A broad bark molecular marker, primer set and identification method and application
By using PCR reactions with czg1, czg2, czg3 sequences and primer sets P780F5, P780F6, P780F7, the accuracy and cost issues of Guangchenpi identification were resolved, achieving efficient, low-cost, and whole-plant effective identification of Guangchenpi.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- SOUTH CHINA AGRICULTURAL UNIVERSITY
- Filing Date
- 2024-04-29
- Publication Date
- 2026-04-28
AI Technical Summary
Existing technologies are difficult to use efficiently, accurately, and at low cost to identify Guangchenpi, especially the non-peel material of its original plant. They are also easily affected by environmental factors and detection errors, and have a limited scope of application.
The czg1, czg2, and czg3 sequences were used as molecular markers for Guangchenpi (Citrus reticulata peel). Primer sets P780F5, P780F6, and P780F7 were designed and identified by PCR reaction system. Genomic information was used to achieve accurate identification of Guangchenpi.
It achieves efficient and accurate identification of Guangchenpi (dried tangerine peel), unaffected by external factors, and single-point identification is effective for the entire plant, significantly reducing the cost of testing samples, time, effort, and financial resources.
Smart Images

Figure CN118186142B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of medicinal material identification technology, and in particular to a technique for identifying dried tangerine peel. Background Technology
[0002] Chenpi (Pericarpium Citri Reticulatae) is a traditional Chinese medicine, also known as Chenjupi or Jupi. It is the dried peel of the fruit of Citrus reticulata Blanco and its cultivated varieties, belonging to the Rutaceae family. The medicinal properties of Chenpi were first recorded in the Eastern Han Dynasty pharmacopoeia, *Shennong Bencao Jing*. It is bitter and pungent in nature, and enters the lung and spleen meridians. It has the effects of regulating qi and strengthening the spleen, drying dampness and resolving phlegm, and can treat abdominal distension, poor appetite, vomiting and diarrhea, and cough with excessive phlegm. According to the Yuan Dynasty medical book *Riyong Bencao*, "It harmonizes the spleen and stomach, and its drying properties can eliminate phlegm and regulate qi stagnation. Its bitter and pungent taste disperses adverse qi flow, and its warm nature can expel cold stagnation from the diaphragm." The Ming Dynasty classic *Bencao Gangmu* states, "Jupi is bitter and can purge and dry, pungent and can disperse, warm and can harmonize. Its treatment of various diseases always relies on its qi-regulating and dampness-drying effects."
[0003] The Pharmacopoeia of the People's Republic of China (2020 edition) stipulates that dried tangerine peel can be divided into "Chenpi" and "Guangdong Chenpi". "Chenpi" includes: Jianju peel (original plant: Fuju, Citrus reticulata 'Tangerina') produced in Fujian Province, Chuanchenpi (original plant: Dahongpao, Citrus reticulata 'Dahongpao') produced in Sichuan Province, and Zheju peel (original plant: Wenzhou mandarin orange, Citrus reticulata 'Unshiu') produced in Zhejiang Province. "Guangdong Chenpi" specifically refers to the dried peel of Chachiensis (Citrus reticulata 'Chachiensis').
[0004] "Guangdong Chenpi" has been considered a superior grade of tangerine peel for medicinal purposes since ancient times. The late Qing Dynasty medical book *Ben Cao Hai Li* records that "Guangdong Xinhui tangerine peel is the best." The bioactive components of "Guangdong Chenpi" mainly include volatile substances, flavonoids, alkaloids, and polysaccharides, possessing effects such as lowering blood lipids, antidepressant, and analgesic properties. In recent years, besides being used as a medicinal material, "Guangdong Chenpi" has also gained popularity and recognition in spices, teas, and health foods. However, with the rapid development of the industry, the phenomenon of passing off "Chenpi" as "Guangdong Chenpi" has become increasingly common, affecting the quality of "Guangdong Chenpi" and the development of the industry.
