ORF7b gene-deficient feline infectious peritonitis attenuated virus and its construction method and application

Abstract

The present invention discloses an attenuated virus for feline infectious peritonitis with ORF7b gene deletion, a construction method and an application, and belongs to the field of vaccine technology. The present invention uses CRISPR / Cas9-mediated homologous recombination technology, and on the basis of a reverse genetic operation platform, the ORF7b region of plasmid pBAC-QS-79S is replaced with a Nanoluc sequence, and then the strain is rescued, thereby constructing an attenuated virus with ORF7b gene deletion. By measuring the growth characteristics, pathogenicity and immune protection effect of the strain, it is confirmed that the deletion of the ORF7b gene does not affect viral proliferation, but makes the strain lose pathogenicity; at the same time, the results of immune protection experiments show that 80% of cats in the immunized group survived one month after being exposed to strong strains by subcutaneous immunization with attenuated virus, confirming that the attenuated virus has an ideal protective effect on the strong strain of feline infectious peritonitis, and improves the clinical application value.

Description

Technical Field

[0001] The invention relates to the technical field of vaccines, in particular to an ORF7b gene-deficient feline infectious peritonitis attenuated virus and a construction method and application thereof. Background Art

[0002] Feline infectious peritonitis (FIP) is a disease that mainly occurs in cats and has a mortality rate of up to 100%. The main clinical symptoms include fever, pleural and abdominal effusion, lymphadenopathy, liver and kidney damage, etc. Feline infectious peritonitis virus (FIPV) is the pathogen of the disease and is a type of feline coronavirus. In addition, there is another type of feline enteric coronavirus (FECV), which mainly causes mild diarrhea symptoms, depending on the genotype and clinical symptoms.

[0003] At present, the specific pathogenic mechanism of FIP has not been studied clearly. Some researchers believe that FIPV is a mutation of FECV in cats, and this mutation process is closely related to the cat's own immune status, stress level, and living environment. The unclear pathogenic mechanism has led to a very slow development process for FIP vaccines. Currently, there is no commercial vaccine that can effectively prevent FIP ​​at home and abroad. Based on the above situation, it is urgent to develop an ideal vaccine that can prevent FIP.

[0004] Through the study of other types of coronavirus genomes, it was found that the deletion and mutation of open reading frames (ORF) may cause changes in the growth characteristics and toxicity of the strains; and there are two ORFs in the FIPV genome, namely ORF3 / 7. The present invention first constructed a deletion strain of ORF3abc / ORF7ab related genes, and then screened the rescue verification, safety and vaccination methods of a series of strains. Finally, it was found that the ORF7b gene deletion strain has good safety, and subcutaneous vaccination can stimulate the body to produce an ideal protective effect against strong strains. Summary of the invention

[0005] The purpose of the present invention is to provide an attenuated feline infectious peritonitis virus with a deleted ORF7b gene, a construction method and an application thereof, so as to solve the problems existing in the above-mentioned prior art. The deletion of the ORF7b gene of the attenuated virus does not affect the proliferation of the virus, but makes the strain lose its pathogenicity. By adopting a subcutaneous inoculation method, an ideal protective effect against a strong strain of feline infectious peritonitis virus can be produced. The virus has the potential to be used as an attenuated live vaccine, thereby improving the clinical application value.

[0006] To achieve the above object, the present invention provides the following solutions:

[0007] The present invention provides a method for constructing an ORF7b gene-deficient feline infectious peritonitis attenuated virus, comprising the following steps:

[0008] The ORF7b region of the plasmid pBAC-QS-79S was replaced with a reporter gene sequence, and then the feline infectious peritonitis virus was rescued to form an attenuated feline infectious peritonitis virus with a deletion of the ORF7b gene;

[0009] The plasmid pBAC-QS-79S is obtained by introducing the full-length genome sequence of the FIPV-QS strain into the BAC plasmid, and then replacing the Spike region with the Spike fragment of the FIPV-791146 strain;

[0010] The accession number of the full-length genome sequence of the FIPV-QS strain in GenBank is MW030108;

[0011] The sequence of the Spike region is shown in SEQ ID NO.1;

[0012] The Spike fragment of the FIPV-791146 strain is shown in SEQ ID NO.2.

