An antigen binding protein specifically binding to vitamin k3 and uses thereof
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-04-12
- Publication Date
- 2026-08-11
AI Technical Summary
在制备过程中存在以下问题:在杂交瘤细胞的冻存、复苏和传代过程中,会出现染色体突变或丢失的现象,导致单克隆抗体性能下降甚至失效;在腹水生产过程中,由于小鼠个体有差异,会出现溶血的现象,从而影响抗体的质量;另外,杂交瘤细胞的长期保存十分依赖液氮,需随时补充,保存成本高
[0027] The antigen-binding protein provided by this invention has a unique variable region sequence, exhibiting high affinity and specificity for vitamin K3 antigen. When applied to the detection of vitamin K3, its sensitivity (IC50) is high. 50 The concentration reached 0.51 ng/mL, and the limit of detection (IC50) was [missing value]. 10 With a concentration of 0.21 ng/mL, a rapid immunoassay method with better stability and higher consistency was established, showing broad application prospects. This invention is based on recombinant antibody technology, which has good reproducibility and high batch-to-batch consistency. It does not require the use of experimental animals and is expressed under serum-free conditions, avoiding contamination caused by serum components.
Smart Images

Figure CN118324923B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of bioimmunotechnology, and in particular to an antigen-binding protein that specifically binds to vitamin K3 and its applications. Background Technology
[0002] Vitamin K is an essential fat-soluble micronutrient, required for the post-translational γ-carboxylation of specific glutamate residues in liver and extrahepatic proteins. It participates in blood clotting and prevents calcification of cartilage and the vascular system. Vitamin K3 (VK3), also known as menadione, is a synthetic vitamin supplement. Vitamin K3 promotes prothrombin formation, has a diuretic effect, and can lower blood pressure. It is sometimes used as a coloring agent or food additive. Vitamin K3 is also used as a feed additive. In animal husbandry, to prevent vitamin K3 deficiency, vitamin K3 is often improperly added to animal feed. However, excessive addition can produce toxicity in the body and, in severe cases, lead to allergic reactions. Therefore, determining the vitamin K3 content in feed is crucial.
[0003] Currently, the main methods for detecting vitamin K3 include instrumental analysis and immunoassay. Instrumental methods primarily include high-performance liquid chromatography (HPLC), liquid chromatography-mass spectrometry (LC-MS), and sensor analysis methods, which offer high sensitivity and selectivity. However, instrumental analysis requires sophisticated equipment, knowledgeable operators, complex sample pretreatment processes, and the ability to process experimental data. Immunoassay, based on antigen-antibody reactions, is simple to operate and its principles are easy to understand; it also offers high sensitivity and selectivity. For example, Chinese patent CN113046325A discloses a vitamin K3 monoclonal antibody hybridoma cell line and its applications. The monoclonal antibody secreted by this cell line exhibits good specificity and detection sensitivity for vitamin K3.
[0004] Antibodies are fundamental to immunoassay methods. However, the preparation of traditional monoclonal antibodies involves processes such as mouse immunization, hybridoma cell fusion, monoclonal screening, cell expansion and culture, and ascites fluid production. These processes present several problems: chromosome mutations or loss can occur during the cryopreservation, thawing, and passage of hybridoma cells, leading to decreased or even ineffective monoclonal antibodies; hemolysis can occur during ascites fluid production due to individual mouse variations, affecting antibody quality; furthermore, long-term preservation of hybridoma cells is heavily reliant on liquid nitrogen, requiring constant replenishment and resulting in high storage costs. These issues, to some extent, limit the application of traditional monoclonal antibodies and hybridoma cell lines in immunoassay and detection. Summary of the Invention
[0005] To address the aforementioned technical problems, this invention provides an antigen-binding protein capable of specifically binding to vitamin K3 and its application. After extensive screening, an antigen-binding protein that specifically binds to VK3 was successfully obtained. This antigen-binding protein has a unique variable region sequence and is expected to be applied to the detection of vitamin K3.
