Primer, probe and kit for detecting Salmonella pullorum

Abstract

The present invention relates to the field of biotechnology detection, and in particular to a primer and a probe and a kit for detecting Salmonella pullorum. The present invention provides a primer and a probe for detecting Salmonella pullorum, wherein the primer includes a primer for detecting Salmonella pullorum ( Salmonella Pullorum , SP) citE2 SP-F and SP-R of a gene target sequence, wherein the probe is modified with a fluorescent reporter group and a fluorescent quencher group. citE2 The primer pair SP‑F and SP‑R that specifically bind to the gene target sequence, combined with the probe for atopic recognition, can accurately and sensitively detect Salmonella pullorum.

Description

Technical Field

[0001] The invention relates to the field of biotechnology detection, and in particular to a primer, a probe and a kit for detecting Salmonella pullorum. Background Art

[0002] Salmonella pullorum ( Salmonella Pullorum , SP) is a serotype of bacteria, whose infection will cause infectious pullorum. Salmonella pullorum can infect chickens of all ages, with the highest mortality rate for 2-3 week-old chickens. Infected adult chickens show clinical symptoms such as decreased egg production, dysentery, weight loss, reduced fertilization and hatching rates of breeding eggs, and long-term invisible carriage of Salmonella pullorum. There are two main ways for Salmonella pullorum to spread: one is horizontal transmission, that is, after invading the intestinal epithelium, it can be excreted with feces to infect other individuals; the other is vertical transmission, Salmonella pullorum is taken up by macrophages and dendritic cells and can continue to survive in the cells, and then migrate to the reproductive system through the migration and translocation of immune cells in the lymphatic system or bloodstream. The pathogen can infect eggs or their offspring to start its next infection cycle. As a facultative intracellular parasitic pathogen, Salmonella pullorum is difficult to be completely eliminated by antimicrobial drugs or the immune cells and antibodies produced by the immune system during the period of carriage or persistent infection. Therefore, the widespread spread of Salmonella pullorum has seriously hindered the development of the poultry industry.

[0003] Early rapid detection and identification of Salmonella pullorum is the basis for the prevention, control and purification of the disease. Currently, biochemical reaction identification, plate agglutination test and common PCR method are usually used to diagnose samples suspected of Salmonella pullorum infection. Traditional separation and identification methods are cumbersome and time-consuming. Moreover, since Salmonella pullorum and Salmonella gallinarum belong to the same serogroup, it is often difficult to distinguish them using biochemical identification and plate agglutination test. Although the plate agglutination test is simple, it lacks sensitivity and is prone to misjudgment. The common PCR method has better specificity than the first two methods, but its sensitivity is poor and its accuracy is poor. Summary of the invention

[0004] Therefore, the technical problem to be solved by the present invention is to overcome the defects of poor sensitivity and low accuracy of the identification method of Salmonella pullorum in the prior art, thereby providing a primer, a probe and a kit for detecting Salmonella pullorum.

[0005] In one aspect, the present invention provides a primer and a probe for detecting Salmonella pullorum, wherein the primer comprises a primer for detecting Salmonella pullorum ( Salmonella Pullorum , SP) citE2 SP-F and SP-R of the gene target sequence, wherein the sequences of SP-F and SP-R are as follows:

[0006] SP-F: 5′-CCGTCGACATCGCCACCTCCAG-3′ (SEQ ID NO: 1),

[0007] SP-R: 5′-CCCTTTCGCCAACTGCACTTCCTTCAG-3′ (SEQ ID NO: 2);

[0008] The probe sequence is as follows:

[0009] 5′-TGCGCAGTGCTGCATGCGGCGCGC-3′ (SEQ ID NO: 3),

[0010] Wherein, the probe is modified with a fluorescent reporter group and a fluorescent quencher group.

[0011] In some embodiments, the fluorescent reporter group and the fluorescent quencher group are modified at the 5' end of the probe sequence.

[0012] In some of the embodiments, the base number of the linker gene between the fluorescent reporter group and the fluorescent quencher group is 7 bp.

[0013] Preferably, the sequence of the linker gene between the fluorescent reporter group and the fluorescent quencher group is as follows: 5′-TGGCAAT-3′.

[0014] In some of the embodiments, the fluorescent reporter group includes at least one of a FAM group, a CY5 group, a JOE group, and a CY3 group.

[0015] In some embodiments, the fluorescence quenching group includes at least one of a BHQ1 group and a BHQ2 group.

[0016] In some embodiments, the 5′ end of the linker is connected to a fluorescent reporter group, and the 3′ end of the linker is connected to a fluorescent quencher group.

