A peanut seed-specific gene promoter 0B3TGP and its application

Abstract

The present invention provides a peanut seed specific gene promoter 0B3TGP and its application, and relates to the technical field of plant genetic engineering. The promoter 0B3TGP is selected from SEQ ID NO.01, a sequence reversely complementary to SEQ ID NO.01, SEQ ID NO.02, a DNA or RNA sequence hybridizing with SEQ ID NO.01 or SEQ ID NO.02, a sequence having at least 95% identity with the sequence of SEQ ID NO.01 or SEQ ID NO.02, and a DNA or RNA sequence complementary to any one of SEQ ID NO.01 or SEQ ID NO.02; the promoter 0B3TGP can be used or operated to drive the target gene to be expressed in the peanut seed tissue cells, thereby achieving the purpose of expressing the target gene in the specific peanut seed tissue cells.

Description

Technical Field

[0001] The present invention relates to the technical field of plant genetic engineering, and in particular to a peanut seed-specific gene promoter 0B3TGP and an application thereof. Background Art

[0002] A promoter is a DNA sequence that RNA polymerase recognizes, binds to, and starts transcription. It contains conserved sequences required for RNA polymerase specific binding and transcription initiation. Most of them are located upstream of the transcription start site of the structural gene, and the promoter itself is not transcribed. However, some promoters (such as tRNA promoters) are located downstream of the transcription start site, and these DNA sequences can be transcribed. The characteristics of promoters were originally identified by mutations that can increase or decrease the transcription rate of genes. Promoters are generally located upstream of the transcription start site.

[0003] With the rapid development of pharmaceutical technology and genetic engineering technology, in order to meet the low cost and high efficiency in biosynthesis fields such as drug production, plant, animal or microbial cells are used as reactors for genetic modification and gene transformation to efficiently produce heterologous proteins. They are often used in the production of products such as medicinal proteins, antigens and vaccines, and in the cultivation of new varieties of crops with high nutritional value, high active ingredient content or other excellent traits.

[0004] Crops bred through genetic engineering can have a variety of excellent traits that are difficult to obtain or stabilize through conventional breeding models, or enhance the expression of various traits themselves, thereby obtaining new crop varieties with excellent disease and pest resistance, lodging resistance, herbicide resistance, high nutritional value, high active ingredient content or other excellent traits. They have significant cost-reduction and efficiency-enhancing capabilities in agricultural production applications and have broad application prospects. However, there are also potential problems such as certain exogenous ingredients that may induce human immune responses or destroy original nutrients, which need to be avoided in gene editing.

[0005] Among them, the biggest advantage of transgenic plants as oral vaccine synthesis reactors is that they can use plant cell walls to form natural biological capsules to avoid the protein structure being destroyed by the digestive system after oral administration. Only simple ingestion is needed to allow the active ingredients to enter the intestines, stimulate specific immune responses under the stimulation of the intestinal mucosa, and enable the human body to gain immunity. Such vaccines have greatly changed the production methods, vaccination patterns and economic costs of traditional vaccines, and have important social significance and broad development prospects. In addition, important protein and peptide drugs such as human insulin, hemoglobin, immunoglobulin, and enkephalin have also been industrialized and commercialized in the production and application of plant cell reactors.

[0006] At present, the most prominent problem in the production of exogenous gene expression products by transgenic plant cell reactors is the insufficient gene expression, which is the biggest obstacle to the application of plants to produce medicinal proteins. On the one hand, this problem can be solved by using the characteristics of high metabolic rate and continuous division of stem cells such as callus tissue as reactors to make up for this shortcoming. On the other hand, it is also necessary to increase the expression level of such exogenous genes in single cells. To increase the expression level of target genes, we can start from the molecular biology level, such as using strong promoters, specific promoters or leading sequences to allow the target exogenous genes to have higher transcription and translation activities to increase the yield of target products, or control their high expression in seed tissues and specific external environmental conditions, so that in production practice, seeds can be collected under specific conditions for target product extraction instead of whole plant extraction, which will greatly reduce production costs. Summary of the invention

[0007] In view of the deficiencies in the prior art, the present invention provides a peanut seed-specific gene promoter 0B3TGP and its application, which utilizes the specific gene promoter 0B3TGP to drive the expression of a target gene in peanut seed tissue cells, thereby achieving the purpose of expressing the target gene in specific peanut seed tissue cells and cultivating a new high-value crop variety.

