements, modifications, changes or combinations, or the direct application of the concept and technical solution of the invention to other occasions without improvement, should be regarded as the scope of protection of this application.

Claims

1. A multiplex immunofluorescence assay for non-diagnostic purposes, comprising: When paraffin is taken for immunostaining, fluorescently labeled aptamers are used as recognition molecules in the step of incubating nucleic acid aptamers; The labeled aptamers include Alexa Fluor 488, ATTO550 and Alexa Fluor 647 labeled aptamers; the aptamers include Sgc8c, SL1 or SYL3C; The paraffin immunostaining process also includes a dewaxing and hydrating step and an antigen repairing step, and the dewaxing and hydrating step and the antigen repairing step are completed in one step by a dewaxing repairing agent; The dewaxing repair agent comprises: by weight, 12 to 25 parts of fatty acid derivatives, 3 to 10 parts of Tween-20, 2 to 5 parts of polyethylene glycol octylphenyl ether, and 60 to 80 parts of antigen repair solution, wherein the fatty acid derivative comprises a product of the reaction of 3-[[5-methyl-2-(1-methylethyl)cyclohexyl]oxy]-1,2-propylene glycol and sodium tetrahydrogeraniol; The preparation of the fatty acid derivatives comprises: (1) Take 3-[[5-methyl-2-(1-methylethyl)cyclohexyl]oxy]-1,2-propanediol and add dichlorothionyl, stir and reflux at 80-85°C for 4-6 hours, evaporate the dichlorothionyl by vacuum distillation, then add anhydrous chloroform, continue to evaporate the residual dichlorothionyl, and cool to obtain the dichloro intermediate product M; (2) adding sodium metal to tetrahydrogeraniol and introducing nitrogen to react while ensuring that the generated hydrogen is discharged and recovered in time; the reaction is terminated when the sodium block in the reaction system completely disappears, and the reaction is cooled to room temperature to obtain sodium tetrahydrogeraniol; (3) Sodium tetrahydrogeraniol is slowly added to the dichloro intermediate M, the reaction temperature is controlled to 70-75°C in an oil bath, the reaction is carried out for 7-10 hours, the salt is removed by filtration, and the product is distilled under reduced pressure. The product is then purified by distillation in a distillation tower, and the fraction at 160-165°C is collected under a pressure of 0.5 mmHg to obtain fatty acid derivatives; The dosage ratio of 3-[[5-methyl-2-(1-methylethyl)cyclohexyl]oxy]-1,2-propanediol to dichlorothionyl is 0.7~1mmol:1mL; the volume ratio of anhydrous chloroform to dichlorothionyl is 1:0.8~1.1; the molar ratio of tetrahydrogeraniol to metallic sodium is 2.5~3.5:1; the molar ratio of sodium tetrahydrogeraniol to dichloro intermediate M is 2.1~2.5:

1.

2. A dewaxing repair agent, comprising: By weight, 12 to 25 parts of fatty acid derivatives, 3 to 10 parts of Tween-20, 2 to 5 parts of polyethylene glycol octylphenyl ether, and 60 to 80 parts of antigen repair solution; the fatty acid derivatives include the product of the reaction of 3-[[5-methyl-2-(1-methylethyl)cyclohexyl]oxy]-1,2-propanediol and sodium tetrahydrogeraniol; The preparation of the fatty acid derivatives comprises: (1) Take 3-[[5-methyl-2-(1-methylethyl)cyclohexyl]oxy]-1,2-propanediol and add dichlorothionyl, stir and reflux at 80-85°C for 4-6 hours, evaporate the dichlorothionyl by vacuum distillation, then add anhydrous chloroform, continue to evaporate the residual dichlorothionyl, and cool to obtain the dichloro intermediate product M; (2) adding sodium metal to tetrahydrogeraniol and introducing nitrogen to react while ensuring that the generated hydrogen is discharged and recovered in time; the reaction is terminated when the sodium block in the reaction system completely disappears, and the reaction is cooled to room temperature to obtain sodium tetrahydrogeraniol; (3) Sodium tetrahydrogeraniol is slowly added to the dichloro intermediate M, the reaction temperature is controlled to 70-75°C in an oil bath, the reaction is carried out for 7-10 hours, the salt is removed by filtration, and the product is distilled under reduced pressure. The product is then purified by distillation in a distillation tower, and the fraction at 160-165°C is collected under a pressure of 0.5 mmHg to obtain fatty acid derivatives; The dosage ratio of 3-[[5-methyl-2-(1-methylethyl)cyclohexyl]oxy]-1,2-propanediol to dichlorothionyl is 0.7~1mmol:1mL; the volume ratio of anhydrous chloroform to dichlorothionyl is 1:0.8~1.1; the molar ratio of tetrahydrogeraniol to metallic sodium is 2.5~3.5:1; the molar ratio of sodium tetrahydrogeraniol to dichloro intermediate M is 2.1~2.5:

1.

3. Use of the dewaxing repair agent according to claim 2 in immunohistochemical staining.

Images