[0005] "Guang Chenpi" has chemical components that distinguish it from other Chenpi, such as lower content of D-limonene, higher content of γ-terpinene and neohesperidin, etc. In addition, methyl N-methylanthranilate is considered to be a specific component of "Guang Chenpi". The Pharmacopoeia of the People's Republic of China (2020 Edition) stipulates the identification method of "Guang Chenpi". A sample detected with methyl N-methylanthranilate by thin-layer chromatography is "Guang Chenpi". However, this method mainly targets medicinal materials and does not include the identification of the original plants of "Guang Chenpi", especially the non-fruit peel materials of its original plants, and the applicable sample range is small. In addition, the detection of component-related results is easily affected by environmental factors such as weather conditions and water and fertilizer management during the planting process of medicinal material raw materials, as well as force majeure factors such as instrument errors and personnel operations during detection. Therefore, based on the component-based identification method, the identification results generally need to be repeated and are only valid for single-batch samples, and multiple and repeated detections need to be carried out on multiple batches of samples from the same source.
[0006] Molecular markers are different from other genetic markers such as morphology, biochemistry, and cytology. They directly reflect the specific DNA fragments existing in the genome among crop individuals or populations, and have advantages such as a large quantity and wide distribution. They are widely used in the species identification of medicinal materials and their original plants. The development of molecular markers has gone through three stages. The core technology in the first stage is mainly Southern hybridization, and the representative type is restriction fragment length polymorphism (RFLP). Later, with the development of PCR technology, molecular markers in the second stage that can be typed by PCR technology alone gradually emerged, such as simple sequence repeat (SSR), etc. The molecular markers in the third stage are molecular marker technologies based on high-throughput sequencing, which have advantages such as a large quantity and wide distribution.
[0007] Molecular markers are applicable not only to the identification of "Guang Chenpi" medicinal materials, but also to the effective identification of all samples from the original plant where genomic information can be successfully obtained, including seedlings, fruit trees, fresh peels, and leaves, significantly expanding the applicability of the technology. Early identification of seedlings allows for the early detection and elimination of confused seedlings, reducing waste and losses in planting costs. Furthermore, unlike component-based identification methods, molecular markers, derived from genomic information, possess excellent "spatiotemporal stability." On the one hand, they are unaffected by environmental factors causing fluctuations in identification results; on the other hand, they are not limited by the growth stage, physiological state, or sampling site of the material. This means that a single-point result is effective for the entire plant and is permanently valid. By performing molecular marker identification on any part of the planted fruit tree at any growth stage, the authenticity of the "Guang Chenpi" produced from that tree can be determined. In addition, the original plant of "Guang Chenpi" is mostly propagated through asexual reproduction techniques such as grafting or layering (high-position cuttings) for seedling production and planting. Therefore, for grafted seedlings or high-position cuttings with scions from the same source, only the leaves of the mother plant need to be identified. There is no need to repeat the identification of the fruit trees propagated from the mother plant and the "Guang Chenpi" produced thereafter, which can greatly reduce the sample, time, effort and financial costs required for testing. Summary of the Invention
[0008] The purpose of this invention is to provide a molecular marker, primer set, identification method and application for Guangchenpi (Citrus reticulata peel), in order to solve the problem of how to identify Guangchenpi efficiently, accurately and at low cost.
[0009] To achieve the above objectives, the present invention adopts the following technical solution:
[0010] A molecular marker for dried tangerine peel, comprising one or more of the following sequences: czg1, czg2, and czg3, wherein the czg1 sequence is shown in SEQ ID NO.1, the czg2 sequence is shown in SEQ ID NO.2, and the czg3 sequence is shown in SEQ ID NO.3.
[0011] The present invention also provides an application of the aforementioned molecular marker for Guangchenpi in the identification method of Guangchenpi.
[0012] The present invention also provides the application of the aforementioned Guangchenpi molecular marker in the preparation of Guangchenpi identification reagents or kits.
