SNP locus combination, primers and methods for identification of small fragrant chicken breeds in Southeast Guizhou

Abstract

The present invention discloses a SNP site combination, primer and method for the identification of Qiandongnan small fragrant chicken varieties. The SNP site combination includes QDNX1 site to QDNX7 site. When the SNP site combination provided by the present invention is used for the identification of Qiandongnan small fragrant chicken varieties, as long as one SNP site genotype does not conform to the corresponding genotype of Qiandongnan small fragrant chicken, the individual can be completely excluded from belonging to Qiandongnan small fragrant chicken; the probability of all 7 SNP sites combined genotypes being judged as Qiandongnan small fragrant chicken is 100%. This method is simple to operate, has high accuracy, and can effectively combat counterfeit Qiandongnan small fragrant chicken products on the market.

Description

Technical Field

[0001] The invention relates to a poultry variety identification method, and in particular to a SNP site combination, primers and a method for identifying a variety of Qiandongnan small fragrant chicken. Background Art

[0002] Qiandongnan Small Fragrant Chicken is a small broiler chicken. It has black skin, tender meat, delicious meat, and a strong aroma when cooked. According to measurements, the protein content of chicken is as high as 25.34%, and the fat content is only 0.71%. It is rich in a variety of essential amino acids and trace elements for the human body. It is a high-protein, low-fat, nutritious health food with high medicinal value and health care effects. It is a good tonic for postpartum women and people with physical weakness, and is deeply loved by consumers.

[0003] Currently, the method for identifying the authenticity of Qiandongnan Small Fragrant Chicken on the market mainly relies on appearance observation. This observation is highly subjective and there is no scientific identification standard. Especially when identifying the hybrid offspring of Qiandongnan Small Fragrant Chicken and other breeds of chicken, due to their similar appearance, the identification error rate is relatively high.

[0004] Single nucleotide polymorphism (SNP) has the characteristics of large number, wide distribution, rich polymorphism, high genetic stability, representativeness, convenient and fast detection. Using the SNP sites with large breed differences in genomic DNA, the breed identification is performed through the genotypes of different site combinations, and the identification results are more objective and accurate. In view of this, using the combination of SNP sites, a method that can effectively and accurately identify the Qiandongnan Small Fragrant Chicken breed is developed, which is of great significance for the application in the Qiandongnan Small Fragrant Chicken breed identification work. Summary of the invention

[0005] In view of the difficulty in identifying the variety of Qiandongnan small fragrant chicken, the present invention provides a SNP site combination, primers and method for identifying the variety of Qiandongnan small fragrant chicken, which jointly determines whether the individual to be tested belongs to Qiandongnan small fragrant chicken by detecting the genotype of the 7 SNP sites of the provided Qiandongnan small fragrant chicken. The method is simple to operate and has high accuracy. It can accurately identify the variety of Qiandongnan small fragrant chicken and effectively combat the counterfeit and inferior products of the local variety of Qiandongnan small fragrant chicken on the market.

[0006] In order to achieve the above object, the present invention provides a SNP locus combination for the identification of Qiandongnan small fragrant chicken varieties, the SNP locus combination includes QDNX1 locus to QDNX7 locus:

[0007] SNP site number chromosome Location on chromosome SNP site ID Reference genome Mutation site QDNX1 NC_006088.5 chr1:39937195 rs314532058 T C QDNX2 NC_006089.5 chr2:132962450 rs313502535 C T QDNX3 NC_006090.5 chr3:52189265 rs15357089 T G QDNX4 NC_006094.5 chr7:12840943 rs13743510 G A QDNX5 NC_006095.5 chr8:4588485 rs14636015 C T QDNX6 NC_006096.5 chr9:8974630 rs315866297 G C QDNX7 NC_006096.5 chr9:6587595 rs317368689 C T

[0008] The sequences of the primers for each SNP site are:

[0009]