[0017] In some embodiments, the Salmonella pullorum citE2 The gene target sequence is shown in SEQ ID NO:4.

[0018] In some embodiments, the 5′ end of the probe sequence is connected to a linker sequence.

[0019] Optionally, the probe sequence is as follows:

[0020] 5′-FAM-TGGCAAT-BHQ1-TGCGCAGTGCTGCATGCGGCGCGC-3′.

[0021] In another aspect, the present invention provides a kit for detecting Salmonella pullorum, comprising the above-mentioned primers and probes.

[0022] In some embodiments, the kit further comprises a reagent system suitable for real-time fluorescence quantitative PCR reaction.

[0023] Optionally, based on 20 μL, the reagent system of TaqMan qPCR reaction includes 8~12 μL of premix, 0.4~0.6 μL of SP-F, 0.4~0.6 μL of SP-R, 0.1~0.4 μL of probe, 0.8~1.2 μL of DNA template, and the rest is nuclease-free water, wherein the molar concentration of SP-F is 8~12 μM, the molar concentration of SP-R is 8~12 μM, and the molar concentration of the probe is 8~12 μM.

[0024] Preferably, based on 20 μL, the reagent system of the TaqMan qPCR reaction includes 10 μL of 2×Taq Pro HS premix, 0.5 μL of SP-F, 0.5 μL of SP-R, 0.3 μL of probe, 1 μL of DNA template, and the rest is nuclease-free water, wherein the molar concentration of SP-F is 10 μM, the molar concentration of SP-R is 10 μM, and the molar concentration of the probe is 10 μM.

[0025] On the other hand, the present invention provides a method for detecting Salmonella pullorum, comprising the following steps:

[0026] S1, extracting genomic DNA of the sample to be tested as a DNA template;

[0027] S2, using the primers and probes for detecting Salmonella pullorum or the kit for detecting Salmonella pullorum to perform real-time fluorescence detection on the DNA template.

[0028] In some embodiments, step S1 further comprises using primer SP-F, primer SP-R and extracting genomic DNA to construct a citE2 A vector of a gene target sequence, wherein the vector is the DNA template of step S2,

[0029] Optionally, the plasmid of the vector includes a PUC19 plasmid.

[0030] In some of the embodiments, the mass concentration of the genomic DNA of the sample to be tested extracted from the DNA template is 30-1500 ng / μL.

[0031] The technical solution of the present invention has the following advantages:

[0032] 1. The present invention provides a primer and probe for detecting Salmonella pullorum, wherein the primer comprises a primer for detecting Salmonella pullorum (Salmonella Pullorum , SP) citE2 The SP-F and SP-R of the gene target sequence, wherein the sequences of SP-F and SP-R are as follows: SP-F: 5′-CCGTCGACATCGCCACCTCCAG-3′ (SEQ ID NO: 1), SP-R: 5′-CCCTTTCGCCAACTGCACTTCCTTCAG-3′ (SEQ ID NO: 2); the probe sequence is as follows: 5′-TGCGCAGTGCTGCATGCGGCGCGC-3′ (SEQ ID NO: 3), wherein the probe is modified with a fluorescent reporter group and a fluorescent quencher group. The present invention provides a method for citE2 The primer pair SP-F and SP-R that specifically bind to the gene target sequence, combined with the probe for atopic recognition, can accurately and sensitively detect Salmonella pullorum.

[0033] 2. The present invention provides a primer and a probe for detecting Salmonella pullorum, wherein the fluorescent reporter group and the fluorescent quencher group are modified at the 5′ end of the probe sequence. citE2 The gene was conserved among the enteric serotypes but absent in other Salmonella serotypes and bacteria, and was found in Salmonella pullorum ( Salmonella Pullorum , SP) citE2 The gene has a fragment deletion, therefore, the present invention is based on Salmonella pullorum and other enteric Salmonella citE2 Due to the characteristic of the presence of missing fragments in the gene, the fluorescent reporter group and the fluorescent quencher group are modified at the 5′ end of the probe sequence, thereby achieving specific recognition of Salmonella pullorum. This is because when facing the genomes of other intestinal Salmonella other than Salmonella pullorum, due to the presence of gene fragments missing from Salmonella pullorum in other intestinal Salmonella genomes, the probe sequence with the fluorescent group and the quencher group cannot be complementary to the base pairing of the target sequence, thereby failing to be cut by DNA polymerase to generate a fluorescent signal in the PCR stage. However, when facing the genome of Salmonella pullorum, the probe sequence can be complementary to the target sequence, and then can be cut by DNA polymerase to generate a fluorescent signal, thereby achieving specific recognition of Salmonella pullorum and other intestinal Salmonella.

