A kind of high temperature and alkali resistant Haematococcus pluvialis and its screening method and application

Abstract

The present invention discloses a high temperature and alkali resistant Haematococcus pluvialis and a screening method and application, belonging to the field of bioengineering technology. The present invention isolates a strain of Haematococcus pluvialis H7 from a water sample, which was deposited in the General Microbiological Center (CGMCC) of the China Microbiological Culture Collection Committee on February 26, 2024, at the Institute of Microbiology, Chinese Academy of Sciences, Beijing, China, with a deposit number of CGMCC No.41186. The Haematococcus pluvialis identified by the present invention has the characteristics of high temperature resistance, alkali resistance, and high astaxanthin production, and the cultivation mode is simple and effective. When the temperature and pH range are 31-37°C and 11.5-12.0, respectively, the astaxanthin content of Haematococcus pluvialis H7 can reach up to 59.6-60.0 mg / g; therefore, the Haematococcus pluvialis screened out by the present invention can be cultured in large quantities outdoors, without artificially controlling the temperature and pH, which greatly saves the breeding cost.

Description

Technical Field

[0001] The invention relates to high temperature and alkali resistant Haematococcus pluvialis and a screening method and application thereof, belonging to the technical field of bioengineering. Background Art

[0002] Haematococcus pluvialis is a freshwater unicellular green algae belonging to the Chlorophyta, Volvoxales, Haematococcus family, Haematococcus genus. It is widely distributed in freshwater environments around the world. It has attracted much attention due to its unique biological characteristics, especially its ability to synthesize natural astaxanthin. Astaxanthin is mainly found in the red liposomes in the cells of Haematococcus pluvialis, and has strong antioxidant properties and great health benefits.

[0003] Astaxanthin, as a natural pigment, has a wide range of application value. It is widely used in food, health products and cosmetics. Astaxanthin can be used as a food additive to provide products with bright red or orange colors and increase their nutritional value. In addition, astaxanthin is also used as a key ingredient in anti-aging and whitening products and has important applications in the cosmetics field.

[0004] However, the traditional strains of Haematococcus pluvialis have strict requirements on the culture temperature and culture pH. Under normal circumstances, the optimum culture temperature of Haematococcus pluvialis is 20-28℃. Temperatures above 30℃ will inhibit the growth of Haematococcus pluvialis. The optimum culture pH is neutral to slightly alkaline. However, during the culture process, the pH of the solution will rise rapidly with the absorption and utilization of nutrients, and pH becomes a limiting factor for the growth of Haematococcus pluvialis. Therefore, in order to provide the most suitable culture conditions, most Haematococcus pluvialis are cultivated indoors. However, there are the following problems in indoor cultivation: first, the indoor culture space is limited, and Haematococcus pluvialis cannot be cultivated in large quantities; second, the light provided indoors cannot completely simulate sunlight, which will affect the synthesis of astaxanthin; third, indoor cultivation requires artificial temperature control, and light will increase the cost of cultivation. Therefore, the development of a high temperature and strong alkali resistant Haematococcus pluvialis strain has important research and production application value.

[0005] In response to this problem, the present invention provides a new strain of Haematococcus pluvialis. This strain has been screened and identified to be resistant to high temperatures and alkalis. This strain has a strong adaptability to high temperature and alkaline environments and can maintain a high astaxanthin yield and quality under these extreme conditions. At the same time, the application research based on this strain also provides a feasible solution for the production and application of astaxanthin.

[0006] By developing a strain of Haematococcus pluvialis that is resistant to high temperature and strong alkali, the yield and quality of astaxanthin can be improved and its application field can be broadened. This is of great significance to the development of related industries and market demand. The technical highlight of this invention is that it creatively proposes a strain of Haematococcus pluvialis that can still produce high astaxanthin under the characteristics of high temperature and strong alkali resistance through screening and identification, and reveals its application potential in the fields of food, health products and cosmetics. Summary of the invention

[0007] In order to solve the limitations of existing Haematococcus pluvialis in terms of high temperature resistance and strong alkali resistance, the present invention provides a high temperature and alkali-resistant Haematococcus pluvialis, the high temperature and alkali-resistant Haematococcus pluvialis is named H7, and was deposited in the General Microbiological Center of China Microorganism Culture Collection Committee (CGMCC) on February 26, 2024, with an address of No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, China, with a deposit number of CGMCC No.41186 and a classification name of Haematococcus pluvialis.