[0010] The screening method of the SNP loci is as follows: using the 55K Jingxin No. 1 chip optimized in 2023 (redesigned with reference to the Gallus_gallus 6 genome, Beijing Compson Biotechnology Co., Ltd.) to screen and determine 55,000 SNP loci of 12 chicken breeds (Southeast Guizhou Small Fragrant Chicken, Silky Black-Bone Chicken, Jinhu Black-Bone Chicken, Wumeng Black-Bone Chicken, Xingwen Black-Bone Chicken, Zhuxiang Chicken, Wumeng Phoenix Chicken and other domestic representative black-bone chicken breeds, Weining Chicken, Bantam Chicken, Tall Chicken and other non-black-bone chicken breeds, as well as representative Hubbard broiler and Leghorn chicken breeds introduced from abroad for hybrid matching), and comparing each breed with other breeds, taking the set of loci with the largest difference, and the genetic differentiation index between populations is top 5%, the minimum allele frequency>0.4, and the missing rate<0.2 were screened to determine 220 SNP sites, and the allele frequency of the reference genome sites of Qiandongnan Small Fragrant Chicken was preferentially selected as 1 or 0, and then the mean of the different allele frequencies of each site of the other 11 varieties was determined, and then the mean was compared with the different allele frequencies of each site of Qiandongnan Small Fragrant Chicken to screen SNP sites with large differences in allele frequencies. The allele frequencies of other groups were close to 0 or close to 1, and finally 7 SNP sites for the identification of Qiandongnan Small Fragrant Chicken varieties were determined.

[0011] Another aspect of the present invention provides a method for identifying a variety of Qiandongnan small fragrant chicken, the identification method comprising the following steps:

[0012] (1) Extracting the total genomic DNA of the chicken to be tested;

[0013] (2) According to the SNP site combination, PCR amplification is performed using the corresponding primer combination;

[0014] (3) Sequencing the PCR amplification product and determining the genotype;

[0015] (4) If one of the genotypes corresponding to the SNP site combination does not match the genotype corresponding to the Qiandongnan Small Fragrant Chicken, the individual is judged not to belong to the Qiandongnan Small Fragrant Chicken; if the genotypes corresponding to the seven SNP site combinations all match the genotypes of the Qiandongnan Small Fragrant Chicken, the individual is judged to belong to the Qiandongnan Small Fragrant Chicken, and the genotypes of the seven SNP sites QDNX1~QDNX7 are TT, CC, TT, GG, CC, GG, CC, respectively.

[0016] Preferably, the genomic DNA of the chicken to be tested in step (1) is obtained by sampling blood from the wing vein of an individual of the chicken species.

[0017] Specifically, in step (2), the lengths of the PCR products of QDNX1 to QDNX7 are 249 bp, 178 bp, 228 bp, 232 bp, 212 bp, 213 bp, and 224 bp, respectively. The corresponding PCR product information is as follows:

[0018] QDNX1--249bp (SNP site: T / C at 70bp)

[0019] GGATCCTCCCTGAAGCATAAGAAAAACCTTTATGTCTCTGGTGGAGCTGAATAGAGTCTAAGGCTGCATK(T / C)TTCTTTTACAGCTAAGCTTCAGATTCAAACTTATTTGGCCTTGTCAGAAAAT AAATGCCTATTAAATGTTGTCAATCATTTTCTGGACAGTCATCCACCCACATTATCTCCAAGAAGCTGAAATTTTACATACATAACATGGATTAACCCTTGCAGCCTTTGAAACAGACAGCAGGGTG

[0020] QDNX2--178bp (SNP site: C / T at 38bp)

[0021] TGTGGTGGTACACAGGAAAAAACAAATCTGAGCTAATAK(C / T)ACTGAAACAGAAAACTGTTATCTGTGATCTGTGTCTATAAAATCTAATCAGCATCACTTCAGTTCTGAATATTTACCAGAAAAAAGGTATCAACATAATATGAATATTACCCAGCCTGCTTTGAGGGGTTTGGATCTCTG

[0022] QDNX3--228bp (SNP site: T / G at 145bp)

