Indigoidine synthase mutant M4 and its application in indigoidine production

Abstract

The present invention belongs to the field of enzyme engineering and genetic engineering, and discloses an Indigoidine synthase mutant M4 and its application in Indigoidine production, wherein the mutant is shown in SEQ ID NO. 2. Through the analysis of Indigodine fermentation yield determination, it is found that compared with the wild-type Indigoidine synthase, the Indigoidine synthase M4 of the present invention exhibits significantly improved enzyme activity, indicating that it is more suitable for industrial production of Indigoidine.

Description

Technical Field

[0001] The invention belongs to the field of enzyme engineering and gene engineering, and particularly relates to an Indigoidine synthetase mutant M4 and application thereof in Indigoidine production. Background Art

[0002] Natural blue pigment was originally extracted from plants. It is non-toxic and harmless. It is widely used in the printing and dyeing of fabrics and is deeply loved by people. With the continuous increase in demand, the blue pigment directly obtained from plants is in short supply, and there is an urgent need to invent a method for quickly synthesizing blue pigment. In the 1980s, a group of chemists led by German chemist Bayer began to try to synthesize indigo by chemical methods. However, due to the large amount of raw materials such as aniline and nitrobenzene used in the chemical synthesis pathway, it caused great damage to the environment. Therefore, the chemical synthesis of blue pigment was gradually eliminated. With the continuous development of biotechnology, the use of microorganisms to synthesize blue pigment has been recognized by many scholars at home and abroad.

[0003] Indigoidine is a non-toxic, water-soluble natural blue product of microorganisms. It was first discovered and isolated from the plant pathogen Erwinia sp. (Chu et al. 2009). Later, this blue pigment was also found in other microbial products, such as Arthrobacter (Day et al. 2017) and Roseobacter (Gromek et al. 2016). Indigoidine is a natural blue pigment encoded by a single modular non-ribosomal peptide synthetase (NRPS). Its bright dark blue color makes it an attractive alternative fabric dye. In addition, the biosynthetic pathway of Indigoidine is simple. It is formed by the oxidation and condensation of two molecules of L-glutamine. Compared with other natural blue pigments synthesized by microorganisms, it has fewer branched metabolisms and fewer by-products, which is conducive to subsequent separation and purification.

[0004] Several studies have reported the use of heterologous hosts including Corynebacterium glutamicum (Ghiffary et al. 2021), Saccharomyces cerevisiae (Wehrs et al. 2018), Rhodosporidium toruloides (Wehrs et al. 2019), and Pseudomonas putida (Lim et al. 2021) to produce Indigoidine. Indigoidine synthase catalyzes the oxidative condensation of two molecules of L-glutamine to produce Indigoidine. Compared with chemically synthesized pigments, the fermentation production process of Indigoidine has the advantages of safety, pollution-free, and low cost. It also has antibacterial and redox properties. It can be used as a new type of natural pigment and has broad application prospects in light industrial dyeing (high-end clothing, interior coatings, highly sterile industry work clothes, stationery, etc.), food coloring (cocktails, ice cream, milk tea, biscuits, cakes, etc.), beauty colors (hair dyeing, glasses, eyebrow tattoos, nail polish, tattoos, etc.), and pharmaceutical colorants (capsules, injections, ointments, health care, etc.).

[0005] In the Indigoidine synthesis pathway, Indigoidine synthase is the key rate-limiting step. The Indigoidine synthase reported so far generally has the problem of high enzyme activity in low temperature environment and a significant decrease in high enzyme activity. Low temperature is not conducive to cell growth and the fermentation cost is high. Therefore, this characteristic has caused great limitations on the fermentation production of Indigoidine. Therefore, the Indigoidine synthase was modified through enzyme engineering to obtain an Indigoidine synthase with improved activity at high temperature, and based on this, a high-yield engineered bacterium was constructed, laying the foundation for the industrial and efficient fermentation production of the natural blue pigment Indigoidine. Summary of the invention

[0006] The object of the present invention is to provide an Indigoidine synthetase M4 with improved catalytic performance, wherein the synthetase is shown in SEQ ID NO.2.

