58results about How to "Significant application value" patented technology

The invention discloses a method for efficiently and artificially inducing triploid grass carps, which comprises the following steps: (1) collecting sperms and ova of grass carps, and carrying out artificial insemination; (2) carrying out cold shock treatment on the fertilized eggs of the grass carps, wherein the cold shock treatment is that the fertilized eggs are placed in water at the temperature of 4-6 DEG C for 10-12 minutes; and incubating the fertilized eggs to obtain the triploid grass carp.

The invention discloses a composite hydrogel, a composite aerogel, a preparation method and an application. The preparation method of the composite hydrogel comprises the following steps: irradiating a mixed solution A with high-energy rays; wherein the mixed solution A comprises graphene oxide, an inorganic nano material, monomers of acrylic acid and derivatives thereof, water and an alcohol water-soluble compound; the inorganic nano material is selected from one or more of an MXene two-dimensional lamellar material, a metal oxide and a metal sulfide; in the mixed solution A, the content of the graphene oxide is 0.05-10 mg / mL, the mass ratio of the graphene oxide to monomers of acrylic acid and derivatives thereof is 1: (50-1000), and the mass ratio of the graphene oxide to the inorganic nano-material is 1: (0.1-100); the alcohol water-soluble compound accounts for 2-50% of the mixed solution A in percentage by mass. When the composite hydrogel and the composite aerogel are applied to the field of solar photo-thermal water evaporation, an evaporator is not prone to being blocked.

The invention relates to the technical field of sewage treatment. The invention discloses an anaerobic ammonium oxidation bacteria, short-cut nitrifying bacteria and microalgae coupling system and a domestication method thereof, which are characterized in that three autotrophic microorganisms with different oxygen requirements are sequentially domesticated by a biological filler according to a sequence of an inner layer, a middle layer and an outer layer to form dissolved oxygen gradient region change. Wherein the microalgae form an oxygen production area in the outer photosynthesis, and the dissolved oxygen concentration in the area is the highest. Short-cut nitrifying bacteria domesticated on the middle-layer biological filler consume oxygen, and the concentration of dissolved oxygen is lower than that of dissolved oxygen in the outer-layer biological filler area. The dissolved oxygen in the inner-layer biological filler area can reach the lowest level, so that the anaerobic ammonium oxidation bacteria can survive suitably, and the stable denitrification of anaerobic ammonium oxidation is ensured. Therefore, the biological membrane obtained by the domestication method provided by the invention is more stable, the mass transfer of the dissolved oxygen is more uniform than that of the traditional mechanical point source aeration, and the influence of the dissolved oxygen on the interior is smaller, so that the treatment effect is more stable. The anaerobic ammonium oxidation bacteria, short-cut nitrifying bacteria and microalgae coupling system does not need aeration, does not need additional organic carbon sources, can absorb CO2 to realize negative emission, is energy-saving and efficient, meets the requirements of dual carbon and green water plant transformation in China, and has important utilization value.

The invention discloses a data assimilation analysis system based on an object-oriented framework, and the system comprises the steps: obtaining assimilation parameters, defining an analysis variable space for the assimilation parameters through an unstructured grid framework module, and carrying out the distribution collection and boundary exchange calculation through a geometric grid and parallel algorithm communication module MPDD, a control variable, an observation variable, a covariance matrix, various transformation operators and a solver module are constructed, a multivariable price function and a price function gradient are established, the system transmits the multivariable price function and the price function gradient to a universal minimization solver, an analysis field is made to approach an observation result through iterative solution, and the price function gradient is obtained. Other points except the observation position are diffused outwards in the mode of the covariance matrix to influence other mode grid points, and an assimilation analysis field result is obtained. According to the method, rapid expansion and easy replacement of various different space variables, observation operators, covariance matrix schemes, multivariable solvers and the like are realized, and the flexibility and adaptability of a data assimilation analysis system are improved.

The invention provides an application of a Brawtella strain in regulation of intestinal flora and prevention and treatment of Parkinson's disease. The invention also provides application of the strain in preparation of probiotic preparations and preparation of drugs for preventing and treating Parkinson's disease, and the strain can change intestinal flora and influence the function of a central nervous system through an'intestine-brain axis' so as to treat and prevent Parkinson's disease.