[0013] Furthermore, the reporter gene sequence comprises a NanoLuc sequence; the NanoLuc sequence is shown in SEQ ID NO.3.

[0014] The present invention also provides the feline infectious peritonitis attenuated virus obtained by the construction method.

[0015] The present invention also provides application of the attenuated feline infectious peritonitis virus in preparing medicine for treating or preventing feline infectious peritonitis.

[0016] Further, the medicine includes a feline infectious peritonitis vaccine.

[0017] Furthermore, the feline infectious peritonitis vaccine comprises a live attenuated vaccine.

[0018] The present invention also provides a vaccine for preventing or treating feline infectious peritonitis, comprising the feline infectious peritonitis attenuated virus.

[0019] Furthermore, the vaccine is administered subcutaneously.

[0020] Furthermore, the inoculation concentration of the vaccine is 1×10 5 TCID 50 / mL.

[0021] Furthermore, vaccine adjuvants are also included.

[0022] The present invention discloses the following technical effects:

[0023] The present invention uses CRISPR / Cas9-mediated homologous recombination technology, and on the basis of a reverse genetic operation platform, replaces the ORF7b region of the plasmid pBAC-QS-79S with a Nanoluc sequence, and then rescues the strain to form an ORF7b gene-deleted attenuated virus. By measuring the growth characteristics, pathogenicity and immune protection effect of the strain, it is confirmed that the deletion of the ORF7b gene does not affect the proliferation of the virus, but makes the strain lose its pathogenicity; at the same time, the results of the immune protection experiment show that 80% of the cats in the immunized group survived one month after being exposed to the strong strain by subcutaneous immunization with the attenuated virus, which confirms that the attenuated virus has an ideal protective effect on the strong strain of feline infectious peritonitis, and has the potential to be used as an attenuated live vaccine, and improves the clinical application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0025] Figure 1 The results of the proliferation and safety evaluation of the ORF3ab / 3c deletion strain;

[0026] Figure 2 Figure 1 is a diagram of the construction strategy of the recombinant plasmid pBAC-QS-79S-Δ7b;

[0027] Figure 3 The indirect immunofluorescence results of the N protein of the deletion strain QS-79S-Δ7b are shown; the scale bar = 2000 μm;

[0028] Figure 4 To compare the in vitro growth characteristics of the deletion strains QS-79S-Δ7b and QS-79S;

[0029] Figure 5 To evaluate the safety of the deletion strain QS-79S-Δ7b;

[0030] Figure 6 The data of clinical index monitoring of cats after vaccination with live attenuated vaccine; left: weight change rate; right: survival rate;

[0031] Figure 7 Evaluation of the protective effect of live attenuated vaccine against the virulent strain QS-79S; Left: weight change rate; Right: survival rate;

[0032] Figure 8To investigate the effects of different vaccination methods on vaccine protection rate;

[0033] Figures 1 to 8 In the table, QS-79Δ7b represents the live attenuated vaccine group; QS-79 represents the QS-79S strong strain control group; SPSS represents the normal saline control group. DETAILED DESCRIPTION

[0034] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0035] It should be understood that the terms described in the present invention are only for describing a particular embodiment and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. The intermediate value in any stated value or stated range, and each smaller range between any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0036] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0037] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to those skilled in the art. The present invention description and examples are exemplary only.

[0038] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0039] In the following examples, the plasmid pBAC-QS-79S is derived from the team of Professor Peng Guiqing of Huazhong Agricultural University. The QS gene (GenBank: MW030108) is first constructed into a BAC vector to obtain a pBAC-QS plasmid containing the full genome of QS. Then, the Spike region (SEQ ID NO.1) is replaced with the Spike fragment (791146Spike, SEQ ID NO.2) of FIPV-791146 (GenBank: MW030109) by CRISPR / Cas9-mediated homologous recombination technology, and finally the pBAC-QS-79S plasmid is constructed. The relevant construction method is disclosed in the document “Wang G, Hu G, Liang R, Shi J, Qiu X, Yang Y, Jiao Z, Chen Y, Shen Z, Li M, Shi Y, Mao J, Peng G. Establishment of Full-Length cDNA Clones and an Efficient Oral Infection Model for Feline Coronavirus in Cats. J Virol. 2021 Oct 13; 95(21): e0074521. doi: 10.1128 / JVI.00745-21. Epub 2021 Aug 18. PMID: 34406859; PMCID: PMC8513462.”