[0007] Another object of the present invention is to provide the use of the above synthase in the fermentation production of natural blue pigment Indigoidine.

[0008] In order to achieve the above object, the present invention adopts the following technical measures:

[0009] Obtaining the Indigoidine synthetase mutant M4:

[0010] The wild-type Indigoidine synthetase from Streptomyces hygroscopicus JCM 4712, shown in SEQ ID NO.1, has its 135th amino acid mutated from threonine T to isoleucine I, its 359th amino acid mutated from glutamic acid E to proline P, its 369th amino acid mutated from histidine H to tyrosine Y, and its 506th amino acid mutated from histidine H to asparagine W, and the Indigoidine synthetase mutant M4 is shown in SEQ ID NO.2. The protection scope of the present invention also includes:

[0011] The gene encoding the protein shown in SEQ ID NO.2.

[0012] The gene described above is preferably shown as SEQ ID NO.3.

[0013] A substance expressing the protein shown in SEQ ID NO.2, wherein the substance is an expression frame, a recombinant vector or a recombinant microorganism expressing the protein shown in SEQ ID NO.2.

[0014] Application of the above substances in the preparation of the blue pigment Indigoidine.

[0015] In the above application, the recombinant microorganism is a recombinant Bacillus licheniformis.

[0016] In the above application, preferably, the Bacillus licheniformis is Bacillus licheniformis DW2 (CN115786382A).

[0017] Compared with the prior art, the present invention has the following advantages:

[0018] The present invention uses a site-directed mutagenesis method to mutate the 135th amino acid of the Indigoidine synthase from threonine to isoleucine, the 359th amino acid from glutamic acid to proline, the 369th amino acid from histidine to tyrosine, and the 506th amino acid from histidine to asparagine. The present invention names the mutant M4, which significantly improves the catalytic activity of the Indigoidine synthase in producing Indigoidine at 37°C fermentation, and can greatly improve its ability to produce Indigoidine.

[0019] Through fermentation yield determination and analysis, it was found that compared with the wild-type Indigoidine synthase, the Indigoidine synthase mutant M4 of the present invention showed significantly improved catalytic production of Indigoidine under different temperature conditions, indicating that it is more suitable for industrial production. Experiments have shown that the recombinant strain of Bacillus licheniformis expressing the Indigoidine synthase mutant has excellent Indigoidine production capacity. After fermentation at 37°C for 96 hours, the M4 mutant increased by 297.5% compared with the control strain to reach 3.2±0.12g / L, and at 25°C, it increased by 24.5% compared with the control strain to reach 4.2±0.15g / L. Therefore, the recombinant bacteria expressing the mutant M4 have better prospects for industrial application. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 The yield of mutant and wild-type Indigoidine synthase in 37°C fermentation.

[0021] Figure 2 The yields of mutant and wild-type Indigoidine synthase fermented at 25°C. DETAILED DESCRIPTION

[0022] The technical solutions of the present invention, unless otherwise specified, are conventional solutions in the art; the reagents or materials, unless otherwise specified, are all from commercial channels. In order to make the technical solutions and advantages of the present invention more clear, the present invention is further described in detail below in conjunction with specific examples, but it does not constitute a limitation of the present invention.

[0023] The culture medium involved in the following examples is as follows:

[0024] LB liquid medium: yeast powder 5g·L -1 , Peptone 10 g·L -1 、NaCl 10g·L -1 .

