Application of Citrus CsNAC21 / 22 Gene in Improving Resistance to Citrus Canker

Abstract

The invention discloses the application of citrus CsNAC21 / 22 gene in improving the resistance to citrus canker, and belongs to the field of gene engineering technology. The CDS sequence of CsNAC21 / 22 gene is shown in SEQ ID NO.1, and the resistance to citrus canker is enhanced by increasing the expression amount of CsNAC21 / 22 gene. Compared with WT plants, plants overexpressing CsNAC21 / 22 gene can significantly reduce the incidence of canker and reduce the lesion area, with the maximum reduction being 60.6% of WT, and the disease index being 60.7% of WT; the increase in the transcription level of citrus CsNAC21 / 22 gene will not have a significant effect on the appearance phenotype and growth of the plant; the citrus CsNAC21 / 22 gene provided by the invention can be used independently as a candidate gene for studying resistance to citrus canker, and can also be used together with other disease-resistant or disease-susceptible genes for molecular breeding of citrus canker resistance, and has great application value.

Description

Technical Field

[0001] The invention relates to the technical field of genetic engineering, and in particular to the application of citrus CsNAC21 / 22 gene in improving the resistance to citrus canker. Background Art

[0002] Citrus is the largest fruit in southern my country and an important economic crop in the world. However, citrus canker has seriously hindered the healthy development of the citrus industry. Citrus canker is caused by Xanthomonas citrisubsp.citri (Xcc), which originated in India, Java and other places. At present, the main citrus producing areas in Fujian, Hunan, Guangdong and other places in my country are seriously affected by citrus canker. The canker bacteria mainly infect citrus leaves, branches, fruits, etc., among which seedlings and young trees are more seriously affected. Diseased trees will experience leaf fall, dead branches, weak tree vigor and fruit drop, which seriously affects the yield and quality of citrus. There are dozens of Rutaceae plants affected by citrus canker, most of which are economic cultivars. Studies have found that sweet orange is most susceptible to the disease, followed by sour orange and grapefruit.

[0003] At present, comprehensive prevention and control strategies are usually adopted to control the damage of citrus canker, with chemical control as the main method and biological control as the auxiliary method. However, chemical control measures are not environmentally friendly, easily pollute the environment, and require a lot of manpower and material resources, while biological control has poor effects and high costs. Therefore, it is urgent to reduce the losses caused by canker by breeding new disease-resistant varieties. However, hybrid breeding has a long cycle and low breeding efficiency. With the rise of molecular biology, people began to study the pathogens themselves and the disease resistance of plants from the perspective of disease-resistant genetic engineering.

[0004] Genetic engineering methods have also been tried in the study of resistance to citrus canker, and some transgenic materials with resistance to citrus canker have been obtained. For example, Chen Shanchun and others obtained Jincheng, Xinhuicheng, and Navelcheng lines that were transgenic with the antimicrobial peptide D gene of the silkworm silkworm that were resistant to citrus canker; the exogenous genes NLS, chit42, Xa21, and PthA were resistant to citrus canker after being transferred to Bingtangcheng, Ponkan, and Sweet Orange; CsBZIP40 is an important transcription factor that responds to citrus canker infection, and it is speculated that it affects the resistance of citrus varieties through the SA pathway; the CsLOB1 gene, as a target protein of the canker pathogen gene PthA, makes citrus more sensitive to canker; CRISPR / Cas9 targeted knockout of the promoter of the citrus canker susceptible gene CsLOB1 can obtain plants with improved resistance to citrus canker.

[0005] NAC transcription factors are one of the largest families of plant transcription factors discovered so far. The parts of NAC transcription factors involved in plant growth and development include the growth of plant secondary cell walls, lateral root growth, leaf senescence, and biosynthesis of secondary metabolites. At the same time, some reports have shown that NAC transcription factors are also involved in plant stress responses. According to bioinformatics analysis of transcriptome sequencing data, it is speculated that 20% to 25% of NAC genes respond to at least one or several stresses. For example, overexpression of MdNAC29 in apples enhances the resistance of apples to drought and salt stress; overexpression of PcNAC1 in Pear can improve the resistance of Pear to Pear Black Spot Infection; overexpression of VvNAC1 in grapes enhances the resistance of grapes to Botrytis cinerea. At present, there is no research and application of using NACs to improve the resistance of citrus to citrus canker. Summary of the invention

[0006] The purpose of the present invention is to provide the application of citrus CsNAC21 / 22 gene in improving citrus canker resistance, so as to provide a functional gene highly related to citrus canker resistance and provide a new candidate gene for breeding citrus canker-resistant varieties using genetic engineering methods.