[0040] All cells related to the experiment were purchased from the American Type Culture Collection (ATCC) and then adaptively cultured in Professor Peng Guiqing's laboratory (cells were cultured in an incubator at 37°C and 5% CO2 unless otherwise specified).

[0041] In the early stage of the present invention, strains related to different gene deletions such as ORF3ab / 3c / ORF7a / 7b were constructed, and rescue and safety experiments of related strains were carried out. The results confirmed that the deletion of ORF3ab gene was still lethal to cats; ORF3c was lethal to kittens (data see Figure 1 ); ORF7a is both safe and weakly toxic, but the protective effect as an attenuated vaccine is not ideal (protection rate is about 50%), so after completing the replacement and deletion of all open reading frames in the QS strain, ORF7b was selected as the final attenuated live vaccine construction site. The present invention aims to improve and optimize the attenuated vaccine to meet clinical needs, so the relevant embodiments only show the subsequent experimental scheme and optimization strategy of the ORF7b-deficient strain.

[0042] Example 1 Specific construction method of recombinant plasmid pBAC-QS-79S-Δ7b

[0043] The construction strategy of the recombinant plasmid pBAC-QS-79S-Δ7b is as follows Figure 2 As shown: Design specific sgRNA at both ends of ORF7b, and use CRISPR / Cas9-mediated homologous recombination technology to replace the ORF7b region with the Nanoluc sequence. The specific operation plan is as follows:

[0044] 1) Use http: / / crispr.dfci.harvard.edu / SSC / to design sgRNAs at both ends of ORF7b online, and fuse the designed forward and reverse sgRNAs (sgRNA-F and sgRNA-R), use T7 transcriptase to transcribe in vitro, then recover the product by CP and store it at -20°C for later use.

[0045] sgRNA-F1:5'-ATTGTCTGTAACTCTTGTAG-3' (SEQ ID NO.4);

[0046] sgRNA-F2:5'-CCGCTATGACGAGCCAACAA-3' (SEQ ID NO.5);

[0047] sgRNA-R: 5'-AAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTT GCTATTTCTAGCTCTAAAAC-3' (SEQ ID NO. 6).

[0048] 2) Prepare the enzyme digestion system to digest the pBAC-QS-79S plasmid for 5 h (Buffer 5 μL; plasmid 2 μg; sgRNA 1 μL each; Cas9 enzyme 2 μL; make up to 50 μL), and then recover the digestion product by CP.

[0049] 3) The recovered linearized pBAC-QS-79S plasmid was homologously recombined with the Nanoluc fragment with homology arms amplified by PCR at 37°C for 30 min (Buffer 2 μL; linearized BAC vector 50 ng; fragment 100 ng; ligase 1 μL; make up to 10 μL).

[0050] 4) The recombinant product obtained in step 3 was added to DH10B competent cells, heat-shocked at 42°C for 90s, ice-bathed for 3min, and 900μl of antibiotic-free LB was added; then grown in an incubator at 225rpm and 37°C for 1h; 900μl of supernatant was removed by centrifugation, and the bacteria were resuspended in 100μl of antibiotic-free LB and spread on a solid culture plate containing chloramphenicol resistance. The plate was inverted and cultured in a 37°C incubator for 16h, and a single colony was picked and added to 5mL of chloramphenicol-resistant LB liquid culture medium for expansion culture. After 12h, the recombinant plasmid pBAC-QS-79S-Δ7b was extracted (see the instructions for the Omega plasmid extraction kit for detailed operation procedures).

[0051] 5) Identification of recombinant plasmid: The recombinant pBAC-QS-79S-Δ7b plasmid was used as a template to amplify the Nanoluc fragment by PCR. The amplified product was then sent to Sangon Biotech Co., Ltd. for sequencing and compared with the original sequence. The results showed that the recombinant plasmid was successfully constructed. The Nanoluc nucleotide sequence is shown in SEQ ID NO.3.

[0052] Example 2 Detection of N protein expression of deletion strain QS-79S-Δ7b

[0053] By detecting the expression of FIPV strain N protein, it can be determined whether the virus can proliferate normally. The specific operation plan is as follows.