The utility model relates to a drilling rod grabbing manipulator, and belongs to the technical field of mining drilling machines. The manipulator is arranged on the drill rod box sliding rail and comprises a lifting joint, a rotating joint, a telescopic joint and a clamping jaw; the rotating joint is connected with the lifting joint through a cross beam; the lifting joint comprises a lifting oil cylinder, a lifting outer barrel and a lifting inner barrel; the rotating joint comprises a rotating driver and a rotating shaft; the rotating shaft is rotationally arranged in an inner cavity of the cross beam, a protruding part is arranged on the outer side of the rotating shaft, an arc groove matched with the protruding part is formed in the inner cavity of the cross beam, and when the rotating shaft rotates, the protruding part slides in the arc groove in the circumferential direction, so that rotating limiting of the rotating shaft is achieved; the telescopic joint comprises a telescopic oil cylinder, a telescopic outer barrel and a telescopic inner barrel. According to the drilling rod grabbing method, the position of the clamping jaw is adjusted through the lifting joint, the rotating joint and the telescopic joint, so that the clamping jaw can accurately grab or put down a drilling rod. The grabbing manipulator solves the problem that an existing grabbing manipulator cannot meet the requirement for drilling in a full-section and full-dip-angle range.

The present invention provides a wheat fertility-related gene TaMS8 and an application method thereof, and belongs to the field of biotechnology. The present invention obtains a recessive single gene-controlled male sterility material by phenotypic screening and genetic analysis of an EMS mutagenesis library, and then obtains the wheat fertility-related gene TaMS8 by a Mutmap method, and regulates the expression of the gene to regulate plant fertility, so as to produce and maintain a wheat male sterile line and prepare hybrid seeds, which has important theoretical and practical significance for establishing an efficient wheat hybrid seed production technology, and studying the mechanism of wheat male sterility and hybrid vigor.

The present invention relates to a circulation system for cleaning and purifying floating dust on the inner wall of a steel pipe, which comprises a support frame, a working cleaning system, a purification system installed in a cylinder, an ash unloading system, a clean air chamber and a fan, a circulation pipeline, a steel pipe and a pipeline connecting device. The working cleaning system comprises a frame, a transmission device and a guide device installed on the frame, and the cyclone power working part throws the flocculent flexible wear-resistant material into a circular arc and flushes the inner wall of the steel pipe to clean the floating dust on the inner wall of the steel pipe. The purification system is equipped with a filter device and a vibrator. The ash unloading system is arranged below the ash hopper. The clean air chamber and the fan are arranged above the purification system. The present invention utilizes the purified gas to drive the cyclone working cleaning system through the wind energy flowing through the circulation pipeline to remove the floating dust on the inner wall of the steel pipe, so that the floating dust falls into the ash hopper after purification and is discharged by the ash unloading system, and the purified gas is transferred to the output pipeline for the wind energy driving working system to be circulated.

The invention relates to the technical field of agricultural automation control, and particularly discloses a honeysuckle polyploidy cultivation environment regulation and control system based on intelligent sensing, and the system comprises a multi-source fusion sensing module which is used for collecting environment and plant physiological data; the physiological state interpretation and stage recognition module is used for judging a growth stage through a deep learning model; the dynamic environment strategy generation module is used for dynamically generating an environment target value according to the stages and the physiological parameters; and the cooperative execution control module is used for controlling a cooperative executor through hierarchical prediction to realize accurate regulation and control. According to the method, accurate matching of environment regulation and real-time physiological needs of plants can be achieved, the induction success rate and the seedling robustness are improved, and meanwhile energy consumption is reduced.