[0007] To achieve the above objectives, the present invention provides an application of the citrus CsNAC21 / 22 gene in improving resistance to citrus canker. The CDS sequence of the CsNAC21 / 22 gene is shown in SEQ ID NO.1, and increasing the expression level of the CsNAC21 / 22 gene enhances resistance to citrus canker.

[0008] A vector and an engineered bacterium comprising the CsNAC21 / 22 gene, the CDS sequence of the CsNAC21 / 22 gene is shown in SEQ ID NO.1, the vector is an overexpression vector, and the engineered bacterium is a strain comprising the citrus CsNAC21 / 22 gene overexpression vector and used for propagation and infection.

[0009] An application of the above-mentioned vector and engineered bacteria in improving resistance to citrus canker.

[0010] The application of CsNAC21 / 22 gene in the breeding of citrus canker resistant varieties, the CDS sequence of CsNAC21 / 22 gene is shown in SEQ ID NO.1.

[0011] The application of vectors and engineered bacteria containing CsNAC21 / 22 genes in the breeding of varieties resistant to citrus canker. The CDS sequence of the CsNAC21 / 22 gene is shown in SEQ ID NO.1.

[0012] Citrus plants with significantly increased expression levels of CsNAC21 / 22 genes are obtained by genetic engineering methods. The CDS sequence of the citrus CsNAC21 / 22 gene is shown in SEQ ID NO.1.

[0013] Therefore, the application of the citrus CsNAC21 / 22 gene provided by the present invention in improving resistance to citrus canker has the following specific technical effects:

[0014] (1) Compared with WT plants, plants overexpressing CsNAC21 / 22 genes can significantly reduce the severity of ulcer disease and the area of ​​lesions, with the maximum reduction being 60.6% of WT and the disease index being 60.7% of WT;

[0015] (2) The reduction of citrus CsNAC21 / 22 gene transcription level will not have a significant effect on the plant's appearance phenotype and growth potential;

[0016] (3) The citrus CsNAC21 / 22 gene provided by the present invention can be used independently as a candidate gene for studying citrus canker resistance, and can also be used together with other disease resistance or disease susceptibility genes for molecular breeding of citrus canker resistance, which has great application value.

[0017] The technical solution of the present invention is further described in detail below through the accompanying drawings and embodiments. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings required for use in the description of the embodiments of the present invention will be briefly introduced below. Obviously, the accompanying drawings in the following description are only some embodiments of the present invention. For ordinary technicians in this field, other accompanying drawings can be obtained based on these accompanying drawings without paying creative labor.

[0019] Figure 1 The bioinformatics characteristics of the CsNAC21 / 22 gene in Example 1 of the present invention, wherein A is the chromosome location of the citrus CsNAC21 / 22 gene, and bp represents bases; B is the gene structure of citrus CsNAC21 / 22; C is the functional domain of the citrus CsNAC21 / 22 gene, and aa represents amino acids;

[0020] Figure 2 This is the electrophoresis diagram of PCR amplification of the CDS clone of the CsNAC21 / 22 gene in Example 2 of the present invention, wherein CDS represents the coding sequence of the CsNAC21 / 22 gene; M represents a DNA molecular weight standard;

[0021] Figure 3The structure diagram of the CsNAC21 / 22 gene overexpression vector in Example 3 of the present invention, wherein GUS represents the β-glucosidase gene; CaMV 35S represents the plant constitutive promoter derived from cauliflower mosaic virus; NOS represents the opine synthase gene terminator;

[0022] Figure 4 This is a flow chart of citrus genetic transformation in Example 4 of the present invention;

[0023] Figure 5 This is a GUS staining image of the transgenic plant in Example 5 of the present invention, wherein OE-NAC-1, OE-NAC-2, and OE-NAC-3 represent transgenic plants, respectively, and WT represents a wild-type Wanjin Orange plant;