[0013] The present invention also provides a primer set for identifying the molecular marker of the Guangchenpi, including one or more of the P780F5 primer set for identifying the czg1 sequence, the P780F6 primer set for identifying the czg2 sequence, and the P780F7 primer set for identifying the czg3 sequence.
[0014] The nucleotide sequences of the P780F5 primer set are shown in SEQ ID NO.4 and SEQ ID NO.5;
[0015] The nucleotide sequences of the P780F6 primer set are shown in SEQ ID NO.6 and SEQ ID NO.7;
[0016] The nucleotide sequences of the P780F7 primer set are shown in SEQ ID NO.8 and SEQ ID NO.9.
[0017] The present invention also provides the application of the primer set described above for identifying the molecular marker of Guangchenpi in the preparation of Guangchenpi identification reagents or kits.
[0018] The present invention also provides a PCR reaction system using the primer set described above for identifying molecular markers of dried tangerine peel, the components of which include Taq DNA polymerase, dNTPs, buffer, primer set, double-distilled water, and sample genomic DNA.
[0019] This invention also provides a method for identifying Guangchenpi (dried tangerine peel) using the primer set described above. The process includes: extracting genomic DNA from the sample and performing PCR amplification according to the following procedure: pre-denaturation at 94℃ for 3 min; denaturation at 94℃ for 30 s, annealing at 58℃ for 30 s, extension at 72℃ for 1 min, 35 cycles; final extension at 72℃ for 5 min. After obtaining the PCR product, an agar gel electrophoresis test is performed to observe whether a target band of the correct size appears. If it does, it is Guangchenpi; if not, it is not Guangchenpi.
[0020] Compared with the prior art, the present invention has the following advantages:
[0021] The identification of Guangchenpi is not affected by external factors, nor by the growth stage, physiological state, or sampling location of the material. The single-point result is permanently valid for the whole plant, greatly reducing the sample, time, effort, and financial costs required for testing. Attached Figure Description
[0022] The accompanying drawings, which are included to provide a further understanding of the invention and form part of this application, do not constitute an undue limitation of the invention. In the drawings:
[0023] Figure 1 The image shows the agar gel results of PCR reaction products from leaf samples of *Citrus tangerine* (the original plant of *Citrus tangerine*) and non-*Citrus tangerine* leaf samples using primer sets P780F5 and P780F6.
[0024] Figure 2 The image shows the agar gel results of PCR reaction products from leaf samples of *Citrus tangerine* (the original plant of Guangchenpi) and non-*Citrus tangerine* leaf samples using the P780F7 primer set.
[0025] Figure 3 The image shows the agar gel results of PCR reaction products from leaf samples of *Citrus aurantium* (the original plant of *Citrus aurantium*) and non-*Citrus aurantium* leaf samples using the P780F8 primer set. Detailed Implementation
[0026] The present invention will now be described in detail with reference to the accompanying drawings and specific embodiments. The illustrative embodiments and descriptions of the present invention are used to explain the present invention, but are not intended to limit the present invention.
[0027] Example 1
[0028] 1. Specific sequence screening
[0029] The genome of the Dadong 5 strain of Chazhigan (the original plant of Guangchenpi) was assembled by second-generation sequencing and compared with the genomes of common citrus (https: / / www.ncbi.nlm.nih.gov / datasets / genome / GCA_003258625.1 / ) and Wenzhou mandarin orange (https: / / www.ncbi.nlm.nih.gov / datasets / genome / GCA_002897195.1 / ). The comparison method was as follows: the genome sequence of the Dadong 5 strain of Chazhigan was broken into 1000bp segments with a 500bp step size. The Basic Local Alignment Search Tool (blastn) was used to compare the genomes of common citrus and Wenzhou mandarin orange, respectively, to screen for sequences that were present in the Chazhigan genome but not in the genomes of common citrus and Wenzhou mandarin orange. The selected sequences were then compared with publicly available Citrus genomes in the NCBI database (Whole-genome shotgun contigs (wgs)) using BLASTN. Sequences that could not be completely matched with any sequence in the database were identified as specific sequences of the Chazhi mandarin orange. The specific sequences of Chazhi mandarin orange include: czg1, czg2, and czg3. The sequence of czg1 is shown in SEQ ID NO.1, the sequence of czg2 is shown in SEQ ID NO.2, and the sequence of czg3 is shown in SEQ ID NO.3.
