A method for engineering Yarrowia lipolytica to produce astaxanthin

Abstract

This invention belongs to the field of bioengineering technology, specifically relating to a method for engineering *Yarrowia lipolytica* to produce astaxanthin. This invention utilizes CRISPR / Cas9 technology to engineer *Anabaena pseudocaryophylla* (… Pseudanabaena sp.) and Scenedesmus (sp.) Scenedesmus Different combinations of β-carotene ketolase CrtW and β-carotene hydroxylase CrtZ from *Sp. NREL 46B-D3* were integrated into the XPR2 and A08 sites of the *Yarrowia lipolytica* genome for expression. Astaxanthin synthesis was detected by shake-flask fermentation. Then, increasing the copy number of *CrtW* from *Scenedesmus* further promoted astaxanthin synthesis.

Description

Technical Field

[0001] The invention belongs to the technical field of bioengineering, and in particular relates to a method for engineering Yarrowia lipolytica to produce astaxanthin. Background Art

[0002] Astaxanthin is the only non-provitamin A carotenoid that can cross the blood-brain barrier of humans and animals and is essential for their life activities, but cannot be synthesized in the body. The structure of astaxanthin contains two β-ionone rings and 11 conjugated double bonds, which gives it a strong antioxidant capacity. Astaxanthin exists in three configurational isomers: left-handed (3S, 3'S), right-handed (3R, 3'R) and meso (3S, 3'R), among which the left-handed (3S, 3'S) isomer has the highest antioxidant activity. Therefore, astaxanthin can be used as an antioxidant and is widely used in the fields of medicine, anti-aging products, cosmetics and advanced health foods. In addition, because astaxanthin is red, it can also be used as a colorant or food additive to give foods such as fish, eggs and certain aquatic products a bright red appearance.

[0003] At present, the production methods of astaxanthin mainly include chemical synthesis, biological extraction and microbial fermentation. The chemical synthesis process is complex, the production cycle is long, there are many by-products, and it contains multiple isomers. The biological extraction method has a low yield, high cost, and is easily polluted. Astaxanthin produced by microorganisms has the advantages of clear configuration, environmental friendliness, and few by-products. Therefore, the use of synthetic biology to develop microbial cell factories that efficiently synthesize astaxanthin has more development prospects. Common chassis for the production of astaxanthin include Haematococcus pluvialis ( Haematococcus pluvialis , now known as Haematococcus pluvialis ( Haematococcus lacustris ))、Phaffia rhodozyma( Xanthophyllomyces dendrorhous )、Saccharomyces cerevisiae( Saccharomyces cerevisiae ), Yarrowia lipolytica ( Yarrowia lipolytica ) and Escherichia coli ( Escherichia coli ), among which, Haematococcus pluvialis and Phaffia rhodozyma have complete astaxanthin biosynthesis pathway, while the latter three chassis themselves do not have the ability to synthesize astaxanthin and need to introduce the synthesis pathway of β-carotene and its synthesis pathway to astaxanthin.

[0004] Since Yarrowia lipolytica has simple growth conditions, can use a variety of carbon sources to grow, has strong environmental adaptability, can tolerate extreme environments such as low temperature, high salt, high acidity and alkalinity, and is considered a biosafe microorganism (GRAS) by the US Food and Drug Administration, Yarrowia lipolytica is currently one of the most studied and widely used unconventional yeasts, and the astaxanthin produced by Yarrowia lipolytica is mostly left-handed (3S, 3'S) configuration. Kildegaard et al. introduced the bifunctional phytoene synthase / lycopene cyclase of Phaffia rhodozyma into Yarrowia lipolytica GB20 ( crtYB ) and phytoene dehydrogenase ( crtI ), optimize endogenous 3-hydroxy-3-methylglutaryl-CoA reductase ( HMG1 ) and geranylgeranyl diphosphate synthase ( GGS1 / crtE ) activity, downregulating squalene synthase ( SQS1 ) and finally introduced into the marine bacterium Paracoccus N81106 ( Paracoccus sp. N81106) β-carotene ketolase ( crtW ) and P. ananas Pantoea ananatis β-carotene hydroxylase ( crtZ ), and optimize crtW and crtZ Zhu et al. expressed two algae-derived and one plant-derived CrtW and CrtZ in the β-carotene-producing yeast Yarrowia lipolytica. The results showed that the CrtW and CrtZ from Haematococcus pluvialis had the highest activity in catalyzing the production of astaxanthin from β-carotene. crtW and crtZ The copy number of the strain was increased and modularly assembled. The biomass of the strain was increased by optimizing the synthesis of leucine, and astaxanthin was fermented in batches. Hua Qiang et al. combined CrtW and CrtZ from different sources: CrtW from Paracoccus N81106 and CrtZ from Haematococcus pluvialis, Chlamydomonas reinhardtii ( Chlamydomonas reinhardtii ) of CrtW and Pantoea agglomerans ( Pantoea agglomerans ) CrtZ, truncated CrtW of Chlamydomonas reinhardtii and CrtZ of Haematococcus pluvialis were transferred into β-carotene-producing Yarrowia lipolytica XK17. The results showed that the first combination was more conducive to the synthesis of astaxanthin. crtZ The copy number of the gene was increased, and the precursor pathway flux and cofactor content were adjusted for shake flask fermentation of astaxanthin.