[0054] 1) The recombinant plasmid pBAC-QS-79S-Δ7b and the control plasmid pBAC-QS-79S were transfected into CRFK cells in a 6-well plate at a density of about 80% (for detailed transfection steps, see the jetPRIME manual).

[0055] 2) About 36h-48h after transfection, when the cells show 60% lesions, discard the culture medium and fix the cells with 4% paraformaldehyde for 30 min.

[0056] 3) Discard the paraformaldehyde, wash the cells three times with PBS, and then permeabilize them with PBS solution containing 0.1% TritonX-100 at room temperature for 15 minutes.

[0057] 4) Discard the permeabilization solution, wash three times with PBS, and incubate with blocking solution (PBS containing 5% BAS) at 37°C for 30 min.

[0058] 5) Discard the blocking solution, wash three times with PBS, add primary antibody, and incubate at 37°C for 1 h; discard the primary antibody, wash three times with PBS, add fluorescent secondary antibody, and incubate at 37°C for 1 h in the dark.

[0059] 6) Discard the fluorescent secondary antibody and wash three times with PBS; add DAPI and incubate at room temperature in the dark for 5 min. After washing three times with PBS, observe and take pictures using a fluorescence microscope.

[0060] The results are as follows Figure 3 , showing that after the deletion of the 7b gene, the N protein of the strain can be expressed normally, confirming that the 7b gene does not affect the normal proliferation of the deleted strain.

[0061] After the transfection in step 2) for more than 48 hours, the transfected cell plate was frozen and thawed once, and after centrifugation at 6000r / min for 10min, the supernatant was taken and packaged for use. When the CRFK cells grew to a density of about 8%, the supernatant collected from the transfection was inoculated into the CRFK cells, and when the cell lesion reached more than 80% (indicating that the recombinant virus was successfully rescued), the virus suspension was collected and frozen and thawed one to three times, and centrifuged at 6000r / min for 10min in a 4°C centrifuge. The supernatant was recorded as the first-generation virus, the first-generation virus obtained in the recombinant plasmid group was recorded as QS-79S-Δ7b, and the first-generation virus obtained in the control plasmid group was recorded as QS-79S, and the aliquots were stored at -80°C for use.

[0062] Example 3 Comparison of in vitro growth characteristics of deletion strains QS-79S-Δ7b and QS-79S

[0063] 1) Determination of the first-generation virus titer: The first-generation virus was diluted 10-fold in serum-free DMEM (8 dilutions, 8 replicates for each dilution), and the virus dilutions were added to the CRFK cells in a 96-well plate. After 36h-48h, the cytopathic effect was observed and recorded, and the virus titer was calculated according to the Reed-Muench method.

[0064] 2) CRFK cells in 48-well plates were infected with QS-79S-Δ7b and QS-79S viruses at an MOI of 0.01, respectively. After incubation for 1 h, the medium was changed and DMEM cell maintenance medium containing 2% FBS was added. The supernatant was collected every 12 h and stored at -80°C (4 replicates at each time point) until 48 h.

[0065] 3) The virus solution at different time points was frozen and thawed once, and then diluted 10-fold with serum-free DMEM (8 dilutions, 4 replicates for each dilution), and then the dilution was added to the 96-well CRFK cells. After 60 hours, the cytopathic effect of each well was observed and recorded, and the virus titer was calculated using the Reed-Muench method and the growth kinetic curve was drawn.

[0066] In order to identify the effect of 7b gene on the growth characteristics of FIPV strains, the present invention infected CRFK cells with QS-79S-Δ7b deletion strain and QS-79S strong strain, and drew the growth curve of the virus. The results are as follows: Figure 4The results showed that the virus titer of the QS-79S-Δ7b deletion strain was lower than that of the QS-79S strong strain at each time point, which indicates that the deletion of the 7b gene will cause a decrease in virus titer but will not affect the proliferation of the strain.

[0067] Example 4 Safety evaluation of the deletion strain QS-79S-Δ7b

[0068] In order to verify whether the deletion strain QS-79S-Δ7b can be used for subsequent immunization, the present invention designed the following scheme to evaluate the safety of the deletion strain.