[0008] Preferably, the heat-resistant and alkali-resistant Haematococcus pluvialis can be cultured under high temperature of 32-37° C. and strong alkaline conditions of pH 11.5-12.

[0009] Preferably, the high temperature and alkali resistant Rhodococcus pluvialis H7 is screened and cultured using the screening medium and the expansion medium.

[0010] The screening culture medium comprises: each ton of culture medium contains: 600g sodium nitrate, 80g magnesium sulfate heptahydrate, 18g potassium dihydrogen phosphate, 10g sodium carbonate, 5g disodium ethylenediaminetetraacetic acid, 3g ferric chloride hexahydrate, 0.8g boric acid, 0.28g manganese chloride tetrahydrate, 0.021g cobalt nitrate hexahydrate, 0.1g sodium molybdate dihydrate, 0.079g copper sulfate pentahydrate, 0.222g zinc sulfate heptahydrate, 0.1g vitamin B1, and 0.00025g vitamin B12.

[0011] The components of the expansion culture medium are as follows: each ton of culture medium contains: 350g sodium nitrate, 120g magnesium sulfate heptahydrate, 35g potassium dihydrogen phosphate, 14g disodium ethylenediaminetetraacetic acid, 7g ferric chloride hexahydrate, 4g boric acid, 1.0g manganese chloride tetrahydrate, 0.064g cobalt nitrate hexahydrate, 0.25g sodium molybdate dihydrate, 0.079g copper sulfate pentahydrate, 0.222g zinc sulfate heptahydrate, 0.1g vitamin B1, and 0.00025g vitamin B12.

[0012] The specific screening methods are as follows:

[0013] (1) Isolation and purification: Algal cells taken from water bodies are inoculated into screening medium for enrichment culture. The enriched algal cells are gradiently diluted with sterile distilled water and then spread onto solid screening medium for culture. After the culture is completed, single colonies are picked out and inoculated into new solid screening medium by continuous streaking method for culture. The algal cells are purified by continuous streaking method multiple times until algal cells with consistent morphology are cultured.

[0014] (2) Expansion culture: The single algae cells with the same morphology obtained by the multiple continuous streaking method in step (1) are inoculated into expansion culture medium for culture to obtain microalgae. After the culture is completed, a portion of the microalgae is stored in a solid expansion culture medium, and a portion of the microalgae is used for DNA extraction.

[0015] (3) Molecular biological identification: DNA of the microalgae obtained in step (2) is extracted and PCR amplified using 18S rRNA universal primers. The obtained PCR product is sequenced. If the sequencing result is the same as the sequence described in SEQ ID No. 1, it is a heat-resistant and alkali-resistant Haematococcus pluvialis.

[0016] Preferably, the solid screening medium and the solid expansion medium are prepared by adding 10 g / L agar to the screening medium and the expansion medium, respectively.

[0017] Preferably, in step (1), the Haematococcus pluvialis taken from the water body is inoculated into the screening medium.

[0018] Preferably, the conditions for the enrichment culture in step (1) are a temperature of 25±1° C., a humidity of 70%, a light intensity of 3500 lux, and a time for the enrichment culture of 14 days.

[0019] Preferably, the gradient dilution in step (1) is 1000-fold, 100-fold, and 10-fold, and after dilution, 10 μL is applied to the solid screening culture medium.

[0020] Preferably, the culture conditions in the solid screening medium in step (1) are a temperature of 25±1° C., a humidity of 70%, a light intensity of 3500 lux, and the enrichment culture time is 14 days.

[0021] Preferably, the culture conditions in step (2) are a temperature of 25±1° C., a humidity of 70%, a light intensity of 3500 lux, and a time for enrichment culture of 14 days.

[0022] Preferably, the sequence of the 18S rRNA universal primer is as follows:

[0023] The upstream primer sequence was TCCTGCCAGTAGTCATATGC;

[0024] The downstream primer sequence was TGATCCTCCGCAGGTTCAC.

[0025] The Haematococcus pluvialis provided by the present invention can still produce a high amount of astaxanthin under high temperature and high alkalinity conditions, and the astaxanthin yield can reach 60 mg / g.