This invention provides a heat stress-related transcriptional repressor and its applications. Based on ATAC-seq data from heat stress chromatin accessibility sequencing of *Nymphoides oleracea*, this transcriptional repressor was identified. Further comparative genomics was used to screen for its collinear homologous sequences in rice, conducting heterologous functional studies to explore its cross-species universality in gramineous crops. The study found that knocking out this regulatory sequence in rice significantly upregulated the expression of the gene LOC_Os08g06320 compared to the wild type, verifying the transcriptional repressive activity of this sequence. Furthermore, this invention is the first to construct a recombinant vector containing this repressor, achieving artificial regulation of target gene expression. This discovery provides a new research direction for crop breeding and has significant breeding significance and development prospects. Compared with existing technologies, this invention is the first to identify and verify this heat stress-related repressor in *Nymphoides oleracea* and rice, providing a new gene tool for crop stress resistance and genetic improvement, and possessing significant application value.

The present invention provides an sgRNA target sequence for increasing rice grain shape, including an sgRNA1 target and an sgRNA2 target, wherein the sgRNA1 target sequence is CTCCCGCATGACGACGGAGT, and the sgRNA2 target sequence is CAGCGCTGTGATCGAGAAGA. The present invention also provides a recombinant vector comprising the sgRNA target sequence and its application. The present invention performs site-directed editing on a specific sequence of a rice qGL3 gene through CRISPR / Cas9 gene editing technology, and after gene mutation, the grain length, grain width and grain weight of rice can be increased, providing gene resources and technical ideas for research on rice grain shape improvement.

The invention discloses a depression prognosis prediction model construction method, system and device, a medium and application, and belongs to the field of depression prognosis prediction.The construction method comprises the following steps that mGLUR5 receptor availability PET images and T1 weighted MRI images of different patients are obtained; preprocessing the image; and constructing a model. The construction method is based on an advanced molecular imaging technology, the availability change of mGluR5 is measured, and the constructed depression prognosis prediction model has great innovation and application values. The built depression prognosis prediction model and the system, equipment and medium thereof have excellent measurement stability and reliability. The invention further discloses application of the mGluR5 as the biomarker in construction of a depression prognosis prediction model, and by accurately evaluating the availability of the mGluR5, a doctor can adjust a treatment scheme and estimate a prognosis effect according to the specific biomarker of each patient.

The invention discloses an ultra-deep underwater concrete pouring guide pipe with a flexible mixing device and a using method thereof.The pouring guide pipe comprises a plurality of pipe joints connected in sequence, and detachable flexible deflection baffles are arranged at the bottom end of the tail pipe joint and the connecting position of the adjacent pipe joints; the deflection baffle plate applies lateral and upward force to the concrete liquid falling from the guide pipe, so that when the concrete liquid flows through the deflection baffle plate, part of the concrete liquid deflects towards the lateral upper part in the flowing direction and then falls down; and the resultant force direction of the lateral force applied to the concrete liquid by the two vertically adjacent deflection baffles rotates by an angle alpha relative to the axis of the guide pipe. According to the construction environment, the ratio of the flexible deflection baffle to the pipe joint is determined, alpha is set, when the air resistance effect is large, the speed restraining joint is additionally installed, and the air resistance effect is further reduced. The air resistance effect can be remarkably reduced, the flowability and uniformity of concrete are improved, the aggregate separation and segregation phenomena are reduced, and the construction efficiency and quality in the ultra-deep underwater concrete pouring process are improved.

The invention discloses application of a substance for inhibiting Yp1842 protein expression quantity and / or activity in reducing yersinia pestis virulence. The amino acid sequence of the Yp1842 protein is as shown in SEQ ID NO: 2. 100CFU plague bacillus yp1842 and 201 plague bacillus strains are subcutaneously injected into the groin of the Bal b / c mouse, and then the mouse is normally fed for 14 days; the survival condition of the mouse is observed during the period. The result shows that compared with 201 strains of plague bacillus, the toxicity of the plague bacillus yp1842 is obviously reduced. Therefore, the Yp1842 protein has an important influence on the virulence of the yersinia pestis. The method has great application value.

The utility model discloses a multi-station collaborative efficient filter pressing system which comprises a station support, a driving mechanism, a filter pressing main machine and at least two material distributing machines, the driving mechanism and the filter pressing main machine are arranged on the station support, and the output end of the driving mechanism is connected with the filter pressing main machine and used for driving the filter pressing main machine to do linear reciprocating motion on the station support; each material distributing machine is arranged on one side of the station bracket and is arranged along the moving direction of the filter pressing main machine, a material frame is correspondingly arranged on each material distributing machine, and an oil cylinder on each material distributing machine can drive the material frame to reciprocate on the material distributing machine and the station bracket. Through cross-process time sequence reconstruction and multi-equipment parallel cooperation, serial waiting of a traditional filter pressing system is converted into asynchronous rotation, and multiple improvement breakthrough of the equipment utilization rate, the production efficiency and process automation is achieved in a large-yield dehydration scene.