[0023] GCCAGCAAGCTTAGAGACTGAAATTTGGAAGTTAATTGAATAGCATTTTCTTTAGCCTCCAACTATCAGCTCCTTAAGTTCATTAGCTGAATTTAAGGAATTAGGTTCTATCATACTTAACTCACTGGGAGAACTAACAGAAATK(T / G)TGCAGGCTTTAGAAGCTGTTTGTGGTATGTTTGTACCTGTGGGTTACTGCTCCTGTGACAGCAGATGTGTGCTGCTGCAGAGT

[0024] QDNX4 - 232 bp (SNP locus: G / A at 172 bp)

[0025] CTTCAAACTCCCCGTCTCTGTCCAATGAGTTCATACTTTAATTTTTCTTAAAGTTTCATTAAAGGTAACCACAAGGCCTGAATGCAATCTACCACAGTAATTCTTAGACATTAAATAAGAAGAAAATAAGCTATAATCTATCTACATCCTTAACACCTCCCAAGATTCTACK(G / A)GTTAGGCTACCTACGAATTCCTCAGAATTTCTCCTTTTTTCTTCCCGGAGTTTCTCTCCT

[0026] QDNX5 - 212 bp (SNP locus: C / T at 176 bp)

[0027] TTTTGGTTGGTGGGTTGAATGAAGAAACCAGGGTGTGGTTTGTATGTTTTATGGTGCAATTGAGTTCAGATTGGAGCTTACGTTTTGGTGGTTTTAAGGATTTGCTGCTAAATAATTCCTAATAATACAGCTGTTTAGTTTTAAATGCTTCAAATTGCCTCTGACTTTTCGCTGTK(C / T)GTTCTGCCTTTCAGGATTCAGTGGTGCAGTGTGTCA

[0028] QDNX6 - 213 bp (SNP locus: G / C at 160 bp)

[0029] TCTCTCTCAAGTCGGCAGTGGCCGTCCAACGTCAGGCACGGGTGCCACGCGGCCGGACCGTGCAGCAGCAGCAGGCGGGAAAGTGTTTACTGCCCAACCCGTCACGGTGCCAGCGGCTGTCAGAGGGCCGAGTCTGAGGGTTCTGCAAACAACCTATTTK(G / C)ACCAGCAGGCTTTGTCCACAGCCGCTGTCCTTTCTTTTTACAGCGGGATCCCT

[0030] QDNX7 - 224 bp (SNP locus: C / T at 195 bp)

[0031] GATCATTCAAGCTGGCACAAGATATTTATGATTCTGGCAACTAGATTCTAGTTAAAATTTGATGGATGAAACTCTACCACACTTCCCTAGGTAACAAAATGCCAATATAGCAGATATTTTTGAGTAAGAGTTAAGGTTGTTGAAGACCCTGGATGAATGATGAAAACTGAAGGCTGCTTCATCAACCAAACTGK(C / T)TGTATTTCAACTGCCCTATCAAACCATGC

[0032] Through the above technical solution, the present invention achieves the following beneficial effects:

[0033] When the SNP locus combination provided by the present invention is used to identify the Qiandongnan Small Fragrant Chicken variety, as long as one SNP locus genotype does not conform to the corresponding genotype of the Qiandongnan Small Fragrant Chicken, the individual can be completely excluded from belonging to the Qiandongnan Small Fragrant Chicken; the probability of all 7 SNP loci combined genotypes being determined as the Qiandongnan Small Fragrant Chicken is 100%. This method is easy to operate and has high accuracy, and can effectively combat counterfeit Qiandongnan Small Fragrant Chicken products on the market. DETAILED DESCRIPTION

[0034] The specific implementation of the present invention is described in detail below in conjunction with the examples. It should be understood that the specific implementation described herein is only used to illustrate and explain the present invention, and is not used to limit the present invention.