[0034] 3. The primers and probes for detecting Salmonella pullorum provided by the present invention or the kit composed of the primers and probes for detecting Salmonella pullorum can provide efficient and reliable technical support for the diagnosis, epidemic monitoring and prevention and control of Salmonella pullorum, and show high application value in livestock and poultry breeding. The detection method is simple to operate, has a high detection rate, high specificity and sensitivity, can detect Salmonella pullorum from most tissue structures of chickens, and has strong universality. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] In order to more clearly illustrate the specific implementation methods of the present invention or the technical solutions in the prior art, the drawings required for use in the specific implementation methods or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are some implementation methods of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0036] Figure 1 Schematic diagram of the principle of the probe of the present invention to specifically identify Salmonella pullorum;

[0037] Figure 2 is a standard curve of Salmonella pullorum genomic DNA and Ct value at different bacterial solution dilution concentrations in Experimental Example 1 of the present invention;

[0038] Figure 3 1 is a fluorescence quantitative PCR amplification curve of Salmonella pullorum genomic DNA at different bacterial solution dilution concentrations in Example 1 of the present invention;

[0039] Figure 4 is the standard curve of plasmids with different copy numbers and Ct values ​​in Experimental Example 2 of the present invention;

[0040] Figure 5 is the plasmid fluorescence quantitative PCR amplification curve of different copy numbers in Example 2 of the present invention;

[0041] Figure 6 This is a graph showing the specific detection results of Salmonella pullorum in Experimental Example 3 of the present invention;

[0042] Figure 7 It is the detection rate and Ct value of Salmonella pullorum in each tissue and organ of Experimental Example 4 of the present invention, wherein, Figure A is the detection rate and Ct value in the ovary, Figure B is the detection rate and Ct value in the infundibulum, Figure C is the detection rate and Ct value in the magnum, Figure D is the detection rate and Ct value in the isthmus, Figure E is the detection rate and Ct value in the uterus, Figure F is the detection rate and Ct value in the vagina, Figure G is the detection rate and Ct value in the spleen, Figure H is the detection rate and Ct value in the liver, Figure I is the detection rate and Ct value in the blood, Figure J is the detection rate and Ct value in the feces, Figure K is the detection rate and Ct value in the bile, and Figure L is the detection rate and Ct value in the yolk;

[0043] Figure 8 This is a heat map of the detection rate of Salmonella pullorum in various tissues and organs in Example 4 of the present invention. DETAILED DESCRIPTION

[0044] The following examples are provided for a better understanding of the present invention, but are not intended to limit the best mode of implementation, nor to limit the content and protection scope of the present invention. Any product identical or similar to the present invention obtained by anyone under the inspiration of the present invention or by combining the features of the present invention with other prior arts shall fall within the protection scope of the present invention.

[0045] If no specific experimental steps or conditions are specified in the examples, the conventional experimental steps or conditions described in the literature in the field can be used. If no manufacturer is specified for the reagents or instruments used, they are all conventional reagent products that can be obtained commercially.

[0046] The inventors used the NCBI BLAST tool to search for sequences from Salmonella enterica serotypes, other Salmonella subspecies, and other bacteria. citE2 The results showed that citE2 The gene is conserved among enteric Salmonella serotypes but absent in other Salmonella serotypes and bacteria. It was also found that compared with other enteric Salmonella, Salmonella pullorum ( Salmonella Pullorum , SP) citE2 There is a 76 bp gene fragment deletion in the gene, and the deleted gene sequence is shown in SEQID NO:5, specifically: 5′-TGGCGGCATTTGATTACGTGATGGATATGGGCACCAGCCGGGGCGATGGCACCGAGCTGTTCTACGCCCGCTGCGC-3′.

[0047] Subsequently, the inventors used 299 strains of Salmonella pullorum extracted in the previous step ( Salmonella Pullorum , The complete gene sequence of SP was compared and the results confirmed that citE2 The 76 bp deletion in the gene is conservative and unique to Salmonella pullorum.

[0048] Therefore, specific primers and specific probes were designed based on the gene deletion fragment using SnapGene software, which can specifically identify the gene deletion fragment in the Salmonella pullorum genome. citE2 The conserved region sequence of the unique gene fragment is missing. citE2The gene target sequence is shown in SEQ ID NO:4, specifically, 5′-CCGTCGACATCGCCACCTCCAGCCCGCGCATGGTGGCAATTGCGCAGTGCTGCATGCGGCGCGCGTTGCGGGTATTGCCGCCTATGATGTCGTTTGGTCGGATATCAATAATGAAGAAGGCTTCCTGAAGGAAGTGCAGTTGGCGAAAGGG-3′, recorded in NCBI, BioProject accession PRJNA689917, with a position range of 1173217-1173367.