The invention discloses a preparation method and application of ganoderma lucidum outer vesicles without sporocarp waste sources. The ganoderma lucidum external vesicles are used for preparing medicines for treating ischemic cerebral apoplexy sequelae, and can improve core symptoms such as dyskinesia (including limb paralysis, imbalance and gait abnormity), cognitive decline and the like after apoplexy. The spore-free sporocarp waste sourced ganoderma lucidum outer vesicles are prepared from spore-free sporocarp waste which is completely released by spores after a ganoderma lucidum powder spraying period through raw material pretreatment, differential centrifugation, tangential flow concentration and filter membrane filtration. According to the preparation method, the waste is used as a raw material to prepare the high-value medical outer vesicle, green circulation of agricultural waste-high-added-value medical raw materials is achieved, the ganoderma lucidum outer vesicle can effectively penetrate through the blood-brain barrier, brain-targeted delivery is achieved, and the problems that traditional ganoderma lucidum active ingredients are low in blood-brain barrier penetration rate and poor in blood-brain barrier penetration rate are solved. The effective treatment concentration in the brain tissue is difficult to achieve, and the traditional drug delivery bottleneck is broken through.

The utility model discloses a cooling device of lathe main shaft, including the casing, the main shaft through bearing installation in the casing, install the sealing cover at the casing end portion department, set up the liquid inlet and the liquid outlet on the casing, the inner chamber of casing is cylindrical, be provided with the helical flow guide vane in the casing, the liquid inlet and the liquid outlet are located respectively at the both ends near department of flow guide vane, the clearance between the inner edge of flow guide vane and main shaft is 0.8 2mm, the utility model has the advantages in that: through the application of the device, the main shaft can maintain more stable temperature state in the high -speed operation process, avoids the processing precision decline caused by temperature rise, thereby effectively guarantees the processing quality of part.

A child hospital BIM parameter optimization method based on multi-target GAN and LLM updating comprises the following steps: step 1, extracting a newest standard from an authoritative data source by adopting LLM in combination with a GraphRAG technology, and generating a structured data set containing component parameters and corresponding standards thereof in combination with component data collected by a child hospital; 2, analyzing a component position relationship by using NLP, constructing a knowledge graph KG model, and storing the knowledge graph KG model in a Neo4j database to form a component-standard-position relationship network; 3, on the basis of the KG model, regularly verifying and updating a relation between a standard and a component through LLM + GraphRAG, and generating a dynamically updated optimization constraint condition; and 4, on the basis of the updated optimization constraint conditions in the step 3, through a multi-target GAN training generator and a discriminator, generating a core optimization parameter scheme, and outputting an optimized BIM design. According to the method, it is ensured that the optimization process adapts to the latest specification, and the defects of a traditional method in the aspects of multi-target balance, standard dynamics and engineering implementability are overcome.

The present invention provides a target detection imaging system and method based on a fiber laser phased array, comprising a fiber laser phased array light source, for generating an array fiber laser with a high-speed variable intensity distribution, wherein the array fiber laser is composed of a plurality of phase-controllable fiber lasers; a light splitting unit divides the array fiber laser into an emission light and a reference light; an emission optical system projects the emission light onto the target surface; a reference optical system collects the intensity distribution of the reference light; a receiving optical system receives the return light reflected from the target and collects its intensity distribution; a computing control system implements phase control on each fiber laser in the array fiber laser, so that its intensity distribution changes at a high speed, and reconstructs the target image based on the intensity distribution of the reference light and the intensity distribution of the return light. The present invention has the characteristics of high emission power, fast refresh rate, and convenient control of the field of view of the illumination light field, and can significantly improve the target detection distance and the correlation imaging speed.