[0025] LB solid medium: yeast powder 5g L -1 , Peptone 10 g·L -1 、NaCl 10g·L -1 , agar powder 13.5 g·L -1

[0026] ME fermentation medium: trisodium citrate 12g·L -1 、(NH4)2SO4 6.2g·L -1 、K2HPO4·3H2O 0.50g·L -1 ,

[0027] MgSO4·7H2O 0.5g·L -1 、CaCl2·2H2O 0.20g·L -1 、FeCl3·6H2O 0.04g·L -1 、MnSO4·H2O

[0028] 0.02g·L -1 pH 7.50.

[0029] The detection methods involved in the following embodiments are as follows:

[0030] Indigoidine fermentation yield detection:

[0031] Mix 100 μL of fermentation broth with 900 μL of DMSO and 2% Tween20 solution. Shake for 10 min to completely dissolve Indigoidine. Centrifuge at 14000 rpm for 2 min, and take 200 μL for analysis at OD612 using a microplate reader. Dilute the extracted Indigoidine in DMSO and 2% Tween20 solution to obtain the exact concentration, and also make a standard curve.

[0032] Embodiment 1:

[0033] Construction of recombinant plasmid pHY-P43-minA and its mutants:

[0034] 1. Using plasmid pHY300PLK as template and 300-GF and 300-GR as primers, PCR amplification was performed to obtain the pHY300PLK linear backbone. The PCR reaction conditions were: 95°C 5min, 30×(95°C 30sec, 55°C 30sec, 72°C 2.5min), 72°C 5min, 12°C 5min.

[0035] Among them, the sequences of 300-GF and 300-GR are:

[0036] 300-GF:TATATATTCCTCCTTTTCTAATATACATT;

[0037] 300-GR:AAGAGCAGAGAGGACGGATTTCCTG.

[0038] 2. According to the theoretical sequence of MinA, minA-F and minA-R were used as primers to amplify the minA gene by PCR. The amplified product was detected by 0.1% agarose gel electrophoresis and the length was 4140 bp, which was the same as the theoretical value.

[0039] Among them, the sequences of minA-F and minA-R are:

[0040] minA-F:ACAAAGGGGGAGATTTGTATGAGCCCTCACGTTATT;

[0041] minA-R:TCCGTCCCTCTCTGCTCTTTTAATAATTTGGGGTTTT.

[0042] 3. Use ExnaseⅡT5 exonuclease to digest and ligate the target gene fragment in step 2 and the backbone in step 1 to obtain a ligation product; transform the ligation product into Escherichia coli DH5α by calcium chloride transformation method, screen it in a medium containing tetracycline hydrochloride resistance at 37°C, and screen out transformants. Perform colony PCR verification on the plasmid of the transformants, and the primers used are: PHY-F, PHY-R;

[0043] pHY-F:GTTTATTATCCATACCCTTAC;

[0044] pHY-R: CAGATTTCGTGATGCTTGTC.

[0045] If the PCR verification result of the transformant is: an electrophoresis band appears at 5205 bp, it means that the minA free expression vector 3 is successfully constructed, and the above transformant is a positive transformant, named: minA free expression vector pHY-minA.

[0046] 4. Using the recombinant plasmid pHY-minA as a template and T135I-F and T135I-R as primers, PCR amplification was performed to obtain the T135I backbone.

[0047] Among them, the sequences of T135I-F and T135I-R are:

[0048] T135I-F: CGCTGGTAATAATACGAACACCTGC;

[0049] T135I-R: TTCGTATTATTACCAGCGATGAGGT.

[0050] 5. Use ExnaseⅡT5 exonuclease to enzymatically cleave the backbone in step 4 to obtain a ligation product; transfer the ligation product into Escherichia coli DH5α by calcium chloride transformation method, screen it in a medium containing tetracycline hydrochloride resistance at 37°C, and screen out transformants. Perform colony PCR verification on the plasmid of the transformants. The primers used are: PHY-F, PHY-R; if the PCR verification result of the transformant is: an electrophoresis band appears at 5205bp, it will be sent to Qingke Biological Company for sequencing. If the sequencing T135I site encoding base mutates as expected, the above transformant is a positive transformant, named: M1 free expression vector pHY-M1.