[0008] To achieve the above objectives, the technical solution of the present invention is implemented through the following technical solutions:

[0009] A peanut seed-specific gene promoter 0B3TGP, wherein the peanut seed-specific gene promoter 0B3TGP can drive a target gene to be specifically and highly expressed in seed tissue cells in peanut seed tissue cells, and the DNA nucleotide sequence of the specific gene promoter 0B3TGP is selected from any one of the following sequences:

[0010] (1) The DNA nucleotide sequence shown in SEQ ID NO.01:

[0011] TTTTTATATATTTATGTCGGATTGTAGTATAATAGTGATTTGAGATATTTTAAGTGAGAGAGTGTTGTTGGCATATATAATAGTGAAAAATTCCGAGAGAGAGAGAGAGAGAGGAGAGATTGAGAGTAGCGAAG;

[0012] (2) A sequence that is reverse complementary to the DNA nucleotide sequence shown in SEQ ID NO.01, that is, a single-stranded sequence that can form a complete base pairing with the original sequence to form a double-stranded structure and in the opposite direction, such as SEQ ID NO.02:

[0013] CTTCGCTACTCTCAATCTCTCCTCTCTCTCTCTCTCTCTCG GAATTTTTCACTATTATATATGCCAACAACACTCTCTCACTTAAAAT ATCTCAAATCACTATTATACTACAATCCGACATAAATATATAAAAA;

[0014] (3) a nucleic acid DNA or RNA sequence that can hybridize with the sequence of SEQ ID NO.01 or SEQ ID NO.02;

[0015] (4) a sequence having at least 95% sequence identity with the sequence described in (1) or (2);

[0016] (5) A DNA or RNA sequence complementary to any of the sequences described in (1) or (2).

[0017] Preferably, the promoter 0B3TGP is obtained by PCR amplification technology.

[0018] Preferably, during the PCR amplification process, the following two primers are configured according to the DNA nucleotide sequence shown in SEQ ID NO.01 for amplification:

[0019] (1) SEQ ID NO.03: GTAATCATCACACTACATTGTCTCA;

[0020] (2) SEQ ID NO. 04: CTTCGCAATTTGGCTAAGTAAACAT.

[0021] The specific gene promoter 0B3TGP is applied to peanut seed gene editing or transgenic operation to cultivate new varieties.

[0022] Preferably, the application method is to utilize or operate the gene promoter 0B3TGP to drive the expression of the target gene in the peanut seed tissue cells, thereby utilizing the seed cells as a reactor to synthesize related proteins at the molecular biology level.

[0023] Preferably, the specific process of the application is to perform transgenic operation on peanut seeds, use the pCAMBIA2300 plasmid sequence as a vector, construct a DNA double strand of peanut seed-specific gene promoter 0B3TGP-target gene-NOS terminator through enzyme cutting and ligation reaction, and use the plant expression vector to transform the target plant to complete genetic transformation.

[0024] The present invention provides a peanut seed-specific gene promoter 0B3TGP and its application, which has the advantages of:

[0025] The present invention provides a new peanut seed-specific gene promoter 0B3TGP, which can be used or operated to drive the target gene to be expressed in peanut seed tissue cells, thereby achieving the purpose of expressing the target gene in specific peanut seed tissue cells. In the molecular biology level breeding of agricultural production, the peanut seed tissue cells can be used as reactors in this way to carry out genetic modification and gene transformation to efficiently produce heterologous proteins or enhance the expression of self-proteins and produce various nutrients such as fatty acids. It is often used in the production of products such as medicinal proteins, antigens and vaccines, or in the cultivation of varieties with excellent traits such as high nutritional value and high yield. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 This is the electrophoresis diagram of PCR amplification of the peanut seed-specific gene promoter 0B3TGP in Example 1 of the present invention. DETAILED DESCRIPTION

[0027] In order to make the purpose, technical solution and advantages of the embodiments of the present invention clearer, the technical solution in the embodiments of the present invention is clearly and completely described below in combination with the embodiments of the present invention. Obviously, the described embodiments are part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0028] Embodiment 1:

[0029] PCR amplification of peanut seed-specific gene promoter 0B3TGP:

[0030] 1. Select the DNA nucleotide sequence shown in SEQ ID NO.01 as the peanut seed-specific gene promoter 0B3TGP sequence;

[0031] 2. Configure two primers according to the above sequence:

[0032] SEQ ID NO.03: GTAATCATCACACTACATTGTCTCA;

[0033] SEQ ID NO. 04: CTTCGCAATTTGGCTAAGTAAACAT.