[0026] Beneficial effects of the present invention

[0027] (1) The present invention provides a high temperature and alkali resistant Haematococcus pluvialis H7, which can be cultured under high temperature of 32 to 37° C. and alkaline conditions of pH 11.5 to 12, and the astaxanthin yield is as high as 60 mg / g.

[0028] (2) The Haematococcus pluvialis H7 of the present invention can adapt to outdoor cultivation, can effectively utilize natural resources, and can reduce the cultivation cost while still being able to grow and accumulate a large amount of astaxanthin.

[0029] (3) The Haematococcus pluvialis H7 provided by the present invention makes it possible to cultivate Haematococcus pluvialis in large-scale industrial outdoor areas. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 The present invention provides a flow chart for the separation, identification and application of a strain of high temperature and alkali resistant Haematococcus pluvialis.

[0031] Figure 2 This is a microscopic image of the identified microalgae H7 provided in Example 1 of the present invention.

[0032] Figure 3 This is the phylogenetic tree of 18S rRNA sequences for identifying microalgae provided in Example 1 of the present invention. DETAILED DESCRIPTION

[0033] The technical solution of the present invention is further described below in conjunction with the accompanying drawings and through specific implementation methods. However, the following embodiments are merely simple examples of the present invention and do not represent or limit the scope of protection of the present invention. The scope of protection of the present invention shall be subject to the claims.

[0034] Unless otherwise specified, all reagents used in the present invention are of conventional commercially available analytical grade.

[0035] The components and contents of the culture medium used in the examples are shown in Tables 1 and 2.

[0036] Table 1 Screening medium components

[0037] Serial number name Chemical formula Standard / ton 1 Sodium nitrate <![CDATA[NaNO 3 ]]> 600g 2 Magnesium sulfate heptahydrate <![CDATA[MgSO 4 ·7H 2 Oh]]> 80g 3 Potassium dihydrogen phosphate <![CDATA[KH 2 AFTER 4 ]]> 18g 4 Sodium carbonate <![CDATA[Na 2 CO 3 ]]> 10g 5 Disodium EDTA <![CDATA[Na 2 EDTA]]> 5g 6 Ferric chloride hexahydrate <![CDATA[FeCl 3 ·6H 2 O]]> 3g 7 Boric acid <![CDATA[H 3 BO 3 ]]> 0.8g 8 Manganese chloride (tetrahydrate) <![CDATA[MnCl 2 ·4H 2 O]]> 0.28g 9 Cobalt nitrate (hexahydrate) <![CDATA[Co(NO 3 , 2 ·6H 2 O]]> 0.021g 10 Sodium molybdate (dihydrate) <h2 style=";text-align:left;direction:ltr"><![CDATA[Na <h2 style=";text-align:left;direction:ltr"> 2 <h2 style=";text-align:left;direction:ltr"> MoO<h2 style=";text-align:left;direction:ltr"> 4 <h2 style=";text-align:left;direction:ltr"> 2H<h2 style=";text-align:left;direction:ltr"> 2 <h2 style=";text-align:left;direction:ltr"> O]]><h2 style=";text-align:left;direction:ltr"> 0.1g 11 Copper sulfate pentahydrate <![CDATA[CuSO 4 ·5H 2 Oh]]> 0.079g 12 Zinc sulfate heptahydrate <![CDATA[ZnSO 4 ·7H 2 Oh]]> 0.222g 13 Vitamin B1 VB1 0.1g 14 Vitamin B12 VB12 0.00025g

[0038] Table 2 Expansion medium components

[0039] Serial number name Chemical formula Standard / ton 1 Sodium nitrate <![CDATA[NaNO 3 ]]> 350g 2 Magnesium sulfate heptahydrate <![CDATA[MgSO 4 ·7H 2 Oh]]> 120g 3 Potassium dihydrogen phosphate <![CDATA[KH 2 AFTER 4 ]]> 35g 5 Disodium EDTA <![CDATA[Na2 E DTA]]> 14g 6 Ferric chloride hexahydrate <![CDATA[FeCl 3 ·6H 2 O]]> 7g 7 Boric acid <![CDATA[H 3 BO 3 ]]> 4g 8 Manganese chloride (tetrahydrate) <![CDATA[MnCl 2 ·4H 2 O]]> 1.0g 9 Cobalt nitrate (hexahydrate) <![CDATA[Co(NO 3 , 2 ·6H 2 O]]> 0.064g 10 Sodium molybdate (dihydrate) <h2 style=";text-align:left;direction:ltr"><![CDATA[Na <h2 style=";text-align:left;direction:ltr"> 2 <h2 style=";text-align:left;direction:ltr"> MoO<h2 style=";text-align:left;direction:ltr"> 4 <h2 style=";text-align:left;direction:ltr"> 2H<h2 style=";text-align:left;direction:ltr"> 2 <h2 style=";text-align:left;direction:ltr"> O]]><h2 style=";text-align:left;direction:ltr"> 0.25g 11 Copper sulfate pentahydrate <![CDATA[CuSO 4 ·5H 2 Oh]]> 0.079g 12 Zinc sulfate heptahydrate <![CDATA[znSO 4 ·7H 2 Oh]]> 0.222g 13 Vitamin B1 VB1 0.1g 14 Vitamin B12 VB12 0.00025g