[0035] Example 1: Screening of SNP sites

[0036] Using the 2023 optimized 55K Jingxin No. 1 chip (redesigned with reference to the Gallus_gallus 6 genome, Beijing Compson Biotechnology Co., Ltd.), 55,000 SNP sites of 12 chicken breeds (such as Qiandongnan Small Fragrant Chicken, Silky Black-bone Chicken, Wumeng Black-bone Chicken, Xingwen Black-bone Chicken, Zhuxiang Chicken, Jinhu Black-bone Chicken, Wumeng Phoenix Chicken and other representative domestic black-bone chicken breeds, Weining Chicken, Bantam Chicken, Tall Chicken and other non-black-bone chicken breeds, as well as representative foreign introduced Hubbard broiler and Leghorn chicken breeds for hybrid matching) were screened and determined. According to the comparison of each breed with other breeds, the set of sites with the largest difference was taken, and the genetic differentiation index between populations was top 5%, the minimum allele frequency>0.4, and the missing rate<0.2 were screened to determine 220 SNP sites, and the allele frequency of the reference genome sites of Qiandongnan Small Fragrant Chicken was preferentially selected as 1 or 0, and then the mean of the different allele frequencies of each site of the other 11 varieties was determined, and then the mean was compared with the different allele frequencies of each site of Qiandongnan Small Fragrant Chicken to screen SNP sites with large differences in allele frequencies. The allele frequencies of other groups were close to 0 or close to 1, and finally 7 SNP sites for the identification of Qiandongnan Small Fragrant Chicken varieties were determined.

[0037] The genotype frequencies of SNP loci in Qiandongnan Xiaoxiang Chicken and other breeds are as follows:

[0038]

[0039]

[0040] The information of 7 SNP sites is shown in the table below:

[0041] SNP site number chromosome Location on chromosome SNP site ID Reference genome Mutation site QDNX1 NC_006088.5 chr1:39937195 rs314532058 T C QDNX2 NC_006089.5 chr2:132962450 rs313502535 C T QDNX3 NC_006090.5 chr3:52189265 rs15357089 T G QDNX4 NC_006094.5 chr7:12840943 rs13743510 G A QDNX5 NC_006095.5 chr8:4588485 rs14636015 C T QDNX6 NC_006096.5 chr9:8974630 rs315866297 G C QDNX7 NC_006096.5 chr9:6587595 rs317368689 C T

[0042] According to the physical location of the 7 SNP sites, based on the red junglefowl reference genome sequence (Galgal6), the UCSC website https: / / genome-asia.ucsc.edu / cgi-bin / hgGateway?hgsid=791993043_MvNmFj6QPMRQsauOxQixq3gPtEUU was used to obtain the DNA sequences of the 7 SNP sites, and then Primer5.0 was used to design primers. The primer sequences, PCR product lengths and annealing temperatures of each SNP are shown in the following table:

[0043]

[0044]

[0045] Example 2: Identification of small fragrant chicken varieties in Southeast Guizhou

[0046] Thirty Qiandongnan small fragrant chickens, 30 Silky-bone chickens, 30 Wumeng Phoenix chickens, 30 Wumeng Silky-bone chickens, 30 Jinhu Wufeng chickens, and 30 Hubbard broilers preserved in the genetic material bank of poultry germplasm resources of Jiangsu Provincial Key Laboratory were randomly selected and marked. Blood was collected from the wing vein, and genomic DNA was extracted by phenol-chloroform method. Primers for a total of 7 SNP sites, QDNX1 to QDNX7, were selected for PCR amplification.

[0047] PCR total reaction system 50 μL: DNA template 2 μL, dNTP (2 mmol / L) 4 μL, Mg 2+ (3mmol·L -1 )0.6μL, 1×PCR reaction buffer 5μL, upstream and downstream primers (10μmol·L -1 ) 1 μL each, Taq polymerase (1U·μL -1 )2.5μL, add ultrapure water to 50μL.

[0048] PCR reaction program: 95℃ pre-denaturation for 5min; 94℃ denaturation for 30s, 55℃ annealing for 30s, 72℃ extension for 30s, 35 cycles in total; 72℃ extension for 5min. PCR amplified target fragments were detected by 1.5% agarose gel electrophoresis.

[0049] The PCR products were sent to a biological company for sequencing, and the sequences were simultaneously subjected to polymorphism detection and genotype determination. According to the sequencing results, 30 individuals with a combined genotype of 7 loci of TTCCTTGGCCGGCC were determined to be Qiandongnan Xiaoxiang Chicken, and the results were consistent with the markers. The remaining individuals did not fully conform to the TTCCTTGGCCGGCC genotype and were therefore determined to be non-Qiandongnan Xiaoxiang Chicken.