[0005] The engineered bacteria constructed in the above studies still have the problem of low astaxanthin production, so it is necessary to explore the combination of CrtW and CrtZ with higher enzyme activity to promote the synthesis of astaxanthin in Yarrowia lipolytica. Summary of the invention

[0006] In order to solve the above technical problems, the present invention uses Yarrowia lipolytica IF015 as the starting bacteria, and IF015 is based on the ob-CHC TEF C TEF The present invention uses CRISPR / Cas9 technology to generate an engineered strain of Yarrowia lipolytica with uracil and leucine auxotrophy. Pseudanabaena sp.) and Scenedesmus ( Scenedesmus sp. NREL 46B-D3) were integrated into the XPR2 and A08 sites of the Yarrowia lipolytica genome for expression, and the synthesis of astaxanthin was detected by shake flask fermentation. Then, the copy number of CrtW from Scenedesmus on the genome was increased to further promote the synthesis of astaxanthin.

[0007] The technical scheme adopted by the present invention is: a method for engineering Yarrowia lipolytica to produce astaxanthin, comprising taking Yarrowia lipolytica producing β-carotene as a chassis, co-expressing codon-optimized β-carotene ketolase genes and β-carotene hydroxylase genes derived from Pseudo-Anabaena and Scenedesmus on its genome, and fermenting to determine the optimal combination capable of synthesizing astaxanthin, wherein the nucleotide sequence of the codon-optimized β-carotene ketolase gene derived from Pseudo-Anabaena is shown as SEQ ID NO.1, the nucleotide sequence of the codon-optimized β-carotene hydroxylase gene derived from Pseudo-Anabaena is shown as SEQ ID NO.2, the nucleotide sequence of the codon-optimized β-carotene ketolase gene derived from Scenedesmus is shown as SEQ ID NO.3, and the nucleotide sequence of the codon-optimized β-carotene hydroxylase gene derived from Scenedesmus is shown as SEQ ID NO.4.

[0008] Furthermore, the optimal combination is the co-expressed gene as shown in SEQ ID No.3 and the gene as shown in SEQ ID No.2.

[0009] Furthermore, it also includes increasing the copy number of the gene as shown in SEQ ID NO.3 on the genome to further promote the synthesis of astaxanthin.

[0010] Another aspect of the present invention provides a method for engineering Yarrowia lipolytica to produce astaxanthin, comprising the following steps:

[0011] (1) Construction of CrtW expression plasmid and CrtZ expression plasmid: The codons of CrtW from two different sources, Anabaena and Scenedesmus, were optimized, and the PCrtW nucleotide sequence was shown in SEQ ID No.1 and SCrtW nucleotide sequence was shown in SEQ ID No.3, respectively, and they were synthesized between the restriction sites NheI and BssHII of the plasmid pHR_XPR2_hrGFP, respectively, to obtain plasmids pHR_XPR2_PCrtW and pHR_XPR2_SCrtW; the codons of CrtZ from two different sources, Anabaena and Scenedesmus, were optimized, and the PCrtZ nucleotide sequence was shown in SEQ ID No.2 and SCrtZ nucleotide sequence was shown in SEQ ID No.4, respectively, and they were synthesized between the restriction sites NheI and BssHII of the plasmid pHR_A08_hrGFP, respectively, to obtain plasmids pHR_A08_PCrtZ and pHR_A08_SCrtZ;