[0040] Note: When preparing solid culture medium, just add agar at 10g / L.

[0041] like Figure 1 As shown, a high temperature and alkali resistant Haematococcus pluvialis and its application provided by an embodiment of the present invention include the following steps:

[0042] (1) Isolation and identification of microalgae.

[0043] (2) Cultivation and step-by-step amplification of Haematococcus pluvialis seed liquid.

[0044] (3) High temperature and alkalinity under sunlight induce Haematococcus pluvialis to accumulate astaxanthin.

[0045] (4) Determine the astaxanthin content of the Haematococcus pluvialis in the culture solution of step (3) using high performance liquid chromatography.

[0046] Example 1

[0047] The isolation and identification of Haematococcus pluvialis specifically includes the following steps:

[0048] (1) Water samples were collected from the Fayi Village Reservoir in Ziwu Town, Chuxiong City, Yunnan Province. Algal cells in the water samples were cultured in screening medium at 25°C, 70% humidity, and 3500 lux for enrichment culture for 14 days. After the enrichment culture was completed, the enriched algal cells were graded diluted with distilled water (1000 times, 100 times, and 10 times) in a clean bench. 10 μL of each concentration was spread on a solid screening medium, sealed with a sealing film, and placed in a light incubator for culture at a temperature of 25°C, a humidity of 70%, and a light intensity of 3500 lux for 14 days. After the culture was completed, a single colony was selected and inoculated on a new solid screening medium by continuous streaking method for continued culture at a temperature of 25°C, a humidity of 70%, and a light intensity of 3500 lux for 14 days. After the culture was completed, a single algal cell on the medium was taken for microscopic observation until algal cells with consistent morphology were cultured by the streaking method.

[0049] (2) The single algae cells with the same morphology as in step (1) were inoculated into a 500 mL conical flask (containing 300 mL of expansion culture medium) for expansion culture at a temperature of 25°C, a light intensity of 3500 lux, and sterile air of 0.1 vvm. The culture time was 14 days. After the culture was completed, some microalgae were retained for subsequent DNA extraction, and the remaining microalgae were stored in a solid expansion culture medium.

[0050] (3) According to the instructions of the plant genomic DNA kit, the total DNA of the microalgae was extracted, and PCR amplification was performed using the total DNA of the microalgae as a template using 18S rRNA universal primers (F: 5′-TCCTGCCAGTAGTCATATGC-3′; R: 5′-TGATCCTCCGCAGGTTCAC-3′). The resulting PCR product was sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing. The 18S rRNA sequence is shown in SEQ ID No. 1. After sequencing, a Blast comparison was performed at NCBI, and it was found that the sequence was more than 99.99% similar to that of Haematococcus pluvialis. The homology was analyzed using Mega tree construction, and the evolutionary tree was as follows: Figure 3 As shown, it was found that the algae strain had a similarity of more than 99% with Haematococcus pluvialis RRGK. The isolated and identified Haematococcus pluvialis was named Haematococcus pluvialis H7.