[0024] Figure 6 The electrophoresis diagram of PCR identification of transgenic plants in Example 5 of the present invention, wherein M represents a DNA molecular weight standard, OE-NAC-1, OE-NAC-2, and OE-NAC-3 represent transgenic plants, WT represents a wild-type Wanjin Orange plant, and + represents a plasmid pLGNe-CsNAC21 / 22;

[0025] Figure 7 The relative expression analysis results of CsNAC21 / 22 in transgenic plants in Example 5 of the present invention, where *** indicates a significant difference compared with WT (P < 0.001);

[0026] Figure 8 The phenotype photos of the transgenic plants in Example 5 of the present invention, wherein OE-NAC-1, OE-NAC-2, and OE-NAC-3 represent transgenic plants, respectively, and WT represents a wild-type Wanjin Orange plant;

[0027] Fig. 9 This is a photo of the transgenic plant leaves inoculated with canker bacteria on the 10th day in Example 6 of the present invention, wherein OE-NAC-1, OE-NAC-2, and OE-NAC-3 represent transgenic plants, and WT represents a wild-type Wanjin orange plant;

[0028] Fig.10 The statistical results of the lesion size on the 10th day after the leaves of the transgenic plants were inoculated with the canker bacteria in Example 6 of the present invention, wherein OE-NAC-1, OE-NAC-2, and OE-NAC-3 represent transgenic plants, and WT represents a wild-type Wanjin orange plant;

[0029] Fig.11 The disease index statistics of the transgenic plant leaves inoculated with canker bacteria on the 10th day in Example 6 of the present invention are shown, wherein OE-NAC-1, OE-NAC-2, and OE-NAC-3 represent transgenic plants, and WT represents a wild-type Late Jincheng orange plant. DETAILED DESCRIPTION

[0030] The technical solution of the present invention is further described below through the accompanying drawings and embodiments.

[0031] In order to make the purpose, technical scheme and advantages of the present application clearer, more thorough and more complete, the technical scheme of the present invention is clearly and completely described below through the accompanying drawings and examples. The following detailed descriptions are all descriptions of the embodiments, and are intended to provide further detailed descriptions of the present invention. Unless otherwise specified, all technical terms used in the present invention have the same meaning as those generally understood by those skilled in the art to which the present application belongs.

[0032] The instruments, equipment, reagents and materials used in the examples were obtained from commercial sources, and methods not otherwise specified are conventional methods in the art.

[0033] Embodiment 1

[0034] Bioinformatics Analysis of Citrus CsNAC21 / 22 Genes

[0035] The citrus CsNAC21 / 22 gene is located between 34713467bp and 34717763bp on chromosome 5 of citrus, with a total length of 50232142bp and a CDS sequence of 975bp. The CDS sequence is shown in SEQ ID NO.1 and can encode 324 amino acids. The CsNAC21 / 22 protein sequence was analyzed and the results were as follows: Figure 1 As shown, CsNAC21 / 22 protein has a distinct NAC-domain structural functional domain.

[0036] SEQ ID NO.1

[0037] ATGAGCAGCAGCAACAACAGTAATAATAACATAAGAATGGTGGAGGCTCAGTTGCCACCAGGGTTTAGGTTTCATCCGAGAGACGATGAACTTGTTTGTGATTATTTGATGAAGAAGGTCACTCACACCAATGAATCCATTCTTTTGGCTGCAGTTGATCTCAACAAGTGTGAGCCTTGGGACATTCCTGAAACTGCATGTGTTGGAGGCAAAGAATGGTATTTTTACAGTCAGCGTGATCGAAAATATGCAACAGGACTAAGAACAAACCGCGCCACGGCATCTGGATACTGGAAGGCCACCGGAAAAGATCGAGCCATCCTTCGAAAGGGCAGCCTTGTCGGTATGAGAAAAACCTTGGTGTTTTATCGAGGTAGGGCACCAAAAGGGAAAAAAACTGAATGGGTAATGCATGAATTTCGGCTTGAAGGTCCCTTTGCTAATTCTCCTAAGGTTTCGTCTCTCAAGGAAGATTGGGTGTTGTGTAGAGTGTTTTACAAAAAGAGAGAAGTTCCTGGCCAACAGAGCATGGGAAGCTGCAGCTATGACGACACAGGCTCTTCATCACTCCCACCATTAATGGACTCTTACATCACTTTTGACCAAACTCTACCAAATTTTCAAGATAATTATAATGAGCTTGTGTCCTGCTTCTCCATACTTTCATCCTCCCAACAAGACCAAATTATTACCAACAACCCAATTTTCACCCATTTCAATCATTCTGAGCCAAACAATATTATTTCCACAAAAAATTCAACCACATTTGGAAAAAATATACCAGTGGGAACTGATTGCTTAGACCCTGTTGCTTGTGATAAGAAGGTCATAAAAGCTGTCTTGAATCAGCTTACCAAGATTGAAAGCAATGTTCCTAATATGCAAGGATCATCACCAAGCTTAGGAGAACCAAGTCCAGACAGCTACTTATCTGAAGTAGGCATGCCAACAAACATGTGGAATCATCATTATTGA