[0034] 3. Prepare a DNA amplification system based on Phusion DNA polymerase: The preparation method is to mix the following, and the ratio here is based on a total system volume of 50 μL as an example:

[0035] (1)dd H 2O 30.5 μL

[0036] (2) 10× Buffer 5 μL

[0037] (3) dNTP (10mmol / L) 1μL

[0038] (4)SEQ ID NO.03 (10μmol / L) 5μL

[0039] (5)SEQ ID NO.04 (10μmol / L)5μL

[0040] (6)MgCl 2 (50mmol / L)0.5μL

[0041] (7) Peanut genomic DNA 2μL

[0042] (8) Phusion DNA polymerase 1 μL;

[0043] 4. Run the PCR amplification program: Place the above amplification system into a PCR thermal cycler and perform the following thermal cycle steps:

[0044] (1) 98°C, 5 min

[0045] (2) 98°C, 30 seconds

[0046] (3) 55°C, 30 seconds

[0047] (4) 72°C, 3 min

[0048] (5) Repeat steps (2) to (4) 20 times

[0049] (6) 72°C, keep warm for 20 min;

[0050] The DNA fragment with a length of 0.22 kb was recovered by electrophoresis.

[0051] pEASY-Blunt was used for blunt-end ligation and transformed into DH5α Escherichia coli competent cells to complete sequencing.

[0052] Embodiment 2:

[0053] The peanut seed-specific gene promoter OB3TGP obtained in Example 1 above was used for crop genome integration operation:

[0054] By utilizing the tissue specificity of the peanut seed-specific gene promoter 0B3TGP, the peanut seed-specific gene promoter 0B3TGP is operated to drive the GFP fluorescent protein gene to express in the peanut seed tissue cells, thereby achieving the purpose of expressing the GFP fluorescent protein gene in the peanut seed tissue cells:

[0055] 1. Using the pCAMBIA2300 plasmid sequence as a vector, a double-stranded DNA of peanut seed-specific gene promoter 0B3TGP, GFP fluorescent protein gene, and NOS terminator was constructed through enzyme digestion and ligation reaction, and the target plant was transformed using the plant expression vector to complete genetic transformation;

[0056] 2. Tissue culture and subsequent differentiation induction were performed on the callus of Fuhua 54 peanut in MB medium to obtain 20 complete plants of the original Fuhua 54 peanut variety and the transgenic Fuhua 54 peanut variety (genetic transformation positive variety) in which the GFP fluorescent protein gene was inserted using the peanut seed-specific gene promoter 0B3TGP-GFP fluorescent protein gene-NOS terminator plasmid sequence. The plants were planted under normal greenhouse conditions for 120 days until the plants matured and bore fruit. The seeds of the two plants were collected and the cotyledons and embryos were separated separately. The two peanut seeds were observed for the presence and intensity of fluorescence under ultraviolet light irradiation. According to the observation, no fluorescence was found in the tissues tested of the original Fuhua 54 peanut variety, while 92% of the tissues of the Fuhua 54 peanut variety (genetic transformation positive variety) showed fluorescence.

[0057] That is, the peanut seed-specific gene promoter 0B3TGP can enhance the expression of the GFP fluorescent protein gene in peanut seed tissue cells.