[0051] (4) The microalgae obtained in step (2) were observed under an optical microscope, and it was found that the liquid contained a lot of single-cell microalgae, and its characteristics were as follows: Figure 2 a The cells are oval or elliptical in the early stage of culture. The green cells are highly motile and have two flagella. There is a capsule outside the algae cell. The protoplasm and the cell wall are connected by protoplasmic filaments. There is a large gap in the middle, which is filled with transparent substances. In the late stage of culture, the immobile cells have no flagella and capsules, and the cell wall becomes obviously thicker. The motile algae cells are relatively small (5-30μm); then the cells gradually become larger, such as Figure 2 As shown in 2b and 2c, the color of the algae cells gradually turns red, and the red color starts from the middle of the cell. The red area gradually extends to the surrounding area, and the cell wall gradually thickens. Finally, the algae cells become thick-walled immobile cells, such as Figure 2 As shown in d, 2e, and 2f, the cell diameter is between 20 and 40 μm, and some exceed 50 μm. The motile cells mainly reproduce by 2-fission and spore reproduction, while the immobile cells mainly reproduce by spore reproduction, and there are also other reproduction methods.

[0052] Example 2

[0053] Comparison of astaxanthin production between Haematococcus pluvialis H7 and common Haematococcus pluvialis

[0054] The temperature provided in the embodiment of the present invention is 32-37° C. and the pH value is 11.5-12.0. Under this condition, common Haematococcus pluvialis and Haematococcus pluvialis H7 of the present invention are cultured at the same time, and the astaxanthin content of the two Haematococcus pluvialis is detected and analyzed. The specific culture method is as follows:

[0055] (1) Cultivation of Haematococcus pluvialis seed solution and step-by-step amplification: Haematococcus pluvialis H7 stored on solid amplification medium was inoculated into 250 mL of amplification medium for amplification culture. The environmental conditions were a temperature of 25°C, a light intensity of 3500 lux, and sterile air of 0.1 vvm. The culture time was 14 days. After the culture was completed, 10 × 10 5 cells / mL of algae liquid was inoculated in a 5L bubbling photobioreactor containing 4L expansion culture medium and cultured at a temperature of 25°C, a humidity of 70%, a light intensity of 3500lux, and a culture time of 7 days, so that the algae cells grew to the logarithmic growth stage; then, it was enlarged step by step from 5L to 200L to 100 tons; when the seed liquid grew to the late logarithmic growth stage, a large amount of Haematococcus pluvialis H7 was obtained.

[0056] (2) Seed solution induction: The Haematococcus pluvialis H7 obtained in step (1) was diluted to 2.5 × 10 5 cells / mL were inoculated in the expansion culture, cultured outdoors at a temperature of 32-37°C, with the culture pH adjusted to 11.5-12.0, and cultured under sunlight for 21 days (because it was cultured outdoors, the temperature and pH could not be controlled to a certain value).

[0057] The common Haematococcus pluvialis was cultured using the same culture method.

[0058] Determination of astaxanthin content: The astaxanthin content of Haematococcus pluvialis H7 and common Haematococcus pluvialis was determined using the "Liquid Chromatography Method for Determination of Astaxanthin in Haematococcus pluvialis GB / T31520-2015".

[0059] When the temperature was 32-37°C and the pH value was 11.5-12.0, the astaxanthin content of Haematococcus pluvialis H7 reached 60 mg / g, and the astaxanthin content of common Haematococcus pluvialis was 30.00 mg / g (see Table 3).

[0060] Table 3 The amount of astaxanthin accumulated by Haematococcus pluvialis H7 and common Haematococcus pluvialis in outdoor sunlight

[0061]

[0062] Example 3

[0063] Comparison of astaxanthin production between Haematococcus pluvialis H7 and common Haematococcus pluvialis

[0064] The temperature provided in the embodiment of the present invention is 33-37° C. and the pH value is 11.5-12.0. Under this condition, common Haematococcus pluvialis and Haematococcus pluvialis H7 of the present invention are cultured at the same time, and the astaxanthin content of the two Haematococcus pluvialis is detected and analyzed. The specific culture method is as follows:

[0065] (1) Cultivation and step-by-step amplification of Haematococcus pluvialis seed solution: A single colony was selected from the amplification medium and inoculated into 250 mL of amplification medium for amplification. The environmental conditions were a temperature of 25 °C, a light intensity of 3500 lux, and sterile air of 0.1 vvm. The culture time was 14 days. After the culture was completed, 10 × 10 5 cells / mL of algae liquid was inoculated in a 5L bubbling photobioreactor containing 4L expansion culture medium and cultured at a temperature of 25°C, a humidity of 70%, a light intensity of 3500lux, and an enrichment culture time of 7 days, so that the algae cells grew to the logarithmic growth stage; then, it was enlarged step by step from 5L to 200L to 100 tons; when the seed liquid grew to the late logarithmic growth stage, a large amount of Haematococcus pluvialis H7 was obtained.

