A strain of Lactobacillus johnsonii XY9 and its application in the preparation of hypoglycemic and anti-aging drugs

Abstract

The present invention belongs to the field of probiotics and their application technology, and is specifically related to a strain of Lactobacillus johnsonii XY9 and its application in the preparation of hypoglycemic and anti-aging food and medicine. The present invention separates and purifies a strain of Lactobacillus johnsonii XY9 from a fecal sample of a healthy adult in Guangdong, China, and the strain has excellent protease activity, can produce and secrete γ-aminobutyric acid, can inhibit α-glucosidase activity, can remove DPPH free radicals, and has excellent cellulase activity. Therefore, the strain has the function of promoting digestion and absorption of protein food, improving protein allergy, anti-depression and improving sleep, hypoglycemic and weight loss, anti-oxidative whitening, anti-aging, anti-inflammatory, promoting the absorption of cellulose, improving constipation and other functions, and can be used in the fields of hypoglycemic and anti-aging, with important application value and economic value.

Description

Technical Field

[0001] The invention belongs to the technical field of probiotics and their application, and specifically relates to a strain of Lactobacillus johnsonii XY9 and its application in the preparation of blood sugar lowering and anti-aging medicines. Background Art

[0002] Lactobacillus johnsonii is a Gram-positive bacillus belonging to the family Lactobacillaceae and the genus Lactobacillus. It is generally 0.5-1.2μm×0.5-1.5μm in size. The bacteria are short rod-shaped with round ends. They usually appear alone, and a few appear in pairs of short chains. There are no spores, no capsules, and no movement. Lactobacillus johnsonii was first discovered in human glands and is a native species in the human digestive tract. It has no special requirements for oxygen, is facultatively anaerobic, and grows better when the oxygen pressure is reduced. The suitable temperature for growth is 30-37℃, and it can grow at 10℃. It can be detected in almost all digestive tracts of the human body, so it is a lactobacillus widely present in the human body, which also shows that Lactobacillus johnsonii is a normal strain present in the human body. In addition, Lactobacillus johnsonii has good acid and bile resistance, can survive in the stomach and intestines of humans and animals, and is widely present in the intestines of humans and animals.

[0003] Lactobacillus johnsonii is one of the lactobacillus strains that can be produced and processed, and is widely present in the intestinal tract of humans and animals and discharged with feces, and as an important component of the normal microbial system of the intestinal tract, it accompanies the host throughout life, and is of great significance for maintaining the balance of intestinal microecology. At the same time, as a probiotic in the intestinal flora, it is also a kind of edible lactic acid bacteria, and Lactobacillus johnsonii can also play the role of helping intestinal peristalsis, and can also enhance the digestive ability of the human body and improve immunity. Therefore, Lactobacillus johnsonii has become a hot spot of research in recent years as a probiotic lactobacillus with great potential. In recent years, Lactobacillus johnsonii has been widely used in the production of probiotic products as a probiotic, and is constantly being used to be made into a probiotic preparation suitable for humans and animals.