[0006] The first objective of this invention is to provide an antigen-binding protein that specifically binds to vitamin K3, said antigen-binding protein comprising a heavy chain variable region and a light chain variable region, wherein:
[0007] The heavy chain variable region includes heavy chain complementarity-determining regions VH-CDR1, VH-CDR2 and VH-CDR3, with amino acid sequences shown in SEQ ID NO.1-3 or sequences with at least 90% homology to them.
[0008] The light chain variable region includes light chain complementarity-determining regions VL-CDR1, VL-CDR2, and VL-CDR3, with amino acid sequences shown in SEQ ID NO.4-6 or sequences with at least 90% homology to them.
[0009] Furthermore, the antigen-binding protein may be an antibody or its antigen-binding fragment.
[0010] Furthermore, the variable region of the heavy chain of the antigen-binding protein includes frame regions VH-FR1, VH-FR2, VH-FR3, and VH-FR4, with complementary determinant regions (CDRs) between adjacent frame regions; that is, VH-CDR1, VH-CDR2, and VH-CDR3 are separated by frame regions VH-FR1, VH-FR2, VH-FR3, and VH-FR4. Therefore, VH-FR1, VH-CDR1, VH-FR2, VH-CDR2, VH-FR3, VH-CDR3, and VH-FR4 are sequentially arranged on the variable region of the heavy chain of the antigen-binding protein.
[0011] Furthermore, the heavy chain variable region of the antigen-binding protein includes framework regions VH-FR1, VH-FR2, VH-FR3 and VH-FR4, with amino acid sequences shown in SEQ ID NO.7-10 or sequences with at least 90% homology to them.
[0012] Furthermore, the variable region of the light chain of the antigen-binding protein includes frame regions VL-FR1, VL-FR2, VL-FR3, and VL-FR4, with complementary determinant regions (CDRs) between adjacent frame regions; that is, VL-CDR1, VL-CDR2, and VL-CDR3 are separated by frame regions VL-FR1, VL-FR2, VL-FR3, and VL-FR4. Therefore, VL-FR1, VL-CDR1, VL-FR2, VL-CDR2, VL-FR3, VL-CDR3, and VL-FR4 are sequentially arranged on the variable region of the light chain of the antigen-binding protein.
[0013] Furthermore, the light chain variable region of the antigen-binding protein includes framework regions VL-FR1, VL-FR2, VL-FR3 and VL-FR4, with amino acid sequences shown in SEQ ID NO.11-14 or sequences with at least 90% homology to them.
[0014] Furthermore, the antigen-binding protein includes a constant region.
[0015] Furthermore, the species source of the constant region is cattle, horses, dairy cows, pigs, sheep, goats, rats, mice, dogs, cats, rabbits, donkeys, deer, mink, chickens, ducks, geese, or humans.
[0016] Furthermore, the constant region is selected from one of mouse IgG1, IgG2a, IgG2b, IgG3 or human IgG1, IgG2, IgG3, IgG4, IgM.
[0017] Furthermore, the amino acid sequence of the heavy chain constant region of the antigen-binding protein is shown in SEQ ID NO.15, and the amino acid sequence of the light chain constant region is shown in SEQ ID NO.16.
[0018] A second objective of this invention is to provide a nucleic acid molecule encoding the aforementioned antigen-binding protein.
[0019] Furthermore, nucleic acid molecules are either DNA or RNA.
[0020] A third objective of this invention is to provide an expression vector containing the aforementioned nucleic acid molecules.
[0021] Furthermore, the expression vector can be a viral vector or a non-viral vector, such as DNA, RNA, viral vectors (e.g., lentivirus, adenovirus, AAV virus, retrovirus or combinations thereof), plasmids, transposons, other gene transfer systems, liposome nanoparticles, etc.
[0022] A fourth objective of the present invention is to provide a host cell containing the above-described antigen-binding protein, the above-described nucleic acid molecule, or the above-described expression vector.