[0069] 1) Before the infection, RT-PCR was used to analyze the infection status of each cat to pathogens such as feline coronavirus (FCoV), feline immunodeficiency virus (FIV), feline herpes virus (FHV) and feline leukemia virus (FeLV). Negative cats can be used for subsequent experiments. The three groups of cats were placed in separate cages in different rooms. During the experiment, a dedicated person fed cat food and drinking water twice a day and cleaned the cat litter box.

[0070] 2) Fifteen adult cats were randomly divided into three groups: QS-79S-Δ7b experimental group, QS-79S positive control group and SPSS saline negative control group, with 5 cats in each group.

[0071] 3) The QS-79S-Δ7b experimental group was orally inoculated with 1 mL of the deletion strain (QS-79S-Δ7b strain 1×10 5 TCID 50 / mL), and the QS-79S control group was orally administered with 1 mL of the strong strain (FIPV-79S strain 1×10 5 TCID 50 / mL), and the SPSS control group took 1mL of normal saline orally.

[0072] 4) The cats’ mental state, appetite, body temperature, weight and other indicators were recorded and scored daily. The death and elimination of cats were also recorded daily. The experiment was monitored continuously for 27 days.

[0073] The results are as follows Figure 5 As shown, at the end of the 28-day experiment, the survival rate of cats in the QS-79S-Δ7b experimental group and the SPSS negative control group was 100%, and the survival rate of the QS-79S control group was 0%, confirming that the 7b deletion strain has good safety.

[0074] Example 5 Vaccination regimen of live attenuated vaccine and clinical data monitoring during immunization

[0075] After confirming the safety of the strain, in order to verify the stimulating effect of the deletion strain on the body's immunity, the present invention designed the following vaccination plan and monitored the clinical data during the immune experiment.

[0076] 1) Before the virus attack, RT-PCR was used to analyze the infection status of each cat with pathogens such as feline coronavirus (FCoV), feline immunodeficiency virus (FIV), feline herpes virus (FHV) and feline leukemia virus (FeLV). Negative cats can be used for subsequent experiments. The two groups of cats were placed in separate cages in different rooms. During the experiment, a dedicated person fed cat food and drinking water twice a day and cleaned the cat litter box.

[0077] 2) Eighteen adult cats were randomly divided into two groups: 9 in the QS-79S-Δ7b experimental group and 9 in the SPSS control group.

[0078] 3) The QS-79S-Δ7b experimental group was subcutaneously inoculated with 1 mL of attenuated live vaccine (QS-79S-Δ7b strain 1×10 5 TCID 50 / mL), and the SPSS control group was subcutaneously inoculated with 1mL of normal saline, and immunized three times in succession, with an interval of 21 days between each immunization.

[0079] 4) Monitor the cats’ mental state, appetite, body temperature and weight daily, and record the cats’ deaths and elimination.

[0080] Immunization monitoring data such as Figure 6 As shown, due to the large number of monitoring indicators, this example only shows two important indicators, body weight and mortality rate. The results show that the body weight of both the experimental group and the control group increased slowly during the immunization process, and the cat survival rate was 100%, confirming that subcutaneous vaccination of the 7b deletion strain has ideal safety.

[0081] Example 6 Evaluation of the protective effect of attenuated live vaccines against virulent strains

[0082] To further verify whether the QS-79S-Δ7b live attenuated vaccine has an immune protection effect against the strong strain QS-79S, the immune protection effect will be evaluated after the immunization is completed. The specific test plan is as follows.

[0083] 1) The vaccinated cats in the QS-79S-Δ7b experimental group and the SPSS control group were used for subsequent immune protection effect evaluation experiments. Each cat was orally administered 1 mL of the strong strain (QS-79S1×10 5 TCID 50 / mL).

[0084] 2) The cats' mental state, appetite, body temperature and weight were recorded and scored daily, and the death and elimination of cats were recorded. 27 days after the challenge, 3 cats were randomly selected from each group for euthanasia, and tissues such as heart, liver, spleen, lung, kidney and mesenteric lymph nodes were collected for tissue toxicity, histopathology and immune factor detection.

[0085] The results are as follows Figure 7 As shown, due to too many detection indicators, this example only shows the weight change rate and mortality rate as reference indicators. After oral administration of the strong strain QS-79S, all cats in the SPSS control group died at 21 days; the cats in the QS-79S-Δ7b experimental group still had a survival rate of 77.8% at 27 days, confirming that the deletion strain can be used as a attenuated vaccine for three consecutive vaccinations to stimulate the body to produce an ideal protective effect against the strong strain QS-79S.