[0012] (2) Construction of CrtW and CrtZ co-expression strains: The four plasmids in (1) and their corresponding pCRISPRyl were simultaneously transformed into Yarrowia lipolytica IF015 to obtain PCrtW and PCrtZ co-expression strain YL1, PCrtW and SCrtZ co-expression strain YL2, SCrtW and PCrtZ co-expression strain YL3, and SCrtW and SCrtZ co-expression strain YL4;

[0013] (3) using the strains obtained in (2) to perform fermentation culture to produce astaxanthin and screen the optimal combination YL3;

[0014] (4) Plasmid pHR_AXP_SCrtW was constructed and transformed with pCRISPRyl_AXP into the recombinant Yarrowia lipolytica strain YL3 to obtain the recombinant strain YL5 with increased SCrtW copy number, which was then fermented and cultured to produce astaxanthin.

[0015] The nucleotide sequence PCrtW is shown in SEQ ID No. 1, 762 bp;

[0016] The nucleotide sequence PCrtZ is shown in SEQ ID No. 2, 885 bp;

[0017] The nucleotide sequence SCrtW is shown in SEQ ID No. 3, 1110 bp;

[0018] The nucleotide sequence of SCrtZ is shown in SEQ ID No. 4, 903 bp.

[0019] Furthermore, in step (2), pHR_XPR2_PCrtW and pCRISPRyl_XPR2 were first transformed into Yarrowia lipolytica IF015 at the same time to obtain recombinant strain W1; pHR_XPR2_SCrtW and pCRISPRyl_XPR2 were transformed into Yarrowia lipolytica IF015 at the same time to obtain recombinant strain W2; pHR_A08_PCrtZ and pCRISPRyl_A08 were transformed into W1 at the same time to obtain a PCrtW and PCrtZ co-expressing strain. YL1; pHR_A08_SCrtZ and pCRISPRyl_A08 were simultaneously transformed into W1 to obtain the PCrtW and SCrtZ co-expression strain YL2; pHR_A08_PCrtZ and pCRISPRyl_A08 were simultaneously transformed into W2 to obtain the SCrtW and PCrtZ co-expression strain YL3; pHR_A08_SCrtZ and pCRISPRyl_A08 were simultaneously transformed into W2 to obtain the SCrtW and SCrtZ co-expression strain YL4.

[0020] Furthermore, in step (3), the recombinant bacteria YL1, YL2, YL3, and YL4 were subjected to shake flask fermentation. The specific operation was as follows: a newly activated single colony was picked from the plate and inoculated into a test tube containing YPD liquid culture medium, and cultured with shaking. The colony was transferred to a conical flask containing fermentation medium at a 5% inoculation rate, and cultured with shaking for 96 h. The fermentation liquid after 96 h was taken for treatment, and the astaxanthin production was determined by HPLC. Co-expression of SCrtW and PCrtZ can further promote the synthesis of astaxanthin.

[0021] Furthermore, in step (4), plasmid pHR_AXP_SCrtW was constructed by enzyme ligation, and it was transformed into YL3 together with pCRISPRyl_AXP to obtain recombinant bacteria YL5 with one increased copy number of SCrtW, and then shake flask fermentation was performed.

[0022] Furthermore, the fermentation medium includes 60-100 g / L glucose, 10-30 g / L soy peptone, 5-15 g / L beef extract, (NH 4 ) 2 SO 4 10~20 g / L, MgSO 4 •7H 2 O 10~15 g / L; fermentation conditions: pH 5.5~7.5, fermentation temperature 25~35℃, rotation speed 150~250 r / min, fermentation time 96~120 h.

[0023] The preferred fermentation conditions are: pH 5.5-7.5, fermentation temperature 25-35°C, rotation speed 150-250 r / min, and fermentation time 96-120 h.

[0024] The present invention also provides application of the above-mentioned method for producing astaxanthin by engineering Yarrowia lipolytica in producing astaxanthin.