[0066] (2) Seed solution induction: The Haematococcus pluvialis H7 obtained in step (1) was diluted to 2.5 × 10 5 cells / mL were inoculated in the expansion culture, cultured outdoors, the culture temperature was adjusted to 32-37°C, the culture pH was 11.5-12.0, and cultured under sunlight for 21 days (because it was cultured outdoors, the temperature and pH could not be controlled to a certain value).

[0067] The common Haematococcus pluvialis was cultured using the same culture method.

[0068] Determination of astaxanthin content: The astaxanthin content of Haematococcus pluvialis H7 and Haematococcus pluvialis was determined using the "Liquid Chromatography Method for Determination of Astaxanthin in Haematococcus algae GB / T31520-2015".

[0069] When the temperature was 33-37°C and the pH value was 11.5-12.0, the astaxanthin content of Haematococcus pluvialis H7 reached 59.83 mg / g, and the astaxanthin content of common Haematococcus pluvialis was 31.00 mg / g (see Table 3).

[0070] Example 4

[0071] Comparison of astaxanthin production between Haematococcus pluvialis H7 and common Haematococcus pluvialis

[0072] The temperature provided in the embodiment of the present invention is 31-35° C. and the pH value is 11.5-12.0. Under this condition, common Haematococcus pluvialis and Haematococcus pluvialis H7 of the present invention are cultured at the same time, and the astaxanthin content of the two Haematococcus pluvialis is detected and analyzed. The specific culture method is as follows:

[0073] (1) Cultivation and step-by-step amplification of Haematococcus pluvialis seed solution: A single colony was selected from the amplification medium and inoculated into 250 mL of amplification medium for amplification. The environmental conditions were a temperature of 25 °C, a light intensity of 3500 lux, and sterile air of 0.1 vvm. The culture time was 14 days. After the culture was completed, 10 × 10 5 cells / mL of algae liquid was inoculated in a 5L bubbling photobioreactor containing 4L expansion culture medium and cultured at a temperature of 25°C, a humidity of 70%, a light intensity of 3500lux, and an enrichment culture time of 7 days, so that the algae cells grew to the logarithmic growth stage; then, it was enlarged step by step from 5L to 200L to 100 tons; when the seed liquid grew to the late logarithmic growth stage, a large amount of Haematococcus pluvialis H7 was obtained.

[0074] (2) Seed solution induction: The Haematococcus pluvialis H7 obtained in step (1) was diluted to 2.5 × 10 5 cells / mL were inoculated in the expansion culture, cultured outdoors, the culture temperature was adjusted to 32-37°C, the culture pH was 11.5-12.0, and cultured under sunlight for 21 days (because it was cultured outdoors, the temperature and pH could not be controlled to a certain value).

[0075] The common Haematococcus pluvialis was cultured using the same culture method.

[0076] Determination of astaxanthin content: The astaxanthin content of Haematococcus pluvialis H7 and common Haematococcus pluvialis was determined using the "Liquid Chromatography Method for Determination of Astaxanthin in Haematococcus pluvialis GB / T31520-2015".

[0077] When the temperature was 31-35°C and the pH value was 11.5-12.0, the astaxanthin content of Haematococcus pluvialis H7 reached 59.6 mg / g, and the astaxanthin content of common Haematococcus pluvialis was 28.00 mg / g (see Table 3).

Claims

1. A high temperature and alkali resistant Haematococcus pluvialis, characterized in that: The high temperature and alkali-resistant Haematococcus pluvialis is named H7, and was deposited in the General Microbiology Center of China Microorganism Culture Collection Committee on February 26, 2024, with the address: Institute of Microbiology, Chinese Academy of Sciences, Beijing, China, with the deposit number CGMCC No.41186, and the classification name is Haematococcus pluvialis.

2. The heat-resistant and alkali-resistant Haematococcus pluvialis according to claim 1, characterized in that: The high temperature and alkali resistant Haematococcus pluvialis H7 can be cultured under the conditions of a high temperature of 32-37° C. and a pH value of 11.5-12.

3. Use of the high temperature and alkali resistant Haematococcus pluvialis according to any one of claims 1 or 2 in the production of astaxanthin.

Images