[0051] 6. According to steps 4 and 5, using pHY-M1 as a template, iteratively use E359P-F, E359-R; H369Y-F, H369Y-R; H506N-F, H506N-R to amplify the backbone, and use ExnaseⅡT5 exonuclease to enzymatically digest and ligate the backbone in step 4 to obtain a ligation product; the ligation product is transferred into Escherichia coli DH5α by calcium chloride transformation method to finally obtain a recombinant Escherichia coli containing pHY-M4, wherein the plasmid pHY-M4 contains a mutated Indigoidine synthase gene as shown in SEQ ID NO.3, encoding the protease shown in SEQ ID NO.2.

[0052] Among them, the sequences of E359P-F, E359-R; H369Y-F, H369Y-R; H506N-F, H506N-R are:

[0053] E359P-F:ACTGTGGCAGGCCGACCTGCGCTA;

[0054] E359P-R: AGGTCGGCCTGCCACAGTAGGTG.

[0055] H369Y-F: ATCCCCCCAATATACAGTTCACC;

[0056] H369Y-R:ACTGTATATTGGGGGGATTCAGGT.

[0057] H506N-F: ACAACCTGCATTGCTCAGCTGGGCA;

[0058] H506N-R:CTGAGCAATGCAGGTTGTCGTGA.

[0059] Embodiment 2:

[0060] Construction of recombinant Bacillus licheniformis DW2 engineered strain

[0061] The recombinant plasmid pHY-M4 obtained in Example 1 was electroporated into Bacillus licheniformis DW2. The transformed Bacillus licheniformis DW2 was spread on a plate containing 20 μg mL -1 The tetracycline-containing LB solid medium was inverted and cultured at 37° C. for 12-15 hours; transformants were picked for colony PCR screening, and pHY-F and pHY-R were used as verification primers. Positive transformants were obtained by PCR verification to obtain the recombinant strain Bacillus licheniformis DW2 / pHY-M4.

[0062] The sequences of pHY-F and pHY-R are:

[0063] pHY-F:GTTTATTATCCATACCCTTAC;

[0064] pHY-R: CAGATTTCGTGATGCTTGTC.

[0065] Embodiment 3:

[0066] Construction of recombinant control engineering bacteria

[0067] The recombinant plasmid pHY-minA obtained in Example 1 was electroporated into Bacillus licheniformis DW2. The transformed Bacillus licheniformis DW2 was spread on a plate containing 20 μg mL -1 The tetracycline-containing LB solid medium was inverted and cultured at 37° C. for 12-15 hours; transformants were picked for colony PCR screening, and pHY-F and pHY-R were used as verification primers. Positive transformants were obtained by PCR verification to obtain the recombinant strain Bacillus licheniformis DW2 / pHY-minA.

[0068] Embodiment 4:

[0069] Application of the recombinant strain Bacillus licheniformis DW2 / pHY-M4 and its control in the fermentation production of Indigoidine (37℃)

[0070] The recombinant Bacillus licheniformis DW2 / pHY-M4 obtained in Example 2 was fermented, and the recombinant strain DW2 / pHY-minA obtained in Example 3 was used as a control.

[0071] The specific steps of seed fermentation are as follows: first, recombinant Bacillus licheniformis DW2 / pHY-M4 and DW2 / pHY-minA were extracted from glycerol tubes in a solution containing 20 μg mL -1 Activate by streaking on LB solid medium containing tetracycline and incubate at 37°C for 20-24 hours. Pick colonies and inoculate into LB medium containing 20 μg mL -1 5 mL LB medium containing tetracycline, 230 r·min -1, temperature 37℃, culture for 10-12h. Then inoculate the activated bacterial solution with 2% (v / v) inoculation volume to contain 20μg·mL -1 In 50 mL of LB liquid medium containing tetracycline, 37°C, 230 r·min -1 After culturing for 10-12 h, the seed solutions of the control group and the experimental group were obtained (OD600 4.0-5.0).