[0025] The beneficial effects of the present invention are as follows: (1) The present invention provides a method for engineering Yarrowia lipolytica to produce astaxanthin. The engineered Yarrowia lipolytica can synthesize astaxanthin and has the advantages of precise modification of target genes, low probability of secondary mutations, and short genetic breeding cycle; (2) The present invention uses Yarrowia lipolytica IF015, which produces β-carotene, as the starting bacteria, and integrates and co-expresses two algae-derived CrtW and CrtZ The gene opened up the synthesis pathway from β-carotene to astaxanthin, and at the same time showed that the combination of CrtW from Scenedesmus and CrtZ from Pseudo-Anabaena could further promote the synthesis of astaxanthin. In addition, further increasing the copy number of CrtW from Scenedesmus in the Yarrowia lipolytica genome could significantly promote the synthesis of astaxanthin, providing basic research and theoretical basis for the construction of Yarrowia lipolytica cell factories for efficient synthesis of astaxanthin through synthetic biology in industry. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 Schematic diagram of the biosynthetic pathway and engineering strategy of astaxanthin in Yarrowia lipolytica of the present invention,

[0027] Among them, Glucose: glucose, Pyruvate: pyruvate, Acetyl-CoA: acetyl-CoA, Citrate: citric acid, IPP: isopentenyl pyrophosphate, DMAPP: dimethylallyl pyrophosphate, FPP: farnesyl pyrophosphate, β-Carotene: β-carotene, Echinenone: echinone, Carthaxanthin: carthaxanthin, Adonimbuin: 4-diketo-3-hydroxy-β-carotene, β-Cryptoxanthin: β-cryptoxanthin, Zeaxanthin: zeaxanthin, Adonixanthin: 3-dihydroxy-2-keto-β-carotene, Astaxanthin: astaxanthin, Mitochondria: mitochondria, Endoplasmic reticulum orliposomes: endoplasmic reticulum or liposomes, CrtW: β-carotene ketolase, CrtZ: β-carotene hydroxylase;

[0028] Figure 2 The astaxanthin content of the starting strain Yarrowia lipolytica IF015 and the four recombinant strains after 96 h of shake flask fermentation;

[0029] Figure 3 The astaxanthin content of recombinant bacteria YL3 and YL5 after 96 h of shake flask fermentation. DETAILED DESCRIPTION

[0030] In order to enable those skilled in the art to better understand the present invention, the present invention is further described in conjunction with specific implementation methods.

[0031] 1. Preparation and sources of strains, plasmids and culture media.

[0032] The Yarrowia lipolytica IF015 of the present invention is based on the ob-CHC in the paper published by (Larroude, Celinska et al. 2018) TEF C TEF The uracil and leucine auxotrophic Yarrowia lipolytica engineered bacteria were obtained by the strain construction method. Other strains and plasmid information are shown in Table 1. The primers were synthesized by GenScript.

[0033] LB medium: 10 g / L tryptone, 5 g / L yeast extract, 10 g / L NaCl, for screening of E. coli transformants, 15 g / L agar powder added to solid medium. Add 100 μg / mL ampicillin antibiotics as required.

[0034] YPD medium: 20 g / L tryptone, 10 g / L yeast extract, 20 g / L glucose, used for the culture of Yarrowia lipolytica, solid culture medium supplemented with 15 g / L agar powder.

[0035] YNB solid medium: 6.7 g / L amino acid-free yeast nitrogen source, 10 g / L glucose, 15 g / L agar powder. Add leucine (final concentration 0.1 g / L) or uracil (final concentration 0.1 g / L) to the YNB medium as needed to prepare YNB+leucine or YNB+uracil medium. Used for screening of Yarrowia lipolytica transformants.

[0036] Fermentation medium: glucose 80 g / L, soy peptone 20 g / L, beef extract 10 g / L, (NH 4 ) 2 SO 4 15 g / L, MgSO 4 •7H 2 O 12 g / L, pH 6.8.

[0037] Table 1 Strains and plasmids involved in the experiment

[0038]

[0039] 2. Reagents and instruments

[0040] 2×Phanta Flash Master Mix (Dye Plus) and 2×Taq Master Mix (Dye Plus) were purchased from Nanjing Vazyme Biotechnology Co., Ltd.; plasmid extraction kit and yeast genomic DNA extraction kit were purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.; Frozen-EZ Yeast Transformation II Kit™ (yeast transformation kit) was purchased from Shanghai Maokang Biotechnology Co., Ltd.; standard astaxanthin was purchased from Sigma-Aldrich (USA); and the remaining biochemical reagents were domestic analytical grade reagents.

[0041] Instruments used: PCR instrument (LifeECO), ELISA reader (Thermo), ultrasonic cell disruptor (Ningbo Xinzhi), and high performance liquid chromatography (Agilent).

[0042] 3. Fermentation, extraction and detection of astaxanthin.