[0023] Furthermore, the host cell can be a prokaryotic or eukaryotic cell, such as plant cells, animal cells, microorganisms, etc. Preferably, the host cell is one of the following: Chinese hamster ovary (CHO) cells, human embryonic kidney cells (HEK293), HeLa cells, young hamster kidney cells, NSO mouse myeloma cells, or other mammalian cells.
[0024] A fifth object of the present invention is to provide a kit comprising the above-described antigen-binding protein, the above-described nucleic acid molecule, the above-described expression vector, or the above-described host cell.
[0025] A sixth object of the present invention is to provide the application of the above-mentioned antigen-binding protein, the above-mentioned nucleic acid molecule, the above-mentioned expression vector, the above-mentioned host cell, or the above-mentioned kit in the detection of vitamin K3.
[0026] The beneficial effects of this invention are:
[0027] The antigen-binding protein provided by this invention has a unique variable region sequence, exhibiting high affinity and specificity for vitamin K3 antigen. When applied to the detection of vitamin K3, its sensitivity (IC50) is high. 50 The concentration reached 0.51 ng / mL, and the limit of detection (IC50) was [missing value]. 10 With a concentration of 0.21 ng / mL, a rapid immunoassay method with better stability and higher consistency was established, showing broad application prospects. This invention is based on recombinant antibody technology, which has good reproducibility and high batch-to-batch consistency. It does not require the use of experimental animals and is expressed under serum-free conditions, avoiding contamination caused by serum components. Attached Figure Description
[0028] To make the content of this invention easier to understand, the invention will be further described in detail below with reference to specific embodiments and accompanying drawings, wherein...
[0029] Figure 1 This is an agarose gel electrophoresis image of the antibody variable region gene obtained by PCR amplification in Example 1 of this invention;
[0030] Figure 2 This is an SDS-PAGE protein electrophoresis image of the recombinant antibody in Example 3 of this invention;
[0031] Figure 3 This is the ic-ELISA standard curve of vitamin K3 by the recombinant anti-vitamin K3 antibody in Example 4 of the present invention (concentrations from low to high are 0, 0.05, 0.1, 0.2, 0.5, 1, 2, 5 ng / mL). Detailed Implementation
[0032] The present invention will be further described below with reference to the accompanying drawings and specific embodiments, so that those skilled in the art can better understand and implement the present invention. However, the embodiments described are not intended to limit the present invention.
[0033] In this invention, the term "specific binding" generally refers to the binding of an antibody to an epitope via its antigen-binding domain, and this binding requires some complementarity between the antigen-binding domain and the epitope. According to this definition, an antibody is said to "specifically bind" to an epitope when it is more likely to bind to the epitope via its antigen-binding domain than to a random, unrelated epitope to which it would bind.
[0034] In this invention, the terms "isolated" or "purified" generally refer to molecules (e.g., antibodies, nucleic acids, etc.) that are at least partially isolated from other molecules that are normally bound to them in their natural state. "Isolated or purified polypeptides" or "isolated or purified nucleic acids" are essentially free of other biomolecules such as nucleic acids, proteins, lipids, carbohydrates, cell debris, and growth media.
[0035] In this invention, the term "antigen-binding protein" is used broadly and refers to a protein comprising a portion that binds to an antigen or target and optionally comprising a framework or frame portion that allows the antigen-binding portion to adopt a configuration that promotes antigen-binding protein binding to an antigen. Examples of antigen-binding proteins include human antibodies, humanized antibodies; chimeric antibodies; recombinant antibodies; single-chain antibodies; bifunctional antibodies; trifunctional antibodies; tetrafunctional antibodies; Fab fragments; F(ab')2 fragments; IgD antibodies; IgE antibodies; IgM antibodies; IgG1 antibodies; IgG2 antibodies; IgG3 antibodies; or IgG4 antibodies and fragments thereof. Antigen-binding proteins may include, for example, chimeric antigen receptors having a transplanted CDR or CDR derivative, alternative protein frameworks, or artificial frameworks. Such frameworks include, but are not limited to: antibody-derived frameworks containing mutations introduced to, for example, stabilize the three-dimensional structure of the antigen-binding protein; and fully synthetic frameworks containing, for example, biocompatible polymers.