[0049] The specific primers include the front primer SP-F and the rear primer SP-R.

[0050] The SP-F sequence is shown in SEQ ID NO: 1,

[0051] Specifically, 5′-CCGTCGACATCGCCACCTCCAG-3′,

[0052] The SP-R sequence is shown in SEQ ID NO: 2,

[0053] Specifically, 5′-CCCTTTCGCCAACTGCACTTCCTTCAG-3′,

[0054] The specific probe sequence is shown in SEQ ID NO: 3.

[0055] Specifically, it is 5′-TGCGCAGTGCTGCATGCGGCGCGC-3′.

[0056] At the same time, in order to distinguish Salmonella pullorum from other enteric Salmonella and achieve specific detection, the present invention uses Salmonella pullorum and other enteric Salmonella to distinguish Salmonella pullorum from other enteric Salmonella. citE2 Due to the missing fragment of the gene, the fluorescent reporter group and the fluorescent quencher group are modified at the 5' end of the probe sequence to achieve specific recognition of Salmonella pullorum. This is because, see Figure 1 When faced with genomes of other enteric Salmonella other than Salmonella pullorum, due to the presence of Salmonella pullorum missing gene fragments in other enteric Salmonella genomes, the DNA connecting the fluorescent group and the quenching group in the probe sequence cannot be complementary to the target sequence base pairing, which results in the inability to be cut by DNA polymerase in the PCR stage to produce a fluorescent signal. However, when faced with the genome of Salmonella pullorum, the probe sequence can be completely complementary to the target sequence and can be cut by DNA polymerase to produce a fluorescent signal, thereby achieving specific identification of Salmonella pullorum and other enteric Salmonella.

[0057] The primers and probes in the present invention were synthesized by Hangzhou Shangya Company.

[0058] In the embodiment of the present invention, Salmonella pullorum ( Salmonella Pullorum , SP), Salmonella enterica serovar Gallinarum ( Salmonella Gallinarum), Salmonella Enteritidis ( Salmonella Enteritidis), Salmonella Newport ( Salmonella Newport), Salmonella typhimurium ( Salmonella Typhimurium), Salmonella Dublin ( Salmonella Dublin)Reference from Zhou X, Kang X, Chen J, Song Y, Jia C, Teng L, et al. Genome degradation promotes Salmonella pathoadaptation by remodelingfimbriae-mediated proinflammatory response. National Science Review 2023:nwad228, Escherichia coli( Escherichia coli , ATCC25922), Staphylococcus aureus ( Staphylococcus aureus, ATCC25923), Listeria monocytogenes ( Listeria monocytogenes , ATCC19114) and Bacillus cereus ( Bacillus cereus , ATCC49064) were purchased from the ATCC standard strain library, and the above strains were all stored in the laboratory of University of Science and Technology of China Hangzhou Institute for Advanced Studies.

[0059] The commercial genomic DNA extraction kit in the embodiments and experimental examples of the present invention was purchased from Zhejiang Easyside Biotechnology Co., Ltd., model DR0301250, 2×Taq Pro HS premix was purchased from Nanjing Novozymes, model QN111-01, gel recovery kit was purchased from Zhejiang Easyside Biotechnology Co., Ltd., model DR0101250, plasmid extraction kit was purchased from Zhejiang Easyside Biotechnology Co., Ltd., model DR0201250, tissue genomic DNA extraction kit was purchased from Tiangen Biochemical Technology Co., Ltd., model DP304, PUC19 plasmid was commercially available, and the PUC19 plasmid in the embodiments of the present invention was purchased from Bioengineering (Shanghai) and stored in the laboratory of the University of Science and Technology of China Hangzhou Advanced Research Institute.

[0060] Example 1

[0061] This embodiment provides a method for detecting Salmonella pullorum, and the specific steps and parameters are as follows:

[0062] (1) Extraction of Salmonella pullorum genomic DNA:

[0063] The strain of Salmonella pullorum to be tested was inoculated into a sterile LB liquid culture medium, and placed in a shaking incubator at 37°C and 180 rpm for overnight fermentation to obtain a bacterial liquid;

[0064] The fermented bacterial liquid was centrifuged at 7000 rpm for 15 min at 4°C, the supernatant was discarded, and the genomic DNA was extracted from the bacterial precipitate using a commercial genomic DNA extraction kit (DR0301250, EasyST, China). The genomic DNA concentration was then determined using an ultra-micro nucleic acid protein spectrophotometer and stored in a -20°C refrigerator for future use.