[0043] Pick a single colony of Yarrowia lipolytica and inoculate it into a test tube containing 5 mL of YPD liquid medium, and culture it at 30°C and 220 rpm for 14 h. Then take 1.5 mL and inoculate it into a 250 mL conical flask containing 30 mL of fermentation medium (5% inoculation amount), and culture it at 30°C and 220 rpm for 96 h.

[0044] Take 1 mL of the fermentation broth from 96 h and add 8000 g , centrifuge at 4°C for 20 min, discard the supernatant, wash the cell pellet once with sterile water, and then add 9 mL of a mixture of dimethyl sulfoxide (DMSO) and methanol (v / v=1:1) to resuspend the cell pellet. Heat in a 50°C water bath for 1 h, during which time the centrifuge tube is taken out and vortexed. Finally, 8000 g , centrifuge at 4°C for 10 min, take 1 mL of the supernatant, filter it and then perform HPLC detection.

[0045] Chromatographic conditions: chromatographic column, Agilent ZORBAX SB-C18 column (250 mm×4.6 mm, 5 μm); column temperature, 40°C; mobile phase is a mixture of methanol / acetonitrile / isopropanol with a volume ratio of 5:3:2; flow rate, 1 mL / min; detector, ultraviolet detector; detection wavelength, 475 nm; injection volume, 10 μL.

[0046] The present invention uses the amino acid sequences of β-carotene ketolase CrtW (Accession: ADN43075.1) and β-carotene hydroxylase CrtZ (Accession: UAW09501.1) of Haematococcus pluvialis as templates, performs BLAST search in the NCBI database, and screens multiple protein sequences with identity (Identity) <30% with the template sequence. CrtW and CrtZ from Pseudo-Anabaena and Scenedesmus are selected for codon optimization, synthesized into purchased plasmids pHR_XPR2_hrGFP and pHR_A08_hrGFP, and then transformed into Yarrowia lipolytica IF015. After screening the correct transformants, shake flask fermentation is performed. After the optimal combination is screened out, the copy number of CrtW is increased to further investigate its effect on astaxanthin synthesis.

[0047] Example 1: Construction of plasmids pHR_XPR2_PCrtW, pHR_A08_PCrtZ, pHR_XPR2_SCrtW, pHR_A08_SCrtZ.

[0048] First, Pseudo-Anabaena Pseudanabaena sp.) CrtW (Accession: PZV12621.1) and CrtZ (Accession: PZV17034.1), Scenedesmus ( Scenedesmus sp. NREL 46B-D3) were codon optimized to obtain the nucleotide sequences of PCrtW (as shown in SEQ ID No.1, 762 bp), PCrtZ (as shown in SEQ ID No.2, 885 bp), SCrtW (as shown in SEQ ID No.3, 1110 bp), and SCrtZ (as shown in SEQ ID No.4, 903 bp).

[0049] SEQ ID No.1

[0050] atggagatgttcaccagcctccagaaggtgtacaagggcgacgactggatcggtcttctcattgcagttatcataatttccttgtggttcatcagtctgtttgagctgctcaccattcccatctctgatacatctatcttttggctgatcttctcgattgttggaagaacttatctccatacagggctcttcattctggcccacgactccatgcatggcaacctcatccccaacaaccggtcccttaatcatctgattggacgttttgctgtgactgtctatggatttctgccctacgacctgtgctgttcgaaccacttcaaccatcatcgatacccttcacaatcgggtgacccggatttctacggatcagtcagcaatcctatcttctggtactccaagttcatccgagagtacttccccatgcgaagcctaattatttttttagtcaacatgattttgcttacctggggcctgacgtccattttccacatcgagttcatcaacctaattctctttgtgctggtgccattggttctgagttctctgcagcttttttattttggcacctacctgcctcaccaccaggtctacgagaacccttacttttcgccacgccttcagtctaactactactcgaatctctggtctttcttctcttgctacaacttcggtcactaccactgggaacaccatgaatatcccaagactccctggtacaaactgcactccatccacgccaaggagattgctctcaagtaa