[0036] In this invention, the term "antibody" is used in the broadest sense and specifically covers, but is not limited to, monoclonal antibodies (including full-length monoclonal antibodies comprising two light chains and two heavy chains), polyclonal antibodies, multispecific antibodies (e.g., bispecific antibodies), humanized antibodies, fully human antibodies, chimeric antibodies, heavy chain antibodies, and camelified single-domain antibodies (e.g., heavy chain variable domain antibodies). Antibodies typically have the structure of immunoglobulins and may comprise proteins, or antigen-binding fragments thereof, containing at least two heavy chains (HC) and two light chains (LC) linked together by disulfide bonds. Each heavy chain comprises a heavy chain variable region (VH) and a heavy chain constant region. The amino acid composition and sequence of the immunoglobulin heavy chain constant regions differ, thus their antigenicity also differs. Accordingly, immunoglobulins can be classified into five classes, or isotypes of immunoglobulins, namely IgM, IgD, IgG, IgA, and IgE, with their corresponding heavy chains being μ, δ, γ, α, and ε chains, respectively. Based on differences in the amino acid composition of their hinge region and the number and position of disulfide bonds in their heavy chain, Ig can be further divided into different subclasses. For example, IgG can be divided into IgG1, IgG2, IgG3, and IgG4. Light chains are classified as κ chains or λ chains based on differences in their constant regions. Each of the five classes of Ig can have either a κ chain or a λ chain.
[0037] In this invention, the term "variable" generally refers to the strong variation in certain portions of the sequence of the variable domain of an antibody, which contributes to the binding and specificity of a particular antibody to its specific antigen. However, variability is not uniformly distributed throughout the entire variable region of the antibody. It is concentrated in three segments within the variable regions of the light and heavy chains, referred to as complementarity-determining regions (CDRs) or hypervariable regions (HVRs). The more highly conserved portions of the variable domain are referred to as frames (FRs). The variable domains of the natural heavy and light chains each contain four FR regions, mostly in a β-sheet configuration, linked by three CDRs to form loops, and in some cases forming part of a β-sheet structure. The CDRs in each chain are closely clustered together by the FR regions and, together with CDRs from the other chain, form the antigen-binding site of the antibody. Constant regions do not directly participate in antibody-antigen binding. In the art, antibody CDRs can be defined using various methods, such as the Kabat definition rule, the Chothia definition rule, or the IMGT definition rule based on sequence variability.
[0038] The amino acid sequence information involved in this invention is as follows:
[0039]
[0040] Example 1: Isolation and identification of the variable region gene of anti-vitamin K3 monoclonal antibody
[0041] Hybridoma cell lines producing anti-vitamin K3 monoclonal antibodies were revived and cultured in culture flasks. After expansion, 5-10 × 10⁶ cells were collected. 6 For each cell, add 1 mL of Trizol reagent, mix thoroughly by pipetting, and lyse. Add 200 μL of chloroform to the lysis buffer, shake for 15 s to obtain an emulsion, incubate at 4 °C for 5 min, and centrifuge at 12000 g for 15 min. Take 450 μL of the colorless aqueous phase, add an equal volume of pre-cooled isopropanol, mix by inverting, incubate at 4 °C for 10 min, and centrifuge at 12000 g for 10 min. Discard the supernatant, wash the precipitate with 1 mL of 75% ethanol, centrifuge at 12000 g for 10 min, discard the supernatant, resuspend the precipitate in 100 μL of RNase-free water, and store at -80 °C.
[0042] Using RNA as a template, SMARTer ® The RACE 5' / 3' Kit (purchased from Takara) is used for first-strand cDNA synthesis and rapid amplification of cDNA ends, respectively. The heavy and light chains of the antibody correspond to different gene-specific primers, named H-5'GSP and L-5'GSP, respectively. The sequence of H-5'GSP is GATTACGCCAAGCTTCTCAATTTTCTTGTCCACCTTGGTGC, and the sequence of L-5'GSP is GATTACGCCAAGCTTCTCATTCCTGTTGAAGCTCTTGACAATGGG. Figure 1 As shown, agarose gel electrophoresis yields bright target bands, which contain VH and VL gene fragments, respectively.