[0050] The preferred implementation modes of the present invention are described in detail above in combination with the embodiments; however, the present invention is not limited to the specific details in the above implementation modes. Within the technical concept of the present invention, a variety of simple modifications can be made to the technical scheme of the present invention, and these simple modifications all belong to the protection scope of the present invention.

[0051] It should also be noted that the various specific technical features described in the above specific embodiments can be combined in any suitable manner without contradiction. In order to avoid unnecessary repetition, the present invention will not further describe various possible combinations.

[0052] In addition, various embodiments of the present invention may be arbitrarily combined, and as long as they do not violate the concept of the present invention, they should also be regarded as the contents disclosed by the present invention.

Claims

1. A method for identifying the variety of small fragrant chicken in Southeast Guizhou, characterized in that: The steps include: (1) Extracting the total genomic DNA of the chicken to be tested; (2) According to the SNP site combination, PCR amplification is performed using the corresponding primer combination; The SNP locus combination includes QDNX1 locus to QDNX7 locus: QDNX1 is located at position 39937195 on chromosome 1 of NC_006088.5, which is a T or C polymorphic; QDNX2 is located at position 132962450 on chromosome 2 of NC_006089.5, which is a C or T polymorphic; QDNX3 is located at position 52189265 on chromosome 3 of NC_006090.5, which is T or G polymorphic; QDNX4 is located at position 12840943 on chromosome 7 of NC_006094.5, which is polymorphic to G or A; QDNX5 is located at position 4588485 on chromosome 8 of NC_006095.5, which is a C or T polymorphic; QDNX6 is located at position 8974630 on chromosome 9 of NC_006096.5, which is a G or C polymorphic; QDNX7 is located at position 6587595 on chromosome 9 of NC_006096.5, which is a C or T polymorphic; The nucleotide sequences of the primers for each SNP site are: QDNX1-F: 5'GGATCCTCCTGAAGCATAA3' QDNX1-R: 5'CACCCTGCTGTCTGTTTCAA3' QDNX2-F: 5'TGTGGTGGTACACAGGAAAA3' QDNX2-R: 5'CAGAGATCCAAACCCCTCAA3' QDNX3-F: 5'GCCAGCAAGCTTAGAGACTGA3' QDNX3-R: 5'ACTCTGCAGCAGCACACATC3' QDNX4-F: 5'CTTCAAACTCCCCGTCTCTG3' QDNX4-R: 5'AGGAGAGAAACTCCGGGAAG3' QDNX5-F: 5'TTTTGGTTGGTGGGTTGAAT3' QDNX5-R: 5'TGACACACTGCACCACTGAA3' QDNX6-F: 5'TCTCTCTCAAGTCGGCAGTG3' QDNX6-R: 5'AGGGATCCCGCTGTAAAAAG3' QDNX7-F: 5'GATCATTCAAGCTGGCACAA3' QDNX7-R: 5'GCATGGTTTGATAGGGCAGT3'; (3) Sequencing the PCR amplification product and determining the genotype; (4) If one of the genotypes corresponding to the SNP site combination does not match the genotype corresponding to the Qiandongnan Small Fragrant Chicken, the chicken to be tested is judged not to be a Qiandongnan Small Fragrant Chicken; if the genotypes corresponding to the seven SNP site combinations all match the genotypes of the Qiandongnan Small Fragrant Chicken, the chicken to be tested is judged to be a Qiandongnan Small Fragrant Chicken, and the genotypes of the seven SNP sites QDNX1~QDNX7 that match the Qiandongnan Small Fragrant Chicken are TT, CC, TT, GG, CC, GG, and CC, respectively.

2. The identification method according to claim 1, characterized in that: In step (1), the genomic DNA of the chicken to be tested is obtained by sampling blood from the wing vein of the individual chicken to be tested.

3. The identification method according to claim 1, characterized in that: In step (2), the lengths of the PCR products of QDNX1 to QDNX7 were 249 bp, 178 bp, 228 bp, 232 bp, 212 bp, 213 bp, and 224 bp, respectively.

Images