[0051] SEQ ID No.2

[0052] atgcaacagcaaggtaaagctctcactgttccaattggcgttatgggagcggcccagggattcaaccccaccattctgctgcttctcggttccatcgttctcgctactgccagcacaacaggctactgggtgtggggctgggcccactggctggtgtttgtttgcaacttttctgctctctacgtgctgggcaccgtcatccacgacgcctgtcacaacgtggcccatcccaaccgaatcgtcaatgcggccattggacacattgctgccatcttgcaaggctttgtattccctgtcttcacccgggtgcacatgcagcaccatgctcatgtcaatgacgaggaggatgaccccgaccactttgtctccacgggaggacctctctggctcatcgcagcgcggttcttctaccacgaggtgttctttttccagcgaagattgtggcgaaactacgagcttctggagtgggctatctctcgactcattgtcattgccactctgattgtgggataccactacggttttctggtctacatgatgaacttctggtttgttcctgctgcagtcatgggcttgctcctaggattgttcttcgactacctgccacatcgaccttttgtggaacgttcgcgatggaagaacgcccgcgtttatcccggtcgtttcctcaacattctcctgttgggccagaactatcatcttatccatcatctgtggccgaatgtgccctggtactactatgaaaagacctactaccagatgaagcctctgctagatgccaacggttcaccgcagacccttggactgctcaagatgcccgatctggcagggttcatctatgacgtgtttcttggtataagattccacggccacaagcagaagtaa

[0053] SEQ ID No.3

[0054]

[0055] SEQ ID No.4

[0056] atggtttcgaccaatgccctgagttgctccagctcgcggggtctcgtagctgcgtcaaagccccatgtgtctcgactcaaccagggctgccggcctgttctcgtccctggtcgtataacccagctccgagctgccgccgatgagtccgtccaacaggacgcagcttctcagatcgcccagaacgctcaagagctcgctcagtcaattgaactggcccagaagtctgcttctaaacggctgcagcgccgaagacaacagttgacttaccaggcttccgctattgcagccaccactggagttggagcccttgccattctcgcaacgtactacaagtttgtctaccacatgggaggctccccggatgccgccttcccgtgggccgacatgtgcggaacccttgcgttggtggttggcggcgtcgtcggcatggagatgtgggctagatgggcacacagagctctgtggcacgactttgttcctggatgggccctacacaagagccaccatgagccccgaatcggaccctttgaagctaacgacgtgtatgccatcatgaacgccgtgccagcaatcgccctttgtctgtatgggttcttgactcctaccatgacaggatcgctgtgtttcggaggtggcttgggcatcacgctgttcggtattgcgtacatgtttgtgcatgatggactggtccacaagcgattccctacaggtcccattgctgaactgccctacatgaagcgtgtgacagtcgcgcaccgactgcatcattccgagaagtacaacggtgtgccctggggtctcttccttggaccccaggagctcgaggctatcggcgccggccctgaattagaccgactggtggaggagctggaggtgcgaagtaccgccccatctcggaaataa

[0057] Plasmids pHR_XPR2_hrGFP and pHR_A08_hrGFP were provided to GenScript, and the nucleotide sequences of PCrtW and SCrtW were synthesized between the restriction sites NheI and BssHII of the vector pHR_XPR2_hrGFP to replace hrGFP, thereby obtaining plasmids pHR_XPR2_PCrtW and pHR_XPR2_SCrtW; the nucleotide sequences of PCrtZ and SCrtZ were synthesized between the restriction sites NheI and BssHII of the vector pHR_A08_hrGFP to replace hrGFP, thereby obtaining plasmids pHR_A08_PCrtZ and pHR_A08_SCrtZ.

[0058] Example 2: Construction of recombinant Yarrowia lipolytica strains YL1, YL2, YL3, and YL4.

[0059] (1) Construction of recombinant strains YL1 and YL2

[0060] The instructions of the yeast transformation kit Frozen-EZ Yeast Transformation II Kit™ were used to simultaneously transform Yarrowia lipolytica IF015 with plasmid pCRISPRyl_XPR2 and plasmid pHR_XPR2_PCrtW constructed in Example 1 to obtain transformants. The genome of the transformant was extracted using a yeast genomic DNA extraction kit, PCR amplified and sent for testing to obtain the correct strain W1.

[0061] Plasmid pCRISPRyl_A08 and plasmid pHR_A08_PCrtZ constructed in Example 1 were simultaneously transformed into W1 to obtain transformants. The genome of the transformants was extracted, PCR amplified and sent for testing to obtain the recombinant strain YL1.

[0062] Plasmid pCRISPRyl_A08 and plasmid pHR_A08_SCrtZ constructed in Example 1 were simultaneously transformed into W1 to obtain transformants. The genome of the transformants was extracted, amplified by PCR and sent for testing to obtain the recombinant strain YL2.