[0058] 2. Verify that the effect of the peanut seed-specific gene promoter 0B3TGP on the enhanced expression of the GFP fluorescent protein gene when used for gene editing is only specific to peanut seed tissue cells:

[0059] The remaining parts of the original peanut variety Fuhua 54 obtained after the planting and the transgenic peanut variety Fuhua 54 (genetic transformation positive variety) in which the GFP fluorescent protein gene was inserted using the peanut seed-specific gene promoter 0B3TGP-GFP fluorescent protein gene-NOS terminator plasmid sequence, i.e., the protein extracts of the root, stem, leaf, and shell part and the protein extracts of the seed part were observed under ultraviolet light irradiation conditions for the presence and intensity of fluorescence to investigate the enhanced expression of the GFP fluorescent protein gene. Through the detection, it can be known that the original variety Fuhua 54 There was no fluorescence in the root, stem, leaf and shell tissues of peanut. There was no fluorescence in the root, stem, leaf and shell of the Fuhua 54 (genetic transformation positive variety) peanut variety. It can be seen that the expression of the GFP fluorescent protein gene was not significantly enhanced in the remaining plant cells except seeds of the original Fuhua 54 peanut variety and the transgenic Fuhua 54 (genetic transformation positive variety) peanut variety in which the GFP fluorescent protein gene was inserted using the peanut seed-specific gene promoter 0B3TGP - GFP fluorescent protein gene - NOS terminator plasmid sequence.

[0060] Embodiment 3:

[0061] Peanut seed-specific gene promoter 0B3TGP for crop gene editing:

[0062] Salmonella typhi belongs to the genus Salmonella. It is Gram-negative, short and thick rod-shaped, covered with flagella all around the body, and active in motion. It grows better in a culture medium containing bile because the lipids and tryptophan in bile can serve as nutrients for Salmonella typhi. The bacterial (O) antigen, flagella (H) antigen, and surface (Vi) antigen of Salmonella typhi can cause the human body to produce corresponding antibodies. Since the antigenicity of O and H antigens is strong, they can be used in serum agglutination tests (Widal reaction) to determine the titer of O and H antibodies in serum to assist clinical diagnosis. Strong endotoxins can be released when the bacteria are lysed, which is the main factor causing the disease of Salmonella typhi. Using the invA gene and flagellin gene of Salmonella to amplify by PCR method for molecular hybridization, 3 to 300 live bacterial cells can be detected, achieving sensitive and specific effects.

[0063] When constructing a Salmonella typhi vaccine, the Salmonella typhi Ty21a antigen can be used as an antigenic substance to enter the body to induce an immune response, so that the animal body can quickly produce a targeted immune response when infected by Salmonella typhi to quickly eliminate the pathogen.

[0064] Select the method of plant genome integration, and use the peanut seed-specific gene promoter 0B3TGP to increase its expression and increase the consumption of transgenic food to overcome the problem of low expression:

[0065] 1. Using the pCAMBIA2300 plasmid sequence as a vector, a DNA double-strand of peanut seed-specific gene promoter 0B3TGP, Salmonella typhi Ty21a antigen gene, and NOS terminator was constructed through enzyme digestion and ligation reactions. The plant expression vector was used to transform the target plant to complete genetic transformation.

[0066] 2. Tissue culture and subsequent differentiation induction were performed on the callus of Luhua 11 peanut in MB medium to obtain the original variety of Luhua 11 peanut and the transgenic variety of Luhua 11 (genetic transformation positive variety) peanut with the peanut seed specific gene promoter 0B3TGP-Salmonella typhi Ty21a antigen gene-NOS terminator plasmid sequence inserted with the Salmonella typhi Ty21a antigen gene. Twenty complete plants of each variety were obtained after tissue culture. The plants were planted under normal greenhouse conditions for 120 days until the plants matured and bore fruit. The seeds of the two plants were collected and the seed parts were separated separately. Fifty experimental mice were fed with the two kinds of peanut seeds at a dosage of 15 g / mouse. The two kinds of peanut seeds were fed separately 4 times a week for 2 weeks, i.e. 8 times in total. Retroorbital venous blood and saliva were collected 3 days after the last immunization. The serum and mucosal (taking oral mucosa as an example) of the mice were tested for the presence of Salmonella typhi O 9 The antibody level was used as an indicator to investigate the enhanced expression of the typhoid Salmonella Ty21a antigen gene to produce antigen vaccine. The specific results are shown in the following table:

[0067]

[0068] As can be seen from the above table, the peanut seed-specific gene promoter 0B3TGP can enhance the expression of the Ty21a antigen gene of Salmonella typhi in peanut seed tissue cells to produce antigen vaccines.