[0038] Embodiment 2

[0039] Cloning of the coding sequence of Citrus CsNAC21 / 22

[0040] 1. RNA extraction and cDNA synthesis

[0041] Total RNA from citrus (Wanjincheng) leaves was extracted using a plant total RNA extraction kit (Adlai, CAT: RN09), the RNA quality was verified by agarose gel electrophoresis, and its concentration was measured by a concentration meter. cDNA was synthesized using a reverse transcription kit PrimeScript RTMasterMix (TaKaRa, CAT: RR036A).

[0042] 2. PCR amplification of CsNAC21 / 22 coding sequence

[0043] Primers OE-CsNAC21 / 22-F (sequence as shown in SEQ ID NO.2), OE-CsNAC21 / 22-R (sequence as shown in SEQ ID NO.3) and high-fidelity enzyme PrimeSTAR Max DNA Polymerase (TaKaRa, CAT: R045Q) were used for amplification from citrus cDNA. The amplification system was prepared according to the instructions attached to the high-fidelity enzyme PrimeSTAR Max DNA Polymerase. The PCR amplification program was: 98°C, 5min; 98°C, 30s, 56°C, 30s, 72°C, 1.5min, 35 cycles; 72°C extension for 10min.

[0044] SEQ ID NO.2: GGAATTCCATGAGCAGCAGCAACAACAGTAATAATAAC

[0045] SEQ ID NO.3:CGGATCCGTCAATAATGATGATTCCACATGTTTGTTGG

[0046] The amplified products were subjected to agarose gel electrophoresis. Figure 2 As shown, a DNA fragment of the CsNAC21 / 22 coding sequence was obtained, and the fragment length was 975 bp. The amplified DNA fragment was sequenced and sequenced to determine that it was the coding sequence of the citrus CsNAC21 / 22 gene (the sequence is shown in SEQ ID NO.1). Under ultraviolet light, a clean blade was used to cut out the agarose gel block containing the target fragment, and a kit (BioFlux, CAT: BSC02M1) was used to recover the DNA fragment.

[0047] Embodiment 3

[0048] Construction of CsNAC21 / 22 overexpression vector and transformation of Agrobacterium

[0049] 1. Construction of overexpression vector

[0050] The CsNAC21 / 22 coding sequence DNA fragment obtained in Example 2 and the overexpression vector pLGNe were double digested with restriction endonucleases KpnⅠ and SalⅠ (ThermoFisher), recovered by gel recovery kit and ligated at 16°C overnight. The ligation was carried out using T4 DNA Ligase kit (Promega, CAT: M1801). The ligation system was carried out according to the instructions attached to the enzyme, and the enzyme digestion system and method were carried out according to the instructions attached to the enzyme.

[0051] The obtained ligation product was transformed into E. coli DH5α by the method described in the instruction manual of E. coli DH5α. The plasmid of the positive clone was extracted using a plasmid extraction kit (Omega, CAT: D6942) to obtain the CsNAC21 / 22 overexpression vector pLGNe-CsNAC21 / 22. The vector structure diagram is shown in Figure 3 .