[0063] (2) Construction of recombinant strains YL3 and YL4

[0064] According to the instructions of the yeast transformation kit, plasmid pCRISPRyl_XPR2 and plasmid pHR_XPR2_SCrtW constructed in Example 1 were simultaneously transformed into Yarrowia lipolytica IF015 to obtain transformants. The genome of the transformants was extracted, PCR amplified and sent for testing to obtain the correct strain W2.

[0065] Plasmid pCRISPRyl_A08 and plasmid pHR_A08_PCrtZ constructed in Example 1 were simultaneously transformed into W2 to obtain transformants. The genome of the transformants was extracted, PCR amplified and sent for testing to obtain the recombinant strain YL3.

[0066] Plasmid pCRISPRyl_A08 and plasmid pHR_A08_SCrtZ constructed in Example 1 were simultaneously transformed into W2 to obtain transformants. The genome of the transformants was extracted, PCR amplified and sent for testing to obtain the recombinant strain YL4.

[0067] Example 3: Effect of integrated expression of CrtW and CrtZ from different sources on astaxanthin synthesis by Yarrowia lipolytica.

[0068] In this embodiment, Pseudo-Anabaena ( Pseudanabaena sp.) and Scenedesmus ( Scenedesmus sp. NREL46B-D3) CrtW and β-carotene hydroxylase gene CrtZ The recombinant strains YL1 (containing PCrtW and PCrtZ), YL2 (containing PCrtW and SCrtZ), YL3 (containing SCrtW and PCrtZ), and YL4 (containing SCrtW and SCrtZ) were obtained by integration into the XPR2 and A08 sites of the Yarrowia lipolytica genome. Sequencing showed that there were no additional point mutations.

[0069] After 96 h of fermentation of the starting strain IF015 and the four recombinant strains, the intracellular astaxanthin contents of the four recombinant strains were shown in Table 2, which were 10.7 ± 0.9 mg / L, 5.5 ± 0.5 mg / L, 22.3 ± 2.1 mg / L, and 12.8 ± 1.6 mg / L, respectively. The above results indicate that the β-carotene ketolase gene from Scenedesmus CrtW and β-carotene hydroxylase genes from Pseudo-Anabaena CrtZ When combined together, they can promote the synthesis of astaxanthin.

[0070] Table 2 Astaxanthin production of different recombinant strains after 96 h of fermentation

[0071] Strain Astaxanthin production (mg / L) IF015 —— YL1 10.7# ± 0.9 YL2 5.5# ± 0.5 YL3 22.3# ± 2.1 YL4 12.8# ± 1.6

[0072] Note: # indicates extremely significant difference compared with IF015 (P<0.01).

[0073] Example 4: Effect of increasing the copy number of CrtW from Scenedesmus on the astaxanthin synthesis of Yarrowia lipolytica.

[0074] The plasmids pHR_XPR2_SCrtW and pHR_AXP_hrGFP were digested with restriction endonucleases NheI and BssHII, respectively, to obtain the gene fragment SCrtW containing CrtW from Scenedesmus and the plasmid backbone pHR_AXP, which were then connected by T4 DNA ligase and transformed into Escherichia coli DH5 α competent cells. The plates were coated with ampicillin resistance, and the transformants were selected for sequencing. The results showed that there were no additional point mutations, and the plasmid pHR_AXP_SCrtW was obtained. The plasmids pHR_AXP_SCrtW and pCRISPRyl_AXP were transformed into YL3 at the same time to obtain transformants. The genome of the transformant was extracted for PCR amplification and sent for testing to obtain the recombinant strain YL5.

[0075] The strain YL3 and the recombinant strain YL5 were fermented, and the fermentation broth after 96 h was processed. The astaxanthin content is shown in Table 3. The yield of YL5 was 31.2 ± 2.8 mg / L. The above results show that increasing the β-carotene ketolase gene from Scenedesmus CrtW The copy number on the genome of Yarrowia lipolytica increased the astaxanthin content by about 40%, indicating that β-carotene ketolase is a key enzyme that limits the excessive synthesis of astaxanthin.

[0076] Table 3 Astaxanthin production of different recombinant strains after 96 h of fermentation

[0077] Strain Astaxanthin production (mg / L) YL3 22.3 ± 2.1 YL5 31.2# ± 2.8

[0078] Note: # indicates extremely significant difference compared with YL3 (P<0.01).