[0004] According to research reports, different strains of Lactobacillus johnsonii have different probiotic functions: (1) Lactobacillus johnsonii BS15 can not only colonize in the intestines of humans, rats, mice, fish, pigs and chickens, but also has a good effect on improving the muscle quality of broiler chickens, and can also reduce abdominal fat rate and avoid energy consumption in production (Qing X, Zeng D, Wang H, et al. Preventing subclinical necrotic enteritis through Lactobacillus johnsonii BS15 by ameliorating lipid metabolism and intestinal microflorain broiler chickens. AMB Express. 2017 Dec; 7(1): 139. doi: 10.1186 / s13568-017-0439-5. Epub 2017 Jun 26. PMID: 28655217; PMCID: PMC5484656.). Live bacteria are a necessary condition for the probiotic to work. Lactobacillus johnsonii BS15 can simultaneously improve the development and digestive capacity of the small intestine. These probiotic effects may be the result of the BS15 strain's regulatory effect on the intestinal microecological structure. (2) Lactobacillus johnsonii GLJO02 can effectively alleviate the symptoms of colitis in mice, increase the level of cecal SCFAs, reduce intestinal barrier permeability, and thus inhibit LPS from entering the blood and reduce the body's inflammatory state (Wang Yu, Huang Yina, Cai Yunjie, et al. Lactobacillus johnsonii GLJO02 alleviates DSS-induced colitis in mice by improving intestinal permeability [J]. Chinese Journal of Microecology, 2023, 35(03): 284-290. DOI: 10.13381 / j.cnki.cjm.202303006.). (3) Lactobacillus johnsonii can improve intestinal flora and increase the number of intestinal digestive cocci and clostridium. Lactobacillus johnsonii can also significantly increase the daily weight gain of piglets and reduce diarrhea in piglets (Xin J, Zeng D, Wang H, et al. Probiotic Lactobacillus johnsonii BS15 Promotes Growth Performance, Intestinal Immunity, and Gut Microbiota in Piglets. Probiotics Antimicrob Proteins. 2020 Mar; 12 (1): 184-193. doi: 10.1007 / s12602-018-9511-y. PMID: 30617949.).(4) Lactobacillus johnsonii JJB3 showed good safety in both in vivo and in vitro tests. It improved the oxidative stress of IPEC-J2 cells induced by H2O2 by downregulating the gene transcription levels of two oxidative stress-related metabolic pathways, and had a reliable effect in reducing the oxidative stress of porcine intestinal epithelial cells (Wang Yanyan. Safety evaluation of Lactobacillus johnsonii JJB3 and its antioxidant effect on IPEC-J2 cells [D]. Sichuan Agricultural University, 2023. DOI: 10.27345 / d.cnki.gsnyu.2023.000611).

[0005] Because Lactobacillus johnsonii has diverse sources, it has genetic diversity and functional diversity. However, there are still few studies on the isolation and identification, probiotic properties and metabolic mechanisms of Lactobacillus johnsonii, which to a certain extent affects the development and utilization of Lactobacillus johnsonii. Therefore, it is necessary to explore more new strains based on the different sources of Lactobacillus johnsonii, determine its efficacy based on the function of the strain or its probiotic metabolites, clarify its application prospects, and enable it to better exert its probiotic efficacy. In summary, the research and application of probiotic Lactobacillus johnsonii has a broad development space. Summary of the invention

[0006] In order to overcome the shortcomings of the above-mentioned prior art, the present invention isolates and purifies a Lactobacillus johnsonii XY9 strain from a fecal sample of a healthy adult in Guangdong, China. The strain has excellent protease activity and cellulase activity, can produce and secrete γ-aminobutyric acid, can inhibit α-glucosidase activity, and can scavenge DPPH free radicals. It has important potential application value in the fields of lowering blood sugar and anti-aging.

[0007] In order to achieve the above object, the technical solution adopted by the present invention is:

[0008] The first aspect of the present invention provides a Lactobacillus johnsonii XY9 strain, which was deposited in the China Center for Type Culture Collection on October 25, 2023, with the accession number: CCTCC NO: M 20232013; the 16S rDNA sequence of the Lactobacillus johnsonii XY9 strain is shown in SEQ ID No: 1.

[0009] The second aspect of the present invention provides use of the Lactobacillus johnsonii XY9 strain described in the first aspect in producing protease.

[0010] Research has found that the probiotic Lactobacillus johnsonii XY9 strain can produce protease, suggesting that Lactobacillus johnsonii XY9 strain has the potential to be used to produce protease, and through this property of producing protease, it can be used to promote the human body's digestion and absorption of protein in food, anti-allergy, and help animals digest and absorb nutrients.

[0011] The third aspect of the present invention provides use of the Lactobacillus johnsonii XY9 strain described in the first aspect in producing cellulase.