[0052] 2. Transformation of Agrobacterium with overexpression vector

[0053] The constructed overexpression vector was introduced into Agrobacterium tumefaciens EHA105 by electroporation. The specific steps are as follows:

[0054] Take the frozen Agrobacterium competent cells EHA105 (50 μL) in advance and melt them on ice; add 2 μL of the plasmid of the overexpression vector to the competent cells, mix them by blowing, and place them on ice for 5 minutes; transfer the mixed solution to the bottom of the electric shock cup that has been blown dry in advance, put the electric shock cup into the card slot and adjust it to the correct position, adjust the electric shock device to the "Agr" gear, press the electric shock button, check the electric shock data to ensure that the electric shock is successful; add 1 mL of LB liquid culture medium to the electric shock cup, mix them by blowing with a pipette, transfer them to a sterile centrifuge tube, and shake and culture them at 260 r / min and 28°C for 60 minutes; centrifuge the bacterial solution at 10000 r / min for 1 minute, discard the supernatant (about 100 μL of resuspended bacteria remain), and after resuspension, spread it on LB solid culture medium containing 50 mg / L kanamycin, and invert and culture it in the dark at 28°C for 2 days.

[0055] After the plaques grew, the primers OE-CsNAC21 / 22-F (sequence as shown in SEQ ID NO.2) and OE-CsNAC21 / 22-R (sequence as shown in SEQ ID NO.3) and the high-fidelity enzyme PrimeSTAR Max DNA Polymerase (TaKaRa, CAT: R045Q) were used to verify the single colony by PCR. The amplification system was prepared according to the instructions attached to the high-fidelity enzyme PrimeSTAR Max DNA Polymerase, and the PCR reaction conditions were: 94°C for 3min; 94°C for 30s, 58°C for 30s, 72°C for 30s, 30 cycles; 72°C for 10min.

[0056] The verified correct colonies are the positive clones of the overexpression vector pLGNe-CsNAC21 / 22 containing CsNAC21 / 22.

[0057] Embodiment 4

[0058] Genetic transformation of citrus with CsNAC21 / 22 overexpression vector

[0059] according to Figure 4 The process shown in the figure is used for citrus genetic transformation. The specific operations are as follows:

[0060] 1. Obtaining epicotyls of citrus seedlings

[0061] Fresh citrus fruits were washed and surface disinfected with 70% alcohol. The seed coats were peeled off in a clean bench, and the seeds were taken out. The seeds were placed in a seed germination medium and cultured in the dark at 28°C for 2 weeks, and then cultured under 16 h light / 8 h dark conditions for 1 week. The epicotyls of the germinated seedlings were taken under sterile conditions and cut into 1 cm stem segments for Agrobacterium tumefaciens-mediated genetic transformation.

[0062] 2. Preparation of Agrobacterium tumefaciens culture solution

[0063] Before transfection, the positive Agrobacterium (containing the pLGNe-CsNAC21 / 22 vector) obtained in Example 3 was streaked on LB solid medium containing 50 mg / L kanamycin; a single colony was picked and inoculated into 25 mL of LB liquid medium containing the same antibiotics, and cultured overnight at 28°C with shaking; the bacterial solution was diluted to OD = 0.1 and then continued to be cultured to OD = 0.5, centrifuged at 5000 r / min for 10 min, the supernatant was discarded, and the solution was resuspended in MS liquid medium at pH 5.4 for transfection.

[0064] 3. Transformation of citrus epicotyls

[0065] The citrus epicotyl stem segments obtained in step 1 were soaked in the Agrobacterium solution prepared in step 2 for 13 minutes, then dried with sterile filter paper, and the stem segments were transferred to the co-cultivation medium and cultured in the dark at 26°C for 2 days. After the co-cultivation was completed, the epicotyls were transferred to the screening medium, cultured in the dark at 28°C for 7 days, and then transferred to 28°C, 16h light / 8h dark conditions for culture, subcultured every two weeks, and then subjected to GUS staining for identification.

[0066] 4. Seedling culture of transformants

[0067] When the seedlings grow to more than 1 cm, they are cut and grafted onto late orange seedlings in sterile test tubes and cultured in seedling medium; when the seedlings grow to about 5 cm, they are grafted onto citrus aurantium seedlings and cultured in a 28°C greenhouse.