The invention discloses the application of citrus CsNAC21 / 22 gene in improving the resistance to citrus canker, and belongs to the field of gene engineering technology. The CDS sequence of CsNAC21 / 22 gene is shown in SEQ ID NO.1, and the resistance to citrus canker is enhanced by increasing the expression amount of CsNAC21 / 22 gene. Compared with WT plants, plants overexpressing CsNAC21 / 22 gene can significantly reduce the incidence of canker and reduce the lesion area, with the maximum reduction being 60.6% of WT, and the disease index being 60.7% of WT; the increase in the transcription level of citrus CsNAC21 / 22 gene will not have a significant effect on the appearance phenotype and growth of the plant; the citrus CsNAC21 / 22 gene provided by the invention can be used independently as a candidate gene for studying resistance to citrus canker, and can also be used together with other disease-resistant or disease-susceptible genes for molecular breeding of citrus canker resistance, and has great application value.

The application discloses a synthesis method of 9-bromoanthracene and belongs to the technical field of organic synthesis. Anthracene is used as raw material, inorganic bromide salt is used as a bromine source, hydrogen peroxide is used as an oxidant, and 9-bromoanthracene is synthesized in a mixed solvent under the catalysis of a composite Lewis acid with high selectivity; the crude product is purified through step-by-step fractional recrystallization to obtain a high-purity product. Through the synergistic effect of the composite catalytic system and the mixed solvent, the generation of the difficult-to-remove by-product 9,10-dibromoanthracene is inhibited from the source, and the efficient separation of the product and the key impurities can be realized without column chromatography by combining the gradient cooling fractional crystallization process. The process is green and safe, simple to operate, low in cost and easy to industrialize, and the prepared 9-bromoanthracene can meet the application requirements in high-end fields such as OLED photoelectric materials.

The application discloses an audit literature mind map generation method and system based on feature refining and a large language model, first extracts object theme information, text information, reference object information and hierarchical information in target audit literature and converts them into structured audit text information, and then adopts a hybrid weight model to calculate the global importance of keywords in the structured audit text information and extract target text keywords; the application realizes the function of efficiently generating corresponding audit mind maps for audit literature, and through the adoption of a graph neural network, the logical coherence of text object information can be enhanced and the logical relationship between different nodes can be ensured to be rigorous, and through rule constraints, the text information can be ensured to conform to the audit field specifications, which not only can enhance the systematicness and logicalness of knowledge organization, but also can finely control the generated content, and at the same time, can provide accurate audit literature reading assistance for users and greatly improve the understanding and analysis efficiency of audit literature.

The invention discloses application of soluble transition metal salt in enrichment of small molecule nucleic acid in a biological sample, and belongs to the technical field of molecular biology. According to the application, the soluble transition metal salt is utilized to enrich the small molecule nucleic acid in the liquid biological sample, so that the influence of interferents can be eliminated, the enriched small molecule nucleic acid sample can be stably stored at room temperature, the small molecule nucleic acid sample can be directly subjected to amplification detection without extraction, and the application value is very important.

This utility model discloses a biopharmaceutical separation and purification filtration structure, belonging to the field of biopharmaceutical production. It includes a tank with a drug inlet connected to its inner cavity. A rotating rod is rotatably connected inside the tank. A motor for driving the rotating rod is installed at the top of the tank. A first spring is fixedly connected to the outer surface of the rotating rod, and a filter stirring blade is fixedly connected to the end of the first spring away from the rotating rod. This utility model, through the arrangement of the motor, rotating rod, first spring, filter stirring blade, and arc-shaped block, utilizes the elasticity of the first spring to achieve a vibration effect. This vibration causes the drug adhering to the filter stirring blade to flow downwards rapidly, and also shakes off some particles within the filter pores. This design not only improves filtration efficiency but also avoids clogging problems caused by impurity accumulation, effectively improving the quality and efficiency of biopharmaceutical separation and purification, and has significant technical advantages and application value.