[0012] Research has found that the probiotic Lactobacillus johnsonii XY9 strain can produce cellulase, suggesting that Lactobacillus johnsonii XY9 strain can be used to produce cellulase, and through this characteristic of producing cellulase, it can be used to promote the human body's digestion and absorption of protein in food, improve the absorption of small peptides and amino acids, and anti-allergy.

[0013] The fourth aspect of the present invention provides use of the Lactobacillus johnsonii XY9 strain described in the first aspect in producing γ-aminobutyric acid.

[0014] Studies have shown that the probiotic Lactobacillus johnsonii XY9 strain can produce γ-aminobutyric acid (GABA), suggesting that Lactobacillus johnsonii XY9 strain can be used to produce GABA, and through this property of producing GABA, it can be used to improve the body's sleep quality, fight depression, fight anxiety, lower blood pressure, improve lipid metabolism and other fields.

[0015] The fifth aspect of the present invention provides use of the Lactobacillus johnsonii XY9 strain described in the first aspect in the preparation of an α-glucosidase inhibitor.

[0016] Studies have shown that the probiotic Lactobacillus johnsonii XY9 strain can effectively inhibit the activity of α-glucosidase, which is related to type 2 diabetes. Inhibiting α-glucosidase is one of the methods to control postprandial hyperglycemia, suggesting that Lactobacillus johnsonii XY9 strain is expected to be used in areas such as lowering blood sugar and inhibiting obesity.

[0017] The sixth aspect of the present invention provides use of the Lactobacillus johnsonii XY9 strain described in the first aspect in the preparation of a DPPH free radical scavenger.

[0018] Research has found that the probiotic Lactobacillus johnsonii XY9 strain can eliminate DPPH free radicals and thus avoid the harm caused by such free radicals to the body. It can be used in anti-aging, cancer prevention, cardiovascular and cerebrovascular protection and other fields.

[0019] The seventh aspect of the present invention provides a bacterial agent with probiotic function, wherein the bacterial agent comprises the Lactobacillus johnsonii XY9 strain described in the first aspect.

[0020] Preferably, the bacterial agent is a fermentation product of Lactobacillus johnsonii XY9 strain.

[0021] Preferably, in the field of medical applications, the bacterial agent also includes pharmaceutically acceptable excipients.

[0022] More preferably, the excipients include carriers and excipients. The excipients refer to diluents, adhesives, lubricants, disintegrants, solubilizers, stabilizers, etc. that can be used in the pharmaceutical field, as well as some pharmaceutical matrices. The carrier is a functional pharmaceutical excipient available in the pharmaceutical field, including surfactants, suspending agents, emulsifiers, and some new pharmaceutical polymer materials, such as cyclodextrin, chitosan, polylactic acid (PLA), polyglycolic acid polylactic acid copolymer (PLGA), hyaluronic acid, etc.

[0023] Preferably, in the field of medical applications, the dosage forms of the bacterial agent include tablets, granules, capsules, pills, sustained-release preparations, oral liquid preparations, and injections.

[0024] More preferably, the above dosage forms refer to the dosage forms commonly used in clinical practice. The pharmaceutical preparations can be administered orally or parenterally (eg, intravenously, subcutaneously, intraperitoneally or topically). If some drugs are unstable under gastric conditions, they can be prepared into enteric-coated tablets.

[0025] Compared with the prior art, the present invention has the following beneficial effects:

[0026] The present invention separates and purifies a Lactobacillus johnsonii XY9 strain from a fecal sample of a healthy adult in Guangdong, China. The strain has multiple prebiotic effects, including superior protease activity, production and secretion of γ-aminobutyric acid, inhibition of α-glucosidase activity, scavenging of DPPH free radicals, and superior cellulase activity. Therefore, the Lactobacillus johnsonii XY9 strain has multiple functions such as promoting digestion and absorption of protein food, improving protein allergy, anti-depression and improving sleep, lowering blood sugar and losing weight, anti-oxidation and whitening, delaying aging, and anti-inflammatory, promoting the absorption of cellulose, improving constipation, etc. It can be seen that the Lactobacillus johnsonii XY9 strain newly isolated by the present invention has multiple prebiotic effects, can be used in the fields of hypoglycemic and anti-aging, for example, it can be made into hypoglycemic and anti-aging medicines, and has important application value and economic value. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 This is the phylogenetic tree of Lactobacillus johnsonii XY9 strain (all strains are derived from the Genome database of NCBI);