[0068] The culture medium components used in this example are as follows:

[0069] Seed germination medium: MS + 30 g / L sucrose + 2.5 g / L Gelrite, pH 5.8.

[0070] Co-culture medium: MS + 2 mg / L BA + 0.5 mg / L IAA + 1 mg / L 2,4-D + 100 μmol AS + 30 g / L sucrose + 2.5 g / L Gelrite, pH 5.8.

[0071] Screening medium: MS + 2 mg / L BA + 0.5 mg / L IAA + 500 mg / L Cef + 50 mg / L Kan + 30 g / L sucrose + 2.5 g / L Gelrite, pH 5.8.

[0072] Seedling medium: MS + 30g / L sucrose, pH 5.8.

[0073] Embodiment 5

[0074] Verification of CsNAC21 / 22 overexpressing transgenic plants

[0075] 1. GUS staining identification of transgenic plants

[0076] The leaves of the transgenic plants obtained by the GUS staining method in Example 4 were cut into leaf discs (7 mm in diameter) and subjected to GUS histochemical staining (24 h). The leaves of the late orange seedlings without any treatment (WT) were used as the control. The results are as follows: Figure 5 As shown, the staining solution and the edge of the leaf block of the positive plant both showed blue color, while the staining solution and the edge of the leaf block of the WT plant did not show color.

[0077] 2. PCR identification of transgenic plants

[0078] 100 mg of leaves from transgenic plants were collected, and genomic DNA was extracted using a DNA extraction kit (Adlai, CAT: DN15). PCR was used to detect the integration of the CsNAC21 / 22 coding sequence in the citrus genome. The detection primers were ID-CsNAC21 / 22-F (sequence as shown in SEQ ID NO.4) and ID-CsNAC21 / 22-R (sequence as shown in SEQ ID NO.5). The amplification system was prepared according to the instructions attached to the high-fidelity enzyme PrimeSTAR Max DNA Polymerase. The PCR reaction conditions were: 94°C for 3 min; 94°C for 30 s, 58°C for 30 s, 72°C for 30 s, 30 cycles; 72°C for 10 min.

[0079] SEQ ID NO.4:TCGTTGAAGATGCCTCTGCCGACAG

[0080] SEQ ID NO.5:CGGATCCGTCAATAATGATGATTCCACATGTTTGTTGG

[0081] The results are as follows Figure 6 As shown, a 1197 bp amplified fragment was obtained in the positive plants, while no amplification was obtained in the WT plants.

[0082] 3. qRT-PCR analysis of transgenic plants

[0083] Total RNA from leaves of transgenic plants was extracted using a kit (Adlai, CAT No: RN09), and cDNA was synthesized using a reverse transcription kit PrimeScript RT Master Mix (TaKaRa, CAT: RR036A). The expression of the target gene was detected by qRT-PCR. The detection primers were RT-CsNAC 21 / 22-F (sequence as shown in SEQ ID NO.6) and RT-CsNAC21 / 22-R (sequence as shown in SEQ ID NO.7). The qRT-PCR reaction conditions were: 95℃3min, 94℃10s; 56℃10s, 72℃10s, 40 cycles; 72℃10min. 2 -△△Ct The relative expression of CsNA C21 / 22 genes in transgenic plants was calculated by the following method: the water-treated sample was defined as the reference factor, i.e., its CsNA C21 / 22 expression level was 1, and then the multiple of the gene expression in transgenic citrus relative to the reference factor was calculated. -△△Ct , is its relative expression level.

[0084] SEQ ID NO.6: AGGTTTCATCCGAGAGACGATG

[0085] SEQ ID NO.7:TTTGCCTCCAACACATGCAG

[0086] The results are as follows Figure 7 As shown, the CsNAC21 / 22 gene was expressed at a higher level in the transgenic plants than in the wild-type plants (up to 200 times that of the control).

[0087] 4. Phenotypic observation of transgenic plants

[0088] Some photos of transgenic plants and WT plants are shown in Figure 8 As shown by Figure 8 It can be seen that compared with WT, the transgenic plants had no obvious abnormalities in appearance and growth, indicating that overexpression of the CsNAC21 / 22 gene did not have a significant effect on the phenotype and development of the plants.