[0030] SEQ ID NO.1:
[0031] TTTTAAAGCCAAAGGGGGATCAAGGGATCAAATTACTATTTTACTCCTAGGGAATTAGCAGCAAGTCCTTCAGATCTCTCTATCCATATTTGTAATTTAACTTTTTTTTGGGAAAAGGAATTAGCACTGGAATTTTATCAGTAATTCATTCAATAGATAGTATTACGAGAAATTCTAAAATACTTAAAATATATTACAACCTAGCATTAATTACAGAGAAAACTCAATAACTGATTGCTCTCTTATCACTCACAATTGCTTTGCTCCCTTCAATAAGCCTAGAAAAAAAGTATCTATTAAGCAGTTAGCCTCCTTTAGATTAGAAATTTACAATAAACTGAATACCAATAAAACTAATAGAAATATAATAAAACAATTATCAGAAACCAACAATTGGAAGCCA
[0032] SEQ ID NO.2:
[0033] TACGCCAAAATTAACCCTCGTTACTCATTATTCTTTTTTATTTTACTCTTGAAACCTGCCAATCCCCTCAATTTCTTTGTTTTCATGTTGCATATATCTAGTATATTGACTTGATTGAGAAAGCCGTTTCTTTATTTTGGGAAATTTGTTTTATTTCATGACTCAAATAGCAATTCATTAATTTCATCTAAAGTCTCCATTTGAATGTTATGGCATTAGCTGTGTCAGCTGAATTTACTCTTGGAAAATATTGTTTCAATGTTTCTGCATCTAAAGCCATGTATGTATTATACAGTGAAACAAATAATTATAAAAAGAAAACGAGTTCAATTTAATGCTGAGAAGAGGGCTAGTGTTTATGGGGGT
[0034] SEQ ID NO.3:
[0035] ACTCCACGTGCAAGCTTTTTCTTTTTTTTGGGTTGGGGGGGGGGTGCTTTCACTCATCACTAATTCTTTCATCTTTATACTTTGTAGGCTTAATGGATAATTTTGATTCGAGGTCTGAAGTCATGGTACTGTGTATGGTCAAGACCAACCTGGATGAAGCCAGGCCTTCCATTGCAATTTCAGTGCACTCGGACTCAAAGAATCACTCGGTATGGGTAC AGAACAAACCTGATCAATGTGGCAAATCCAAACCATCTGTTGTCCATATCAAGAATCCAATTGCCGGAACTACTTTCCACTTTGACCTGAACGAGTTTTTGTCATTTATTGATAATCAATCAACTCTTTCTCATTGTGTTTCAAGAGTTATCTCGGAGGTACCAGCTGTTATTGACCATGCTCAGTTGGCGGATGATATTGTTCGAAAGCTCCGAAGT
[0036] We prepared 24 second-generation sequencing data of different varieties of Chazhigan (a type of citrus fruit): 8 leaf samples from the Dadong 5 variety, 8 leaf samples from the Xizhong Youshen variety, and 8 leaf samples from the Dazhong Youshen variety. Using the genome assembled from the second-generation sequencing of the Dadong 5 variety as a reference sequence, we aligned the 24 Chazhigan second-generation sequencing data with the reference sequence using the BWA (version 0.7.17-r1188) MEM alignment strategy. This confirmed that all 24 Chazhigan samples from different varieties had reads covering the specific sequence regions of czg1, czg2, and czg3 of the aforementioned Chazhigan variety. This demonstrates that all 24 Chazhigan samples contain the specific sequences of the aforementioned Chazhigan variety.