[0043] The target gene was purified to 20 μL using a gel extraction kit. The purified product was cloned into a linearized pRACE plasmid using in-fusion and transformed into Stellar competent cells. The cells were then plated on LB agar (containing ampicillin). The next day, 6-8 single colonies of each of VH and VL were collected, expanded, and sent to a gene sequencing company for sequencing using universal M13-F / R primers. The sequenced gene sequences were imported into the Kabat antibody database for alignment analysis to identify the VH and VL genes, as well as the CDR and backbone regions. The VH gene sequence was 351 bp long, preceded by a 65 bp signal peptide; the VL gene sequence was 327 bp long, preceded by a 66 bp signal peptide.
[0044] Example 2: Construction of recombinant antibody expression plasmid
[0045] Based on the heavy and light chain variable region genes of the anti-vitamin K3 monoclonal antibody obtained from sequencing, specific primers were designed. Using the pRACE heavy and light chain plasmid as a template, the heavy and light chain variable region genes were amplified by PCR and homologously recombined into the pcDNA3.4 backbone plasmid containing the heavy and light chain constant regions, respectively, to obtain recombinant antibody expression plasmids containing the full-length heavy and light chain genes. The heavy and light chain expression plasmids were transformed into Top 10 competent cells, and single colonies were picked and sequenced to verify the sequence accuracy. The single colonies corresponding to the correctly sequenced heavy and light chain expression plasmids were taken, expanded, and the heavy and light chain expression plasmids were extracted using an endotoxin-free plasmid extraction kit.
[0046] Example 3: Expression and purification of recombinant antibodies
[0047] Take a tube of HEK293F suspended cells from the liquid nitrogen tank; cell count ≥10-1 7 Each sample was rapidly thawed in a 37°C water bath and transferred to 30 mL of preheated culture medium. It was then cultured in 125 mL shake flasks until a final density of approximately 0.3 × 10⁻⁶ was achieved. 6 Cells / mL, cultured on SMM-93TII medium from Sinocare. Incubator conditions were set as follows: 37℃, 125 rpm, 5% CO2, humidity >80%, cultured for 3-4 days. Cells grew to 3 × 10⁶ cells / mL. 6 Cells / mL, viability greater than 95%, continue passage twice to ensure doubling time of about 24 hours, and use as seed cells.
[0048] The day before transfection, administer 1.5 × 10 6 HEK293F cells were seeded at a density of 120 mL in a 500 mL shake flask. The cells grew to 3 × 10⁶ cells / mL the following day. 6 Cell transfection was initiated when the cell count reached 100 cells / mL and cell viability was >5%. The total amount of heavy and light chain expression plasmids used was 4 μg per mL of culture volume, with a heavy-to-light chain ratio of 1:1.5. PEI was used as the transfection reagent, with the amount of PEI being 2.5 times the amount of plasmid. The plasmid and PEI were thoroughly mixed in fresh culture medium and incubated at room temperature for 15-20 minutes. The mixture was then slowly added to a shake flask, followed by dilution with an appropriate amount of fresh culture medium to a final cell density of 2 × 10⁶ cells / mL. 6 Cells / mL, return to shake incubator for further culture. Add 3.5% culture volume of feed solution 20-24 hours after transfection, and continue adding 3.5% culture volume of feed solution on days 3 and 5 post-transfection. Harvest the cell culture supernatant on day 7 post-transfection or when cell viability is <60%.
[0049] Cell culture supernatant was collected by high-speed centrifugation to remove cells and cell debris. The supernatant was filtered through a 0.45 μm filter and then purified using a Protein G affinity chromatography column. The antibody was dialyzed into 0.01 M PBS buffer and stored at -20°C. A small amount of antibody was tested by reducing SDS-PAGE electrophoresis for verification. Figure 2 As shown, there are two protein bands, one of which is a heavy chain with a molecular weight of about 50 kDa, and the other is a light chain with a molecular weight of about 25 kDa.