[0072] The specific steps of production fermentation are as follows: 50 mL of ME fermentation medium is placed in a 250 mL Erlenmeyer flask, the seed liquid is transferred to the ME liquid medium at an inoculum rate of 2% (v / v), and the fermentation is carried out at 37°C and 230 r·min. -1 After 96 h of culture, the fermentation broth of the control group and the experimental group was obtained, with 3 replicates in each group.

[0073] The Indigoidine production in the fermentation broth of the experimental group and the control group was tested. The test results are as follows Figure 1 As shown by Figure 1 It can be seen that the yield of DW2 / pHY-M4 is 3.2 g / L, while the yield of the control strain DW2 / pHY-minA is 0.8 g / L. The yield of the mutant engineered bacteria is 297.5% higher than that of the control bacteria.

[0074] Embodiment 5:

[0075] Application of recombinant strain Bacillus licheniformis DW2 / pHY-M4 and its control in fermentation production of Indigoidine (25℃):

[0076] The recombinant Bacillus licheniformis DW2 / pHY-M4 obtained in Example 2 was fermented, and the recombinant strain DW2 / pHY-minA obtained in Example 3 was used as a control.

[0077] The specific steps of seed fermentation are as follows: first, recombinant Bacillus licheniformis DW2 / pHY-M4 and DW2 / pHY-minA were extracted from glycerol tubes in a solution containing 20 μg mL -1 Activate by streaking on LB solid medium containing tetracycline and incubate at 37°C for 20-24 hours. Pick colonies and inoculate into LB medium containing 20 μg mL -1 5 mL LB medium containing tetracycline, 230 r·min -1 , temperature 37℃, culture for 10-12h. Then inoculate the activated bacterial solution with 2% (v / v) inoculation volume to contain 20μg·mL -1 In 50 mL of LB liquid medium containing tetracycline, 37°C, 230 r·min -1 After culturing for 10-12 h, the seed solutions of the control group and the experimental group were obtained (OD600 4.0-5.0).

[0078] The specific steps of production fermentation are as follows: 50 mL of ME fermentation medium is placed in a 250 mL Erlenmeyer flask, the seed liquid is transferred to the ME liquid medium at an inoculum rate of 2% (v / v), and the fermentation is carried out at 37°C and 230 r·min. -1 After 48 h of culture, the medium was transferred to 37°C and 230 r / min. -1 The fermentation culture was continued for 48 h to obtain the fermentation broth of the control group and the experimental group, with 3 replicates in each group.

[0079] The Indigoidine production in the fermentation broth of the experimental group and the control group was tested. The test results are as follows Figure 2 As shown by Figure 2 It can be seen that the yield of DW2 / pHY-M4 is 4.2 g / L, while the yield of the control strain DW2 / pHY-minA is 3.4 g / L. The yield of the mutant engineered bacteria is 24.5% higher than that of the control bacteria.

Claims

1. An indigoidine synthetase mutant M4, wherein the amino acid sequence of the mutant M4 is shown in SEQ ID NO.

2.

2. The gene encoding the protein shown in SEQ ID NO.

2.

3. The coding gene according to claim 2, wherein the coding gene is shown in SEQ ID NO.

3.

4. A substance expressing the protein shown in SEQ ID NO.2, wherein the substance is an expression cassette, a recombinant vector or a recombinant microorganism expressing the protein shown in SEQ ID NO.

2.

5. Use of the substance described in claim 4 in the preparation of the blue pigment Indigoidine.

6. The use according to claim 5, wherein the recombinant microorganism is recombinant Bacillus licheniformis.

7. The use according to claim 6, wherein the Bacillus licheniformis is Bacillus licheniformis ( Bacillus licheniformis )DW2.

Images