[0065] (2) qPCR detection

[0066] qPCR detection was performed according to the reaction system in Table 1 and the reaction procedure in Table 2, wherein the DNA template in Table 1 is the genomic DNA extracted in step (1), the primer SP-F sequence is shown in SEQ ID NO: 1, specifically 5′-CCGTCGACATCGCCACCTCCAG-3′, the SP-R sequence is shown in SEQ ID NO: 2, specifically 5′-CCCTTTCGCCAACTGCACTTCCTTCAG-3′, and the TaqMan probe sequence is modified with a FAM fluorescent reporter group and a BHQ1 fluorescent quencher group, and the sequence is shown below, specifically:

[0067] 5′-FAM–TGGCAAT-BHQ1-TGCGCAGTGCTGCATGCGGCGCGC-3′.

[0068] Table 1 PCR reaction system

[0069]

[0070] Table 2 PCR reaction program

[0071]

[0072] Example 2

[0073] This embodiment provides a method for detecting Salmonella pullorum, and the specific steps and parameters are as follows:

[0074] (1) Extraction of Salmonella pullorum genomic DNA:

[0075] The strain of Salmonella pullorum to be detected was inoculated into a sterile LB liquid culture medium, and placed in a shaking incubator at 37°C and 180 rpm for overnight fermentation to obtain a bacterial liquid;

[0076] The fermented bacterial solution was centrifuged at 7000 rpm in a centrifuge at 4°C for 15 min, the supernatant was discarded, and the bacterial pellet was used to extract genomic DNA using a commercial genomic DNA extraction kit (DR0301250, EasyStud, China) and stored in a -20°C refrigerator for future use.

[0077] (2) Vector construction

[0078] The genomic DNA extracted in step (1) was used as a template, and the front primer SP-F and the rear primer SP-R were used for PCR amplification reaction. The PCR reaction system was 10 μL of 2×Taq Pro HS premix, 0.5 μL of 10 μM SP-F, 0.5 μL of 10 μM SP-R, 1 μL of genomic DNA, and 8 μL of nuclease-free water. The reaction procedure was shown in Table 2 in Example 1. After the reaction, citE2 The target gene fragment, wherein citE2 The sequence of the target gene fragment is shown in SEQ ID NO:4, and the specific sequence is as follows: 5′-CCGTCGACATCGCCACCTCCAGCCCGCGCATGGTGGCAATTGCGCAGTGCTGCATGCGGCGCGCGTTGCGGGTATTGCCGCCTATGATGTCGTTTGGTCGGATATCAATAATGAAGAAGGCTTCCTGAAGGAAGTGCAGTTGGCGAAAGGG-3′, wherein the primer SP-F sequence is shown in SEQ ID NO:1, specifically 5′-CCGTCGACATCGCCACCTCCAG-3′, and the SP-R sequence is shown in SEQ ID NO:2, specifically 5′-CCCTTTCGCCAACTGCACTTCCTTCAG-3′.

[0079] The target fragment was recovered using a gel recovery kit (DR0101250, EasySTUD, China), and inserted into the PUC19 plasmid vector using seamless cloning technology. It was then transformed into DH5α competent cells, and positive clones were screened and sequenced for verification;

[0080] The plasmid containing the target fragment was extracted using a plasmid extraction kit (DR0201250, Easy-Development, China), which was PUC19- citE2 Plasmid. The plasmid concentration was measured with an ultra-micro nucleic acid protein spectrophotometer and converted into copy number according to the molecular weight of the plasmid, and then stored at -20°C for later use.

[0081] (3) qPCR detection

[0082] The extracted genomic DNA was subjected to qPCR detection according to the reaction system in Table 1 and the reaction procedure in Table 2 in Example 1, wherein the DNA template was the plasmid containing the target fragment obtained in step (2), i.e., PUC19- citE2 Plasmid, TaqMan probe sequence modified with FAM fluorescent reporter group and BHQ1 fluorescent quencher group, the probe sequence is as follows, specifically 5′-FAM-TGGCAAT-BHQ1-TGCGCAGTGCTGCATGCGGCGCGC-3′, the primer is the same as step (2) of this example.

[0083] Example 3

[0084] This embodiment provides a method for detecting Salmonella pullorum, and the specific steps and parameters are as follows:

[0085] (1) Extraction of Salmonella pullorum genomic DNA:

[0086] The strain of Salmonella pullorum to be detected was inoculated into a sterile LB liquid culture medium, and placed in a shaking incubator at 37°C and 180 rpm for overnight fermentation to obtain a bacterial liquid;

[0087] The fermented bacterial liquid was centrifuged at 7000 rpm for 15 min at 4°C, the supernatant was discarded, and the genomic DNA was extracted from the bacterial precipitate using a commercial genomic DNA extraction kit (DR0301250, EasyST, China). The genomic DNA concentration was then determined using an ultra-micro nucleic acid protein spectrophotometer and stored in a -20°C refrigerator for future use.