[0086] Example 7 Effects of different vaccination methods on vaccine protection

[0087] The original design of the present invention was to orally vaccinate the attenuated vaccine, but the results showed that the protection rate was low (see Figure 8 In order to improve the immune protection rate, under the premise of ensuring safety, the immunization method was screened, and finally subcutaneous inoculation was determined as the immunization method for the attenuated vaccine. The experimental results also confirmed that subcutaneous inoculation can provide the most ideal protection effect for the attenuated vaccine (see Figure 7 ).

[0088] In the oral vaccination trial, 5 cats were included in each of the SPSS control group and the QS-79S-Δ7b experimental group. 1 mL of live attenuated vaccine (QS-79S-Δ7b strain 1×10 5 TCID 50 / mL), and the SPSS control group took 1mL of normal saline orally; the rest of the test plan was completely consistent with the subcutaneous vaccination, please refer to Examples 5-6 for details.

[0089] The results are as follows Figure 8 As shown, oral immunization with the ORF7b gene-deficient vaccine can induce protection against strong strains, but the protection rate is too low. After screening, it was finally determined that the ORF7b gene-deficient live attenuated vaccine should be administered subcutaneously.

[0090] Spike fragment sequence (SEQ ID NO.1):

[0091]

[0092] Spike fragment sequence of FIPV-791146 (SEQ ID NO.2):

[0093]

[0094] NanoLuc sequence (SEQ ID NO.3):

[0095] ATGGTCTCACACTCGAAGATTTCGTTGGGGACTGGCGACAGACAGCCGGCTACAACCTGGACCAAGTCCTTGAACAGGGAGGTGTGTCCAGTTTGTTTCAGAATCTCGGGGTGTCCGTAACTCCGAT CCAAAGGATTGTCCTGAGCGGTGAAAATGGGCTGAAGATCGACATCCATGTCATCATCCCGTATGAAGGTCTGAGCGGCGACCAAATGGGCCAGATCGAAAAAATTTTTAAGGTGGTGTACCCTGTGGA TGATCATCACTTTAAGGTGATCCTGCACTATGGCACACTGGTAATCGACGGGGTTACGCCGAACATGATCGACTATTTCGGACGGCCGTATGAAGGCATCGCCGTGTTCGACGGCAAAAAGATCACTG TAACAGGGACCCTGTGGAACGGCAACAAAATTATCGACGAGCGCCTGATCAACCCCGACGGCTCCCTGCTGTTCCGAGTAACCATCAACGGAGTGACCGGCTGGCGGCTGTGCGAACGCATTCTGGCG.

[0096] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. An attenuated virus for preventing feline infectious peritonitis, characterized in that: The attenuated virus was inoculated subcutaneously; the inoculation concentration of the attenuated virus was 1×10 5 TCID 50 / mL; The method for constructing the attenuated virus comprises the following steps: The ORF7b region of the plasmid pBAC-QS-79S was replaced with a reporter gene sequence, and then the feline infectious peritonitis virus was rescued to form an attenuated feline infectious peritonitis virus with a deletion of the ORF7b gene; The plasmid pBAC-QS-79S is obtained by introducing the full-length genome sequence of the FIPV-QS strain into the BAC plasmid, and then replacing the Spike region with the Spike fragment of the FIPV-791146 strain; The accession number of the full-length genome sequence of the FIPV-QS strain in GenBank is MW030108; The sequence of the Spike region is shown in SEQ ID NO.1; The Spike fragment of the FIPV-791146 strain is shown in SEQ ID NO.2; The reporter gene sequence is a NanoLuc sequence; the NanoLuc sequence is shown in SEQ ID NO.

3.

2. Use of the attenuated virus as claimed in claim 1 in the preparation of a live attenuated vaccine for preventing feline infectious peritonitis.

3. A live attenuated vaccine for preventing feline infectious peritonitis, characterized in that: Comprising the attenuated virus according to claim 1.

4. The attenuated live vaccine according to claim 3, characterized in that Also included are vaccine adjuvants.

Images