Claims

1. A method for engineering Yarrowia lipolytica to produce astaxanthin, characterized in that: The steps include: (1) Construction of CrtW expression plasmid and CrtZ expression plasmid: The codons of CrtW from two different sources, Anabaena and Scenedesmus, were optimized, and the PCrtW nucleotide sequence was shown in SEQ ID No.1 and SCrtW nucleotide sequence was shown in SEQ ID No.3, respectively, and they were synthesized between the restriction sites NheI and BssHII of the plasmid pHR_XPR2_hrGFP, respectively, to obtain plasmids pHR_XPR2_PCrtW and pHR_XPR2_SCrtW; the codons of CrtZ from two different sources, Anabaena and Scenedesmus, were optimized, and the PCrtZ nucleotide sequence was shown in SEQ ID No.2 and SCrtZ nucleotide sequence was shown in SEQ ID No.4, respectively, and they were synthesized between the restriction sites NheI and BssHII of the plasmid pHR_A08_hrGFP, respectively, to obtain plasmids pHR_A08_PCrtZ and pHR_A08_SCrtZ; (2) Construction of CrtW and CrtZ co-expression strains: The four plasmids in (1) and their corresponding pCRISPRyl were simultaneously transformed into Yarrowia lipolytica IF015 to obtain PCrtW and PCrtZ co-expression strain YL1, PCrtW and SCrtZ co-expression strain YL2, SCrtW and PCrtZ co-expression strain YL3, and SCrtW and SCrtZ co-expression strain YL4. First, pHR_XPR2_PCrtW and pCRISPRyl_XPR2 were simultaneously transformed into Yarrowia lipolytica IF015 to obtain recombinant strain W1; pHR_XPR2_SCrtW and pCRISPRyl_XPR2 were simultaneously transformed into Yarrowia lipolytica I F015, to obtain the recombinant bacteria W2; pHR_A08_PCrtZ and pCRISPRyl_A08 were simultaneously transformed into W1 to obtain the PCrtW and PCrtZ co-expression strain YL1; pHR_A08_SCrtZ and pCRISPRyl_A08 were simultaneously transformed into W1 to obtain the PCrtW and SCrtZ co-expression strain YL2; pHR_A08_PCrtZ and pCRISPRyl_A08 were simultaneously transformed into W2 to obtain the SCrtW and PCrtZ co-expression strain YL3; pHR_A08_SCrtZ and pCRISPRyl_A08 were simultaneously transformed into W2 to obtain the SCrtW and SCrtZ co-expression strain YL4; (3) The strain obtained in (2) was used for fermentation culture to produce astaxanthin, and the optimal combination YL3 was screened. In step (3), the recombinant bacteria YL1, YL2, YL3, and YL4 were fermented in shake flasks. The specific operation was: a newly activated single colony was picked from the plate and inoculated into a test tube containing YPD liquid culture medium, and then cultured with shaking, and then transferred to a conical flask containing fermentation medium at a 5% inoculation rate, and cultured with shaking for 96 hours. The fermentation liquid after 96 hours was taken for treatment, and the astaxanthin production was determined by HPLC. Co-expression of SCrtW and PCrtZ can further promote the synthesis of astaxanthin; (4) constructing plasmid pHR_AXP_SCrtW, and transforming it and pCRISPRyl_AXP simultaneously into Yarrowia lipolytica recombinant strain YL3 to obtain recombinant strain YL5 with increased SCrtW copy number, and fermenting and culturing to produce astaxanthin. In step (4), plasmid pHR_AXP_SCrtW was constructed by enzyme ligation, and it was transformed into YL3 simultaneously with pCRISPRyl_AXP to obtain recombinant strain YL5 with increased SCrtW copy number by one, and then fermenting in shake flasks. The fermentation medium comprises: 60-100 g / L glucose, 10-30 g / L soy peptone, 5-15 g / L beef extract, 10-20 g / L (NH4)2SO4 and 10-15 g / L MgSO4·7H2O; the fermentation conditions are: pH 5.5-7.5, fermentation temperature 25-35°C, rotation speed 150-250 r / min and fermentation time 96-120 h; the fermentation conditions are: pH 5.5-7.5, fermentation temperature 25-35°C, rotation speed 150-250 r / min and fermentation time 96-120 h.

2. Use of the method for producing astaxanthin by engineering Yarrowia lipolytica according to claim 1 in producing astaxanthin.

Images