[0069] In addition, in order to verify that the effect of the peanut seed-specific gene promoter 0B3TGP on the enhanced expression of the Ty21a antigen gene of Salmonella typhi when used for gene editing to produce antigen vaccines is only specific to peanut seed tissue cells, the following experimental tests were performed on the plants obtained in the above experiment:

[0070] Western blot was used to detect the expression of Ty21a in the remaining parts of the original peanut variety Luhua 11 obtained after the above planting and the transgenic variety Luhua 11 (genetic transformation positive variety) peanut variety with the typhoid Salmonella Ty21a antigen gene inserted into the peanut seed specific gene promoter 0B3TGP-typhoid Salmonella Ty21a antigen gene-NOS terminator plasmid sequence, i.e., the root, stem, leaf, and shell. It was found that no protein with the molecular weight consistent with the Ty21a subunit protein and antigenicity was detected in other tissues except the seed part. After comparison, it was found that there was no obvious difference in the promotion of the expression of the typhoid Salmonella Ty21a antigen gene in the two plants except the seeds.

[0071] That is, in the remaining plant cells except seeds of both the original variety Luhua 11 peanut and the transgenic variety Luhua 11 (genetic transformation positive variety) peanut in which the Typhoid Salmonella Ty21a antigen gene was inserted using the peanut seed-specific gene promoter 0B3TGP - Typhoid Salmonella Ty21a antigen gene - NOS terminator plasmid sequence, the expression of the Typhoid Salmonella Ty21a antigen gene was not significantly enhanced.

[0072] Based on the above experiments, it can be concluded that the content of Salmonella Typhi Ty21a antigen in 11 types of Luhua peanut seedlings inserted with the peanut seed-specific gene promoter 0B3TGP-Salmonella Typhi Ty21a antigen gene-NOS terminator plasmid sequence was significantly increased compared with the untreated peanut seed tissue cells of the same type under the same growth conditions, while no significant change was found in the content of Salmonella Typhi Ty21a antigen in the rest of the plant. Therefore, the peanut seed-specific gene promoter 0B3TGP has obvious tissue specificity and expression enhancement effects on the expression of Salmonella Typhi Ty21a antigen gene in seed tissue cells when used for gene editing.

[0073] The above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit the same. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that the technical solutions described in the aforementioned embodiments may still be modified, or some of the technical features may be replaced by equivalents. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A peanut seed-specific gene promoter 0B3TGP, characterized in that: The peanut seed-specific gene promoter 0B3TGP can drive the target gene to be specifically and highly expressed in the seed tissue cells in the peanut seed tissue cells, and the DNA nucleotide sequence of the specific gene promoter 0B3TGP is shown in SEQ ID NO.01: TTTTTATATATTTATGTCGGATTGTAGTATAATAGTGATTTGAGATATTTTAAGTGAGAGAGTGTTGTTGGCATATATAATAGTGAAAAATTCCGAGAGAGAGAGAGAGAGAGGAGAGATTGAGAGTAGCGAAG.

2. A peanut seed-specific gene promoter OB3TGP according to claim 1, characterized in that: The promoter 0B3TGP was obtained by PCR amplification technology.

3. A peanut seed-specific gene promoter OB3TGP according to claim 1, characterized in that: In the PCR amplification process, the following two primers are configured according to the DNA nucleotide sequence shown in SEQ ID NO.01 for amplification: (1) SEQ ID NO.03: GTAATCATCACACTACATTGTCTCA; (2) SEQ ID NO.04: CTTCGCAATTTGGCTAAGTAAACAT.

4. An application of the peanut seed-specific gene promoter OB3TGP as claimed in any one of claims 1 to 3, characterized in that: The specific gene promoter 0B3TGP is applied to peanut seed gene editing or transgenic operation to cultivate new varieties.

5. The use of a peanut seed-specific gene promoter OB3TGP according to claim 4, characterized in that: The application method is to use or operate the gene promoter 0B3TGP to drive the target gene to express in peanut seed tissue cells, thereby using the seed cells as reactors to synthesize related proteins at the molecular biology level.

6. The use of a peanut seed-specific gene promoter OB3TGP according to claim 5, characterized in that: The specific process of the application is to perform transgenic operation on peanut seeds, use the pCAMBIA2300 plasmid sequence as a vector, construct a DNA double chain of peanut seed specific gene promoter 0B3TGP-target gene-NOS terminator through enzyme cutting and ligation reaction, and use the plant expression vector to transform the target plant to complete genetic transformation.

Images