[0050] Example 4: Performance testing of recombinant antibodies
[0051] The recombinant antibody was applied to the ic-ELISA detection of vitamin K3. The specific steps are as follows: The coated original VK3-BSA was diluted to 0.3 μg / mL with 0.05 M carbonate buffer (pH 9.6), and 100 μL / well was added to a 96-well microplate and incubated at 37°C for 2 h; washed three times with PBST washing buffer for 3 min each time; 200 μL / well blocking buffer was added and incubated at 37°C for 2 h; serially diluted VK3 standard (50 μL / well) and recombinant antibody (0.3 μg / mL, 50 μL / well) were added and incubated at 37°C for 30 min; after washing, HRP goat anti-mouse IgG (100 μL / well) was added and incubated at 37°C for 30 min; after washing, TMB substrate solution (100 μL / well) was added and reacted at 37°C for 15 min; stop solution (50 μL / well) was added to stop the reaction, and the absorbance at 450 nm was measured using a microplate reader.
[0052] The standard curve of recombinant antibody inhibition of vitamin K3 is as follows: Figure 3 As shown, its sensitivity (IC) 50 The concentration was 0.51 ng / mL, and the limit of detection (IC50) was 0.51 ng 10 The concentration was 0.21 ng / mL, indicating that the recombinant antibody has good sensitivity to vitamin K3.
[0053] Obviously, the above embodiments are merely illustrative examples for clear explanation and are not intended to limit the implementation. Those skilled in the art will recognize that other variations or modifications can be made based on the above description. It is neither necessary nor possible to exhaustively list all possible implementations here. However, obvious variations or modifications derived therefrom are still within the scope of protection of this invention.
Claims
1. An antibody that specifically binds to vitamin K3, characterized in that, The antibody comprises a heavy chain variable region and a light chain variable region, wherein: The heavy chain variable region includes heavy chain complementarity-determining regions VH-CDR1, VH-CDR2 and VH-CDR3, with amino acid sequences shown in SEQ ID NO.1-3, respectively. The light chain variable region includes light chain complementarity-determining regions VL-CDR1, VL-CDR2, and VL-CDR3, with amino acid sequences shown in SEQ ID NO.4-6, respectively.
2. The antibody according to claim 1, characterized in that: The heavy chain variable region of the antibody includes framework regions VH-FR1, VH-FR2, VH-FR3 and VH-FR4, with amino acid sequences shown in SEQ ID NO.7-10, respectively.
3. The antibody according to claim 1, characterized in that: The variable region of the light chain of the antibody includes framework regions VL-FR1, VL-FR2, VL-FR3 and VL-FR4, with amino acid sequences shown in SEQ ID NO.11-14.
4. The antibody according to claim 1, characterized in that: The antibody includes a constant region.
5. The antibody according to claim 4, characterized in that: The amino acid sequence of the heavy chain constant region of the antibody is shown in SEQ ID NO.15, and the amino acid sequence of the light chain constant region is shown in SEQ ID NO.
16.
6. A nucleic acid molecule encoding the antibody of any one of claims 1-5.
7. An expression vector containing the nucleic acid molecule of claim 6.
8. A host cell containing any of the antibodies of claims 1-5, the nucleic acid molecule of claim 6, or the expression vector of claim 7.
9. A reagent kit, characterized in that: The kit contains any of the antibodies described in claims 1-5, or the nucleic acid molecule described in claim 6.
10. The use of the antibody according to any one of claims 1-5, the nucleic acid molecule according to claim 6, the expression vector according to claim 7, the host cell according to claim 8, or the kit according to claim 9 in the detection of vitamin K3, characterized in that, The application described is for non-diagnostic purposes.
Citation Information
Patent Citations
Vitamin K3 monoclonal antibody hybridoma cell strain and application thereof
CN113046325A
Antigen binding protein specifically binding to 25-hydroxyvitamin D3
CN117417455A