[0028] Figure 2 This is the degradation experiment of Lactobacillus johnsonii XY9 strain on milk plate (a is the blank control group; b is the experimental group);

[0029] Figure 3 Lactobacillus johnsonii XY9 strain can produce and secrete γ-aminobutyric acid;

[0030] Figure 4 The fermentation broth of Lactobacillus johnsonii XY9 can secrete substances that significantly inhibit the activity of α-glucosidase;

[0031] Figure 5 Lactobacillus johnsonii XY9 strain can scavenge DPPH free radicals;

[0032] Figure 6 This is an experiment on the degradation of cellulose plates by Lactobacillus johnsonii strain XY9 (left side, blank control group; right side, experimental group). DETAILED DESCRIPTION

[0033] The specific embodiments of the present invention are further described below. It should be noted that the description of these embodiments is used to help understand the present invention, but does not constitute a limitation of the present invention. In addition, the technical features involved in each embodiment of the present invention described below can be combined with each other as long as they do not conflict with each other.

[0034] The experimental methods in the following examples are conventional methods unless otherwise specified, and the experimental materials used in the following examples are commercially available unless otherwise specified.

[0035] The experimental materials involved in the following examples are as follows:

[0036] (1) Lactobacillus johnsonii XY9 strain was isolated from the feces of a healthy adult in Guangdong, China, commissioned by the Runze Laboratory of the Intestinal Microbiology Research Group, and stored in glycerol tubes at -80°C. In general, colonies can be obtained by inoculating it on the surface of an MRS solid culture medium plate and inverting it in a 37°C constant temperature anaerobic incubator for 24 hours, or by shaking it in an MRS liquid culture medium in a 37°C constant temperature anaerobic incubator for 24-48 hours to obtain a fermentation liquid.

[0037] (2) Kits: γ-aminobutyric acid (GABA) detection kit (Cloud-Clone Corp., Cat: CEA900Ge), α-glucosidase inhibitor screening kit (abcam, Cat: ab284520), DPPH free radical scavenging ability kit (Nanjing Jiancheng, Cat: A153-1-1).

[0038] (3) MRS plate: beef extract 10 g, peptone 10 g, yeast extract 5 g, triammonium citrate 2 g, sodium acetate 5 g, glucose 20 g, potassium dihydrogen phosphate 2 g, Tween 80 1 mL, magnesium sulfate 0.58 g, manganese sulfate 0.25 g, agar 15 g, make up to 1 L with ddH2O, adjust pH to 6.2-6.6, autoclave at 121°C for 20 min, and prepare MRS plate.

[0039] (4) MRS liquid medium: beef extract 10 g, peptone 10 g, yeast extract 5 g, triammonium citrate 2 g, sodium acetate 5 g, glucose 20 g, dipotassium phosphate 2 g, Tween 80 1 mL, magnesium sulfate 0.58 g, manganese sulfate 0.25 g, make up to 1 L with ddH2O, adjust the pH to 6.2-6.6, and sterilize at 121°C for 20 min to prepare MRS liquid medium.

[0040] (5) MP plate: 10 g skim milk powder, 1 g sodium chloride, 10 g beef extract, 10 g peptone, 5 g yeast extract, 20 g glucose, 2 g triammonium citrate, 5 g sodium acetate, 2 g dipotassium hydrogen phosphate, 0.5 mL Tween 80, 0.58 g magnesium sulfate, 0.25 g manganese sulfate, 15 g agar, make up to 1 L with ddH2O, adjust pH to 6.2-6.6, sterilize by autoclave at 121°C for 20 min, and prepare MP plate.