[0037] 2. PCR verification
[0038] Based on the specific sequence of the above-mentioned Chazhigan (the original plant of Guangchenpi), PCR was used to verify whether this specific sequence could be amplified into the correct band in Chazhigan samples from different varieties, while other cultivated citrus varieties did not have this band.
[0039] (1) Primer design
[0040] PCR amplification primers were designed using Primer3 version 4.1.0 software (web link: https: / / bioinfo.ut.ee / primer3-0.4.0 / ), as shown in Table 1. This was used to verify whether the correct band of the specific sequence of the tea-branch mandarin orange could be amplified in samples from different varieties, while other cultivated citrus varieties did not show this band.
[0041] Table 1 Primer Information
[0042]
[0043] (2) PCR amplification reagents, consumables and samples
[0044] Reagents: PCR Mix (purchased from Guangzhou Dongsheng Biotechnology Co., Ltd., catalog number: P2015), double-distilled water, primers (as shown in Table 1);
[0045] Sample: The tea branch mandarin orange strain and non-tea branch mandarin orange varieties were selected, as shown in Table 2.
[0046] Table 2 Leaf Sample Information
[0047]
[0048] (3) PCR reaction system and conditions
[0049] The PCR reaction system is shown in Table 3:
[0050] Table 3 PCR reaction system
[0051] reagents Dosage (μl) PCRMix 10 Primer F (10 μM) 0.8 Primer R (10 μM) 0.8 Double distilled water 7.4 Sample genomic DNA 1 Total 20
[0052] The PCR reaction conditions are shown in Table 4:
[0053] Table 4 PCR reaction conditions
[0054]
[0055] Each sample in Table 2 was subjected to the following PCR validation:
[0056] Referring to Table 3, three PCR reaction systems were prepared using the three primer pairs listed in Table 1. Each PCR reaction system was amplified according to the conditions in Table 4. The PCR products were then validated using agarose gel electrophoresis. The electrophoresis conditions were as follows:
[0057] Glue concentration 1%, voltage 180V, time 30min.
[0058] Marker: M stands for DM2000, purchased from Jiangsu Kangwei Century Biotechnology Co., Ltd., item number CW0632M.
[0059] The DM2000 DNA Marker consists of six DNA fragments: 2,000 bp, 1,000 bp, 750 bp, 500 bp, 250 bp, and 100 bp. A 3 μl sample is taken for direct electrophoresis. During electrophoresis, the 750 bp DNA fragment contains approximately 90 ng of DNA, appearing as a bright band, while the other bands contain approximately 30 ng of DNA.
[0060] The results are as follows Figure 1-2 As shown, leaf samples from three different strains of *Citrus aurantium* (the original plant of *Citrus reticulata* var. *citrus*) all amplified clear and bright target bands of consistent size, while the other four leaf samples from non-*Citrus aurantium* var. *citrus ...
[0061] Example 2
[0062] A sequence czg4 was randomly selected from the region outside the specific sequences czg1, czg2, and czg3 of the genome assembled by second-generation sequencing of the Dadong No. 5 strain of Chazhigan (the original plant of Guangchenpi). A pair of primers was designed for this purpose. The primer details are shown in Table 5.