[0088] (2) qPCR detection

[0089] qPCR detection was performed according to the reaction procedure in Table 2 of Example 1. The reaction system was 8 μL of 2×Taq Pro HS premix, 0.6 μL of 8 μM SP-F, 0.4 μL of 12 μM SP-R, 1.2 μL of DNA template, 9.7 μL of nuclease-free water, and 0.1 μL of 8 μM TaqMan probe, wherein the DNA template was the genomic DNA prepared in step (1). The TaqMan probe sequence was modified with a CY5 fluorescent reporter group and a BHQ1 fluorescent quencher group. The sequence was as follows, specifically 5′-CY5-TGGCAAT-BHQ1-TGCGCAGTGCTGCATGCGGCGCGC-3′. The primers were the same as those in step (2) of Example 1.

[0090] Example 4

[0091] This embodiment provides a method for detecting Salmonella pullorum, and the specific steps and parameters are as follows:

[0092] (1) Extraction of Salmonella pullorum genomic DNA:

[0093] The strain of Salmonella pullorum to be detected was inoculated into a sterile LB liquid culture medium, and placed in a shaking incubator at 37°C and 180 rpm for overnight fermentation to obtain a bacterial liquid;

[0094] The fermented bacterial liquid was centrifuged at 7000 rpm for 15 min at 4°C, the supernatant was discarded, and the genomic DNA was extracted from the bacterial precipitate using a commercial genomic DNA extraction kit (DR0301250, EasyST, China). The genomic DNA concentration was then determined using an ultra-micro nucleic acid protein spectrophotometer and stored in a -20°C refrigerator for future use.

[0095] (2) qPCR detection

[0096] qPCR detection was performed according to the reaction procedure in Table 2 of Example 1. The reaction system was 10 μL of 2×Taq Pro HS premix, 0.4 μL of 12 μM SP-F, 0.6 μL of 8 μM SP-R, 0.8 μL of DNA template, 7.8 μL of nuclease-free water, and 0.4 μL of 8 μM TaqMan probe, wherein the DNA template was the genomic DNA prepared in step (1), and the TaqMan probe sequence was modified with a CY3 fluorescent reporter group and a BHQ2 fluorescent quencher group, and the sequence was as follows, specifically 5′-CY3-TGGCAAT-BHQ2-TGCGCAGTGCTGCATGCGGCGCGC-3′, and the primers were the same as those in step (2) of Example 1.

[0097] Example 5

[0098] This embodiment provides a method for detecting Salmonella pullorum, and the specific steps and parameters are as follows:

[0099] (1) Extraction of Salmonella pullorum genomic DNA:

[0100] The strain of Salmonella pullorum to be detected was inoculated into a sterile LB liquid culture medium, and placed in a shaking incubator at 37°C and 180 rpm for overnight fermentation to obtain a bacterial liquid;

[0101] The fermented bacterial solution was centrifuged at 7000 rpm in a centrifuge at 4°C for 15 min, the supernatant was discarded, and the bacterial pellet was used to extract genomic DNA using a commercial genomic DNA extraction kit (DR0301250, EasyStud, China) and stored in a -20°C refrigerator for future use.

[0102] (2) Vector construction

[0103] The genomic DNA extracted in step (1) was used as a template, and the front primer SP-F and the rear primer SP-R were used for PCR amplification reaction. The PCR reaction system was 10 μL of 2×Taq Pro HS premix, 0.5 μL of 10 μM SP-F, 0.5 μL of 10 μM SP-R, 1 μL of DNA template, and 8 μL of nuclease-free water. The reaction procedure was shown in Table 2 in Example 1. After the reaction, citE2 The target gene fragment, wherein citE2 The sequence of the target gene fragment is shown in SEQ ID NO: 4, and the primers are the same as those in step (2) of Example 1;

[0104] The target fragment was recovered using a gel recovery kit (DR0101250, EasySTUD, China), and inserted into the PUC19 plasmid vector using seamless cloning technology. It was then transformed into DH5α competent cells, and positive clones were screened and sequenced for verification;

[0105] The plasmid containing the target fragment was extracted using a plasmid extraction kit (DR0201250, Easy-Development, China), which was PUC19- citE2 Plasmid. The plasmid concentration was measured with an ultra-micro nucleic acid protein spectrophotometer and converted into copy number according to the molecular weight of the plasmid, and then stored at -20°C for later use.