[0041] (6) CMC plate: sodium carboxymethyl cellulose 10 g, ammonium sulfate 1.5 g, manganese sulfate 0.3 g, calcium chloride 0.2 g, sodium chloride 5 g, urea 0.3 g, beef extract 10 g, peptone 10 g, yeast extract 5 g, glucose 20 g, triammonium citrate 2 g, sodium acetate 5 g, dipotassium hydrogen phosphate 2 g, Tween 80 0.5 mL, magnesium sulfate 0.58 g, manganese sulfate 0.25 g, agar 15 g, make up to 1 L with ddH2O, adjust pH to 6.2-6.6, sterilize by autoclave at 121°C for 20 min, and prepare CMC plate.

[0042] Example 1 Isolation and Identification of Lactobacillus johnsonii XY9 Strain

[0043] Lactobacillus johnsonii XY9 strain was isolated from the feces of a healthy adult (BMI=20.6) in Guangdong Province, China, as follows:

[0044] The fecal sample was repeatedly washed 3 times with sterile water, placed in a mortar, 500uL sterile water was added for every 100mg of feces, the homogenate was thoroughly ground, an appropriate amount of grinding liquid was taken with a pipette, and it was spread on an MRS plate and cultured at room temperature for 3 days. Then, the colonies to be streaked and purified in the separation experiment plate were numbered with a marker, and the strain number was indicated on the plate accordingly. After marking, the colonies were picked and inoculated on the MRS plate, and the strains were purified by the plate streaking method. If this method cannot separate the strains, it is necessary to pick the colonies from the enrichment plate, dilute them with the MRS liquid culture medium gradient, and spread them on the culture medium. Finally, referring to the Bergey Bacterial Identification Manual (Eighth Edition) and the Fungal Classification and Identification Manual, the strains belonging to bacteria were first distinguished. A purified strain was initially isolated, the strain number was XY9, and the colonies of the strain were observed to be round, white, and translucent after 48 hours of culture.

[0045] Then, the isolated XY9 strain was molecularly identified by 16S rDNA universal primers (27F: AGAGTTTGATCCTGGCTCAG, 1492R: TACGGCTACCTTGTTACGACTT), and the whole genome of the XY9 strain was sequenced by Beijing Biomark Biotechnology Co., Ltd. The obtained 16S rDNA sequence (SEQ ID No: 1) was BLAST-aligned in the Genome database of NCBI. The results showed that the homology of the XY9 strain with the known Lactobacillus johnsonii 16S rDNA sequence was >99%, and evolutionary analysis was performed with homologous strains ( Figure 1 ), confirming that strain XY9 is a different strain of Lactobacillus johnsonii of the same species.

[0046] Finally, the strain XY9 was deposited, and the deposit information is as follows: deposit time: October 25, 2023; name of the depository: China Center for Type Culture Collection (CCTCC); deposit number: CCTCC NO:M 20232013; address of the depository: Wuhan University, Wuhan, China; classification name: Lactobacillus johnsonii.

[0047] Lactobacillus johnsonii is a probiotic strain with a wide range of probiotic effects, but strains from different sources have different effects, which shows that the new Lactobacillus johnsonii XY9 strain isolated from human feces in the present invention can be used as a probiotic and may have new effects and functions.

[0048] Lactobacillus johnsonii XY916S rDNA sequence(1438bp):

[0049]

[0050] Example 2 Function and application of Lactobacillus johnsonii XY9 strain

[0051] (1) Lactobacillus johnsonii XY9 strain can produce protease

[0052] The ability of Lactobacillus johnsonii XY9 to secrete protease to hydrolyze proteins was identified and measured using skim milk plate medium (MP plate) according to the agar well diffusion test. During the test, 3uL of Lactobacillus johnsonii XY9 bacterial solution with a concentration of 10Abs was added to the MP plate of the experimental group, and 3uL of blank MRS medium was added to the control group, and then inverted and cultured in a 37°C constant temperature anaerobic incubator for 3 days. The results showed that compared with the control with blank medium added, strain XY9 could significantly degrade proteins, forming a clear degradation circle ( Figure 2 ). This indicates that Lactobacillus johnsonii XY9 strain can produce protease that degrades milk protein.