[0089] Embodiment 6

[0090] Evaluation of resistance to canker disease in transgenic plants overexpressing CsNAC21 / 22

[0091] The mature leaves of the transgenic plants were washed with clean water, disinfected with 75% alcohol and rinsed with sterile water, placed on a clean bench, and punctured with a needle at the center of the leaf vein. The ulcer pathogen liquid was applied with a pipette, and 1 μL (1×10 5 CFU / mL), cultured in a 28°C constant temperature and light incubator (16 h light / 8 h dark), and photographed on the 10th day after the leaf was spotted with bacteria. Fig. 9 Then, Image J V1.47 software was used to count the lesion area in the photos. Fig.10 .

[0092] The disease is divided into grades 0-7 according to the area of ​​the lesions, with the letter R representing the area of ​​the lesions:

[0093] Grade 0 (R≤0.5mm 2 ); Level 1 (0.5mm 2 <R≤1.0mm 2 ); Level 2 (1.0mm 2 <R≤1.5mm 2 ); Level 3 (1.5mm 2 <R≤2.0mm 2 ); Level 4 (2.0mm 2 <R≤2.5mm 2 ); Level 5 (2.5mm 2 <R≤3.0mm 2 ); Level 6 (3.0mm 2 <R≤3.5mm 2 ); Grade 7 (R>3.5mm 2 ).

[0094] The disease index was calculated according to the formula: DI = 100 × Σ [number of lesions at each level × corresponding level value] / (total number of lesions × maximum level). Fig.11 shown.

[0095] Depend on Fig. 9 It can be seen that on the 10th day after inoculation with the ulcer pathogen, the overexpression plants and the WT plants grafted at the same time developed disease to varying degrees after inoculation with the ulcer pathogen, and there were certain differences in the size of the lesions. Statistical analysis found that the lesion area of ​​the transgenic plants was significantly smaller than that of the wild-type control, which was 60.6%-85.6% of the control ( Fig.10 The disease index of transgenic plants was significantly lower than that of wild-type controls, ranging from 60.7% to 94.4% of that of controls ( Fig.11 ). It can be seen that overexpression of CsNAC21 / 22 can significantly reduce the lesion area of ​​citrus bacterial canker and alleviate the severity of citrus bacterial canker.

[0096] Therefore, compared with WT plants, plants overexpressing the CsNAC21 / 22 gene can significantly reduce the incidence of ulcer disease and reduce the area of ​​lesions, with the maximum reduction being 60.6% of WT and the disease index being 60.7% of WT; the increase in the transcription level of the citrus CsNAC21 / 22 gene will not have a significant effect on the plant's appearance phenotype and growth potential; the citrus CsNAC21 / 22 gene provided by the present invention can be used independently as a candidate gene for studying resistance to citrus canker disease, and can also be used together with other disease-resistant or disease-susceptible genes for molecular breeding of citrus canker disease resistance, which has great application value.

[0097] Finally, it should be noted that the above embodiments are only used to illustrate the technical solution of the present invention rather than to limit it. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that they can still modify or replace the technical solution of the present invention with equivalents, and these modifications or equivalent replacements cannot cause the modified technical solution to deviate from the spirit and scope of the technical solution of the present invention.

Claims

1. CsNAC21 / 22 The application of the gene in improving resistance to citrus canker is characterized by: CsNAC21 / 22 The CDS sequence of the gene is shown in SEQ ID NO.1, which improves CsNAC21 / 22 The expression level of the gene increases the resistance to citrus canker.

2. A method comprising the method as claimed in claim 1 CsNAC21 / 22 Application of a gene overexpression vector and an engineered bacterium containing the vector in improving resistance to citrus canker.

3. CsNAC21 / 22 The application of the gene in the breeding of varieties resistant to citrus canker is characterized by: CsNAC21 / 22 The CDS sequence of the gene is shown in SEQ ID NO.

1.

4. Inclusion CsNAC21 / 22 The use of a gene overexpression vector and an engineering bacterium containing the vector in the breeding of varieties resistant to citrus canker is characterized by: CsNAC21 / 22 The CDS sequence of the gene is shown in SEQ ID NO.1.

Images