[0106] (3) qPCR detection

[0107] qPCR detection was performed according to the reaction procedure in Table 2 of Example 1, wherein the reaction system was 8 μL of 2×Taq Pro HS premix, 0.6 μL of 8 μM SP-F, 0.4 μL of 12 μM SP-R, 1.2 μL of DNA template, 9.5 μL of nuclease-free water, and 0.3 μL of 8 μM TaqMan probe. The DNA template was the plasmid containing the target fragment prepared in step (2) of this example, i.e., PUC19- citE2 Plasmid, TaqMan probe sequence modified with JOE fluorescent reporter group and BHQ1 fluorescent quencher group, the probe sequence is as follows, specifically:

[0108] 5′-JOE-TGGCAAT-BHQ1-TGCGCAGTGCTGCATGCGGCGCGC-3′, the primer is the same as that in step (2) of Example 1.

[0109] Experimental Example 1

[0110] The bacterial solution obtained by fermentation in step (1) of Example 1 was diluted step by step, and the OD of each bacterial solution concentration was measured. 600 Value and bacterial count, measured by OD 600The horizontal axis is CFU / μL, and the vertical axis is CFU / μL. 600 -CFU / μL standard curve, according to OD 600 -CFU / μL standard curve, the concentration of the bacterial solution obtained by fermentation in step (1) of Example 1 was adjusted to 4×10 9 CFU / μL, and the bacterial solution concentration was diluted to 4×10 3 CFU / μL, 4×10 2 CFU / μL, 4×10 1 CFU / μL, 4×10 0 CFU / μL, the bacterial solutions of different bacterial concentrations were centrifuged at 7000 rpm for 15 min at 4°C, the supernatant was discarded, and the genomic DNA was extracted from the bacterial precipitate using a commercial genomic DNA extraction kit (DR0301250, Easystep, China). The genomic DNA extracted from the above bacterial fermentation solution was used as a DNA template, and the Ct value of the genomic DNA at different bacterial solution concentrations was determined according to the detection method of step (2) of Example 1. The detection method for each bacterial solution concentration was repeated 3 times.

[0111] The Ct value obtained by qPCR was plotted against the standard curve of Salmonella pullorum genomic DNA. Figure 2 It can be seen that the amplification efficiency of the detection method for Salmonella pullorum genomic DNA is 90.55%, and it forms a strong linear relationship with the concentration of Salmonella pullorum genomic DNA (correlation index R 2 = 0.9886).

[0112] Draw the fluorescence quantitative PCR amplification curve of genomic DNA with different bacterial solution concentrations, see Figure 3 The results showed that the detection sensitivity of the detection method of the present invention for the genomic DNA of Salmonella pullorum was 4 CFU / μL.

[0113] Experimental Example 2

[0114] The PUC19- citE2 The copy numbers of the plasmids diluted per unit volume were 5×10 0 copies / μL, 5×10 1 copies / μL, 5×10 2 copies / μL, 5×10 3 copies / μL, 5×10 4 copies / μL, based on the diluted PUC19- citE2The plasmid was used as a DNA template, and the Ct value of the DNA template at different copy numbers was determined according to the detection method in step (3) of Example 2. The detection method for each copy number was repeated 3 times.

[0115] Plot the Ct values ​​of qPCR assays versus PUC19- citE 2 Standard curve of plasmid copy number, see Figure 4 It can be seen that this detection method is effective for PUC19- citE The amplification efficiency of 2 plasmid was 98.11%, and it was similar to PUC19- citE 2 The plasmid copy number forms a strong linear relationship (correlation index R 2 = 0.9975).

[0116] Plotting different copy numbers of PUC19- citE2 Fluorescence quantitative PCR amplification curve of plasmid, see Figure 5 The test results show that the detection method of the present invention is effective for PUC19- citE2 The detection sensitivity of plasmid was 5 copies / μL.

[0117] Experimental Example 3

[0118] The detection method of Example 1 was used to extract Salmonella pullorum ( Salmonella Pullorum , SP), Salmonella enterica serovar Gallinarum ( Salmonella Gallinarum), Salmonella typhimurium ( Salmonella Typhimurium), Salmonella Enteritidis ( Salmonella Enteritidis ), Salmonella Dublin ( Salmonella Dublin), Escherichia coli ( Escherichia coli , ATCC25922), Staphylococcus aureus ( Staphylococcus aureus, ATCC25923), Listeria monocytogenes ( Listeria monocytogenes , ATCC19114) and Bacillus cereus ( Bacillus cereus , ATCC49064) and the genomic DNA extracted from the above strains was tested by qPCR to obtain the real-time fluorescence quantitative PCR amplification curves of different strains. The results are shown in Figure 6 .