[0053] Lactobacillus johnsonii XY9 strain can produce protease, which can be used as a probiotic strain to promote the digestion and absorption of protein in food by the human body and improve the absorption of small peptides and amino acids. At the same time, it can also be used for anti-allergy (improving food allergies caused by protein indigestion or non-absorption). In addition, it can also be used for the extraction of protease and applied to the production of protease in the washing industry; it can also be used in microbial feed to help animals digest and absorb nutrients and improve the utilization rate of feed.

[0054] (2) Lactobacillus johnsonii XY9 strain can produce and secrete γ-aminobutyric acid (GABA)

[0055] Lactobacillus johnsonii XY9 cultured in MRS liquid medium to the stable phase was expanded into new MRS liquid medium at a dilution multiple of 1:30. The bacterial suspension was collected at 24 hours after the stable phase, and the fermentation supernatant was collected after centrifugation at 10,000×g and 4°C for 10 minutes. The GABA concentration in the fermentation supernatant was then determined using a GABA-specific ELISA kit (CEA900Ge). The results showed that compared with the low concentration of GABA in the blank medium MRS, the concentration of GABA in the fermentation supernatant of strain XY9 increased significantly, and the accumulated amount was 13.38 pg / mL, indicating that Lactobacillus johnsonii XY9 can produce and secrete γ-aminobutyric acid ( Figure 3 ).

[0056] GABA is an important inhibitory neurotransmitter of the central nervous system, which is widely found in animals, plants and microorganisms. It has been confirmed that GABA, a small molecular weight non-protein amino acid, is safe for consumption and can be used as a food additive. Studies have shown that taking a certain amount of GABA can improve the body's sleep quality, fight depression, reduce anxiety, lower blood pressure, improve lipid metabolism, enhance memory and improve brain activity, accelerate brain metabolism, strengthen the liver and kidneys, promote ethanol metabolism (detoxification), and improve menopausal syndrome.

[0057] Therefore, the probiotic Lactobacillus johnsonii XY9 strain can achieve the above multiple uses by producing γ-aminobutyric acid.

[0058] (3) The fermentation broth of Lactobacillus johnsonii strain XY9 can effectively inhibit the activity of α-glucosidase

[0059] Lactobacillus johnsonii XY9 cultured to the stable phase in MRS liquid medium was expanded into new MRS liquid medium at a dilution multiple of 1:30. The bacterial suspension was collected when the culture reached the stable phase for 24 hours, and the fermentation supernatant was collected after centrifugation at 10,000×g and 4°C for 10 minutes. The effect of the fermentation supernatant on the enzymatic activity of α-glucosidase to hydrolyze glucose was then determined using the α-glucosidase inhibitor screening kit (ab284520). The results showed that compared with the blank medium MRS without inhibition, the fermentation supernatant of strain XY9 significantly inhibited the ability of α-glucosidase to hydrolyze glucose, with an inhibition rate of about 30.18%, indicating that the fermentation broth of Lactobacillus johnsonii XY9 can effectively inhibit the activity of α-glucosidase ( Figure 4 ).

[0060] α-glucosidase is an enzyme that plays a role in the breakdown of carbohydrates and is associated with type 2 diabetes. Inhibiting α-glucosidase is one of the ways to control postprandial hyperglycemia, thereby contributing to the treatment of diabetes. Therefore, α-glucosidase inhibitors help maintain blood sugar balance and can improve diabetic complications. In addition, inhibiting the activity of α-glucosidase can control obesity.