The invention relates to the technical field of remote sensing satellite ground data processing, in particular to a multi-probe star camera internal and external parameter joint calibration method, which comprises the following steps: constructing an initial light pointing model, and resolving initial attitude parameters; calculating a theoretical image space coordinate of a fixed star control point based on the initial attitude parameter, calculating an attitude parameter again by using the star point data after gross error elimination, and determining a relative installation relation initial value among the multi-probe star cameras; based on the angular distance constraint between star points in a single-frame image, constructing a single-probe internal parameter calibration model and a combined calibration model with internal parameters and relative installation relations as unknown numbers; the observation equation is weighted according to the weighting model, the internal and external parameters are updated based on the resolving result, iterative optimization is carried out until the convergence condition is met, the accurate internal and external parameters of the star camera are obtained, the influence of observation errors on parameter resolving is effectively restrained, and the calibration precision and the reliability of parameter estimation are further improved.

The invention discloses recombinant yersinia pestis with reduced toxicity. The recombinant yersinia pestis is obtained by inhibiting the expression quantity and / or activity of Yp1841 protein in the yersinia pestis; the amino acid sequence of the Yp1841 protein is as shown in SEQ ID NO: 2. 100CFU plague bacillus yp1841 and 201 plague bacillus strains are subcutaneously injected into the groin of the Bal b / c mouse respectively, and then the mouse is normally fed for 14 days; the survival condition of the mouse is observed during the period. The result shows that compared with 201 strains of plague bacillus, the toxicity of the plague bacillus yp1841 is obviously reduced. Therefore, the Yp1841 protein has an important influence on the virulence of the yersinia pestis. The method has great application value.

The present invention discloses a nucleolus localization signal peptide, and also provides a nucleolus localization marker of the nucleolus localization signal peptide and an application method of carrying a protein polypeptide into the nucleolus of a eukaryotic cell. Based on the fact that the present invention can be applied to the study of the physiological functions of eukaryotic cells and the pathogenic mechanism of pathogenic bacteria, and can also be used for the development of nucleolus targeted drug delivery technology, the present invention has great research and application value in the fields of biotechnology and medical technology.

The invention discloses a high-strength and high-thermal-conductivity magnesium alloy which comprises the following components in percentage by mass: 5.8 to 6.4 percent of Al, 2.8 to 3.3 percent of Cu, 0.9 to 1.2 percent of Zn, 4.4 to 5.8 percent of Si, 1.2 to 2.4 percent of Co, 1.3 to 2.0 percent of Ag and the balance of Mg and inevitable impurity elements. The alloy is high in strength, good in performance and excellent in heat conduction performance, and has great application value for achieving integration of magnesium alloy structures and functions.

The invention discloses an envelope protein with wide cell tropism and high infection efficiency and application of the envelope protein. The invention provides a B17M mutant protein as shown in SEQ ID NO: 4. Compared with a wild type BaEV envelope protein, the B17M mutant protein is modified as follows: truncation of a cytoplasm tail region is carried out, the capability of assembling and forming virus particles is improved, and the infection capability is improved; four amino acid residues are inserted, so that the fusion genicity is reduced, and the damage of the envelope protein to target cells can be effectively reduced. The invention also protects a nucleic acid molecule for coding the B17M mutant protein, a recombinant plasmid with the nucleic acid molecule, and a recombinant virus with the nucleic acid molecule. After the B17M mutant protein is constructed on the delivery vector, the efficiency of substance delivery to the human primary cells can be effectively improved, and the product has great application value for modification of the human primary cells and has profound social significance.

The utility model is applicable to the technical field of cable supporting and wiring management, and particularly relates to a multi-pipeline common-frame supporting structure applicable to a large workshop, which comprises a supporting frame, a plurality of rotating shaft seats are mounted on the surface of the supporting frame, supporting blocks are arranged on the outer sides of the rotating shaft seats, and second arc-shaped plates are connected to the surfaces of the supporting blocks. And the surface of the second arc-shaped plate is rotationally connected with a first arc-shaped plate. According to the pipeline guiding device, the rotating shaft seat and the supporting block are arranged on the supporting frame, and the first arc-shaped plate and the second arc-shaped plate are matched in a rotatable mode, so that orderly guiding and flexible limiting of a plurality of pipelines are achieved. And the balls are arranged in the mounting bracket, so that the frictional resistance in the pipeline sliding process is obviously reduced, and the laying smoothness is improved.