[0119] According to the experimental results, the primers and probes of the present invention only produce specific amplification curves for Salmonella pullorum, but do not produce amplification curves for other Salmonella serotypes and genomes of other bacteria, which shows that the detection method can specifically detect Salmonella pullorum.

[0120] Experimental Example 4

[0121] (1) Construction of Salmonella pullorum infection model

[0122] Sixty specific pathogen-free hens aged 180 days were infected by oral inoculation of Salmonella pullorum. The inoculation amount of Salmonella pullorum bacteria per chicken in this model construction was 10 9 CFU.

[0123] (2) Salmonella pullorum detection

[0124] After infection, monitoring was continued for 6 weeks, and 12 tissue samples were collected from 10 infected hens every week. The tissue samples were feces, liver, spleen, blood, bile, ovary, infundibulum, magnum, isthmus, uterus, vagina, and yolk.

[0125] Each tissue sample was ground with liquid nitrogen, and a tissue genomic DNA extraction kit (DP304, Tiangen, China) was used to obtain the tissue sample genomic DNA. The tissue sample genomic DNA was used as a DNA template and the detection method of step (2) of Example 1 was used to detect Salmonella pullorum in the tissue sample. The results are shown in FIG. Figures 7 - 8 (where 3.3e-002 means 0.03333…, 3 infinite loop).

[0126] The results showed that the primers and probes provided by the present invention were capable of detecting Salmonella pullorum in the feces, liver, spleen, blood, bile, ovary, infundibulum, magnum, isthmus, uterus, vagina, and egg yolk of chickens, and in particular, the detection rate in the liver, spleen, blood, ovary, infundibulum, magnum, isthmus, uterus, and vaginal tissues was greater than 50%, among which the ovarian samples maintained the highest detection rate at all infection weeks, averaging 80%.

[0127] Obviously, the above embodiments are merely examples for the purpose of clear explanation, and are not intended to limit the implementation methods. For those skilled in the art, other different forms of changes or modifications can be made based on the above description. It is not necessary and impossible to list all the implementation methods here. The obvious changes or modifications derived therefrom are still within the scope of protection of the invention.

Claims

1. A primer and probe for detecting Salmonella pullorum, characterized in that: The primers include primers for detecting Salmonella pullorum ( Salmonella Pullorum , SP) citE2 SP-F and SP-R of the gene target sequence, wherein the sequences of SP-F and SP-R are as follows: SP-F: 5′-CCGTCGACATCGCCACCTCCAG-3′ (SEQ ID NO: 1), SP-R: 5′-CCCTTTCGCCAACTGCACTTCCTTCAG-3′ (SEQ ID NO: 2); The probe sequences are as follows, 5′-fluorescence reporter group-TGGCAAT-fluorescence quencher group-TGCGCAGTGCTGCATGCGGCGCGC-3′.

2. The primer and probe for detecting Salmonella pullorum according to claim 1, characterized in that: The fluorescent reporter group includes at least one of a FAM group, a CY5 group, a JOE group, and a CY3 group; and / or, The fluorescence quenching group includes at least one of a BHQ1 group and a BHQ2 group.

3. The primers and probe for detecting Salmonella pullorum according to claim 1, characterized in that: Salmonella pullorum citE2 The gene target sequence is shown in SEQ ID NO:

4.

4. A kit for detecting Salmonella pullorum, characterized in that: The kit comprises the primers and probe for detecting Salmonella pullorum according to any one of claims 1 to 3.

5. The kit for detecting Salmonella pullorum according to claim 4, characterized in that: The kit also includes a reagent system suitable for real-time fluorescence quantitative PCR reaction. Based on 20 μL, the reagent system of TaqMan qPCR reaction includes 8~12 μL of premix, 0.4~0.6 μL of SP-F, 0.4~0.6 μL of SP-R, 0.1~0.4 μL of probe, 0.8~1.2 μL of DNA template, and the rest is nuclease-free water. Among them, the molar concentration of SP-F is 8~12μM, the molar concentration of SP-R is 8~12μM, and the molar concentration of the probe is 8~12μM.

6. A method for detecting Salmonella pullorum for non-diagnostic purposes, characterized in that: The following steps are included: S1, extracting genomic DNA of the sample to be tested as a DNA template; S2, using the primers and probe for detecting Salmonella pullorum according to any one of claims 1-3 or the kit for detecting Salmonella pullorum according to any one of claims 4-5 to perform real-time fluorescence detection on the DNA template obtained in step S1.

7. The detection method according to claim 6, characterized in that: Step S1 also includes constructing a primer containing citE2 A vector of a gene target sequence, wherein the vector is the DNA template of step S2; The plasmid of the vector includes the pUC19 plasmid.

Images