[0061] Therefore, the probiotic Lactobacillus johnsonii XY9 strain has the ability to inhibit α-glucosidase activity, which makes it a potential probiotic for lowering blood sugar and inhibiting obesity.

[0062] (4) Lactobacillus johnsonii XY9 strain can scavenge DPPH free radicals

[0063] The Lactobacillus johnsonii XY9 strain cultured to the stable phase in MRS liquid medium was expanded to a new MRS liquid medium at a dilution multiple of 1:30. The bacterial suspension was collected at 24 hours after the stable phase, and the fermentation supernatant was collected after centrifugation at 10,000×g and 4°C for 10 minutes. The DPPH scavenging ability of the fermentation supernatant was then determined by the DPPH free radical scavenging ability kit (Nanjing Jiancheng, Cat: A153-1-1). The results showed that compared with the blank control MRS, the fermentation supernatant of strain XY9 had a DPPH free radical scavenging ability of 317.0 Trolox / mL, which was significantly improved (**P<0.01), indicating that Lactobacillus johnsonii XY9 has a good ability to scavenge DPPH free radicals and exhibits good antioxidant capacity ( Figure 5 ).

[0064] Free radicals, also known as "free radicals" in chemistry, refer to atoms or groups with unpaired electrons formed by homolytic cleavage of covalent bonds in the molecules of a compound under external conditions such as light and heat. Since free radicals contain unpaired electrons, they are extremely unstable (especially hydroxyl free radicals), so they will steal electrons from neighboring molecules (including fats, proteins, and DNA) to keep themselves in a stable state. In this way, the neighboring molecule becomes a new free radical, which then steals electrons. Such a chain reaction will damage the structure of the cell, causing loss of cell function, gene mutation, and even death.

[0065] Free radicals have many negative effects. For example: (1) they weaken the resistance of cells, making the body susceptible to infection by bacteria and germs; (2) they produce chemical substances that damage cells and form carcinogens; (3) they hinder the normal development of cells, interfere with their recovery function, and make the cell renewal rate lower than the withering rate; (4) they damage the genetic gene (DNA) organization in the body, disrupt the operation and regeneration function of cells, cause gene mutations, and develop into cancer; (5) they damage the mitochondria (energy storage bodies) in cells, causing oxidative fatigue; (6) they damage proteins and enzymes in the body, leading to inflammation and aging; (7) they damage fats, causing lipid peroxidation, leading to atherosclerosis and cardiovascular and cerebrovascular diseases.

[0066] In addition, scavenging DPPH free radicals has many functions, such as: ① Anti-aging: A very obvious manifestation of free radicals on the human body is aging, and scavenging free radicals can prevent free radicals from damaging cells and prevent cells from aging and dying, which leads to the aging of the body. Therefore, scavenging free radicals has an anti-aging effect. ② Cancer prevention: When free radicals damage cell membrane proteins, they promote changes in cell function and shape, and damage other surrounding cells. When free radicals damage DNA, they will cause mutations in proto-oncogenes and tumor suppressor genes, leading to the formation of cancer cells. Therefore, scavenging free radicals has the effect of preventing cancer. ③ Protecting the cardiovascular and cerebrovascular system: Free radicals deposited on the blood vessel wall will destroy the elastic fibers of the blood vessel, causing hardening of vascular cells and the occurrence of atherosclerosis. At the same time, free radicals will cause lipid peroxidation, which is easy to cause various cardiovascular and cerebrovascular diseases such as thrombosis. Scavenging free radicals can prevent free radicals from depositing on the blood vessel wall, so it has the effect of protecting the cardiovascular and cerebrovascular system.

[0067] Therefore, the probiotic Lactobacillus johnsonii XY9 strain can avoid the harm caused by DPPH free radicals to the body by removing the free radicals.