[0063] The czg4 sequence is as follows:
[0064] gaaagctttgtcttacggcgagcgaagcgtcaagcgtttgacgagaattaattcgcgtcgaccgagatagtaat
[0065] cactgacattttattgattgcgctagaggataaatttatcgcgttgttcattctgatacgaagaaatatataaaagatgatgg
[0066] atcggtggtaaagcgtcggttggtggacctcaccgggtgcgaggattatcaccggttgcgtcagaagtgctacgcctc
[0067] gccaatcggcgaggaatttgccaggagagaattaccctcgccgatcacgatcgctctaacccgacatcttcggccagc
[0068] gcctcaccgtcagtatctttgagcaacagcagtttcttggtcatccgtcttggatcgagtgtaaaccgacagggcgacca
[0069] tgatgcagatgaatctgaagtccgcagtcgtcttggttgtcgacttccatctcgagttcgacgactgggctcggtggggt
[0070] cgcggaggtcggtgggcgcgtacatagccatctgcgcactgcggatctcgccagaccagtagctcgctcgccgagg
[0071] gtaatggctttgcttgagcaagt
[0072] Table 5. Primer information for the czg4 sequence.
[0073]
[0074] Each sample in Table 2 was subjected to the following PCR validation:
[0075] Referring to Table 3, the PCR reaction system was prepared using the primer pairs in Table 5, and PCR amplification was performed according to the conditions in Table 4. Each PCR product was verified by agarose gel electrophoresis, and the results are as follows: Figure 3 As shown, each sample amplified a band. This indicates that the czg4 sequence is not specific to the tea-branch mandarin orange.
[0076] The technical solutions provided by the embodiments of the present invention have been described in detail above. Specific examples have been used to illustrate the principles and implementation methods of the embodiments of the present invention. The descriptions of the embodiments above are only for helping to understand the principles of the embodiments of the present invention. At the same time, for those skilled in the art, there will be changes in the specific implementation methods and application scope based on the embodiments of the present invention. Therefore, the content of this specification should not be construed as a limitation of the present invention.
Claims
1. A molecular marker for dried tangerine peel, characterized in that: It is one or more of the czg1 sequence, czg2 sequence, and czg3 sequence, where the czg1 sequence is shown in SEQ ID NO.1, the czg2 sequence is shown in SEQ ID NO.2, and the czg3 sequence is shown in SEQ ID NO.
3.
2. The application of the molecular marker of Guangchenpi as described in claim 1 in the identification method of Guangchenpi.
3. The application of the molecular marker of Guangchenpi as described in claim 1 in the preparation of Guangchenpi identification reagents or kits.
4. A primer set for identifying the molecular marker of dried tangerine peel as described in claim 1, characterized in that: This includes one or more of the following primer sets: P780F5 for identifying the czg1 sequence, P780F6 for identifying the czg2 sequence, and P780F7 for identifying the czg3 sequence. The nucleotide sequences of the P780F5 primer set are shown in SEQ ID NO.4 and SEQ ID NO.5; The nucleotide sequences of the P780F6 primer set are shown in SEQ ID NO.6 and SEQ ID NO.7; The nucleotide sequences of the P780F7 primer set are shown in SEQ ID NO.8 and SEQ ID NO.
9.
5. The application of the primer set for identifying molecular markers of Guangchenpi as described in claim 4 in the preparation of Guangchenpi identification reagents or kits.
6. A PCR reaction system for identifying molecular markers in dried tangerine peel, characterized in that: The components include the primer set as described in claim 4, Taq DNA polymerase, dNTPs, buffer, primer set, double-distilled water, and sample genomic DNA.
7. A method for identifying dried tangerine peel using the primer set as described in claim 4, characterized in that: The process includes: extracting genomic DNA from the sample and performing PCR amplification according to the following procedure: 94℃ pre-denaturation for 3 min; 94℃ denaturation for 30 s, 58℃ annealing for 30 s, 72℃ extension for 1 min, 35 cycles; 72℃ final extension for 5 min. After obtaining the PCR product, an agar gel electrophoresis test is performed to observe whether the target band of the correct size appears. If it appears, it is Guangchenpi (Guangzhou tangerine peel); if not, it is non-Guangchenpi.
Citation Information
Patent Citations
InDel molecular marker for identifying citrus chachiensis and application of InDel molecular marker
CN113355448A
Molecular marker for itrus reticulata cv. chachiensis strain identification and application thereof
CN114058728A