[0068] (5) Lactobacillus johnsonii XY9 strain can produce cellulase

[0069] The ability of Lactobacillus johnsonii XY9 to degrade cellulose was identified and determined using cellulose plate culture medium (CMC plate) according to the agar well diffusion method. During the test, 3uL of Lactobacillus johnsonii XY9 bacterial solution with a concentration of 10Abs was added to the CMC plate of the experimental group, and 3uL of blank MRS culture medium was added to the control group. After inverted culture in a 37°C constant temperature anaerobic incubator for 3 days, Congo red staining was performed. The results showed that compared with the control group with blank culture medium added, strain XY9 could significantly degrade cellulose, forming an obvious degradation circle ( Figure 6 ).

[0070] Since Lactobacillus johnsonii XY9 can produce cellulase, the probiotic Lactobacillus johnsonii XY9 can play the following multiple roles through the effect of producing cellulase: (1) It is used to promote the digestion and absorption of dietary ingredients; (2) It improves constipation. Probiotics break down cellulose in the intestine to produce a certain amount of water, which has the effect of softening stool; (3) Lowering cholesterol is the most important effect of cellulose. After being absorbed by the human body, soluble fiber can inhibit the body's absorption of cholesterol, and can combine with cholesterol in the intestine to accelerate the metabolism of cholesterol in the body, preventing the body from inducing hyperlipidemia due to high cholesterol, and can reduce the incidence of arteriosclerosis and coronary heart disease; (4) Cellulose, a non-sweet "sugar", can slow down the absorption of glucose by the blood, balance blood sugar concentration, and promote the sensitivity of muscle and fat cells to insulin, thereby preventing and assisting in the treatment of diabetes.

[0071] In addition, Lactobacillus johnsonii XY9 strain can also be used for the fermentation and extraction of cellulase; for degrading the cell walls of pathogenic fungi and controlling diseases; for the decomposition of cellulose in compost; and for the preparation of livestock and poultry feed, such as feed for monogastric animals such as pigs and chickens, to overcome their inability to utilize cellulose.

[0072] In summary, the newly isolated Lactobacillus johnsonii XY9 strain of the present invention has multiple probiotic effects: (1) has excellent protease activity; (2) can produce and secrete γ-aminobutyric acid; (3) can inhibit α-glucosidase activity; (4) can scavenge DPPH free radicals; (5) has excellent cellulase activity. It can be seen that the newly isolated Lactobacillus johnsonii XY9 strain of the present invention has important application value and economic value in the fields of lowering blood sugar and anti-aging.

[0073] The embodiments of the present invention are described in detail above, but the present invention is not limited to the described embodiments. For those skilled in the art, various changes, modifications, substitutions and variations of these embodiments are made without departing from the principles and spirit of the present invention, and still fall within the protection scope of the present invention.

Claims

1. A strain of Lactobacillus johnsonii XY9, characterized in that: The Lactobacillus johnsonii XY9 strain was deposited in the China Center for Type Culture Collection on October 25, 2023, with the deposit number: CCTCC NO:M20232013; the 16S rDNA sequence of the Lactobacillus johnsonii XY9 strain is shown in SEQ ID No:

1.

2. Use of the Lactobacillus johnsonii XY9 strain according to claim 1 in producing a protease for degrading milk protein.

3. Use of the Lactobacillus johnsonii XY9 strain according to claim 1 in producing cellulase.

4. Use of the Lactobacillus johnsonii XY9 strain according to claim 1 in producing γ-aminobutyric acid.

5. Use of the Lactobacillus johnsonii XY9 strain according to claim 1 in the preparation of an α-glucosidase inhibitor.

6. Use of the Lactobacillus johnsonii XY9 strain according to claim 1 in preparing a DPPH free radical scavenger.

7. A bacterial agent with probiotic function, characterized in that: The bacterial agent comprises the Lactobacillus johnsonii XY9 strain according to claim 1.

8. The bacterial agent with probiotic function according to claim 7, characterized in that: In the field of medical applications, the bacterial agent also includes pharmaceutically acceptable excipients.

Images