Conserved functional B cell epitopes of the effector protein CFP10 of the type VII secretion system of Mycobacterium tuberculosis complex and its application

Abstract

The present invention discloses a conserved functional B cell epitope of the type VII secretion system effector protein CFP10 of a member of the Mycobacterium tuberculosis complex and its application in the specific diagnosis of tuberculosis. The conserved functional B cell epitope of CFP10 of the present invention is functionally expressed and presented on the surface of the inert carrier S9 strain, and can specifically identify the infectious antibody serum sample of the Mycobacterium tuberculosis complex member. The S9 recombinant bacteria expressing the conserved epitope on the surface of the bacteria act as agglutinating antigens, react specifically with the antibody serum sample infected with the Mycobacterium tuberculosis complex member and form an antigen-antibody complex visible to the naked eye, while there is no cross reaction with positive serum infected with other Mycobacterium members and BCG immune serum. The detection system of the present invention has the advantages of specificity, rapidity, convenience, etc., and is expected to become a technical means for serological diagnosis and detection of infection with Mycobacterium tuberculosis complex members.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine and immune diagnosis and detection technology, and specifically relates to a conserved functional B cell epitope of the type VII secretion system effector protein CFP10 of the Mycobacterium tuberculosis complex and an application thereof, and in particular to a conserved functional B cell epitope characteristic sequence GSLQGQWRGA of the type VII secretion system effector protein CFP10 of the Mycobacterium tuberculosis complex, its functional presentation expression and application in serological detection of infection with Mycobacterium tuberculosis complex members. Background Art

[0002] Tuberculosis is one of the most serious infectious diseases in the world caused by infection with Mycobacterium tuberculosis complex (MTBC), among which Mycobacterium tuberculosis and Mycobacterium bovis variant are the most important pathogens. Humans / animals are infected through contact with carriers, animals or animal products. About 1 / 4 of the world's population is infected with Mycobacterium tuberculosis. The "2023 Global Tuberculosis Report" pointed out that tuberculosis is the second largest cause of death from a single infectious pathogen in the world after COVID-19. In 2022 alone, the number of newly diagnosed tuberculosis patients worldwide reached 7.5 million, and the number of deaths due to tuberculosis was about 1.3 million. It is worth noting that Mycobacterium tuberculosis bovis variants have existed for a long time. In some farms with high incidence of bovine tuberculosis, the average individual positive rate of cattle is 22.96%, which endangers the development of the breeding industry and threatens human public health safety.

[0003] Culture filtrate protein 10 (CFP10) is a type VII secretion system effector protein of Mycobacterium tuberculosis complex and a secretory effector protein in the early stage of infection. It participates in the pathogenesis of Mycobacterium tuberculosis and induces the host to produce specific immune responses in the early stage of Mycobacterium tuberculosis complex infection. It is conserved among members of Mycobacterium tuberculosis complex and does not exist in most non-tuberculous mycobacteria and BCG. In theory, CFP10 is a diagnostic target antigen for early infection of Mycobacterium tuberculosis complex. However, the specificity of serological detection methods for Mycobacterium tuberculosis complex infection based on CFP10 diagnostic target antigen in clinical practice is limited by many factors, because a certain amount of functional CFP10 diagnostic target antigen with high purity, correct folding conformation and secretory expression needs to be prepared. The high GC content of nucleic acid and post-translational modification of Mycobacterium tuberculosis will make the non-secreted CFP10 protein obtained based on the traditional protein intracellular expression method not have the correct folding conformation and three-dimensional spatial structure. Whether the specific B cell epitope sequence can be expressed and displayed on the surface of the complete protein, and whether the recombinantly expressed non-secreted CFP10 has the secretory effector protein function, these intracellular expressed CFP10 proteins need to be experimentally verified and clarified. Considering that the non-B cell epitope region of the complete protein is redundant for the specific antigen-antibody reaction, it may affect the specific immune response of Mycobacterium tuberculosis complex infection directly mediated by the diagnostic target antigen directly recognized by the B cell epitope. Therefore, the serological detection method of Mycobacterium tuberculosis complex infection based on the recombinant protein CFP10 cannot exclude nonspecific reactions.

[0004] In summary, the serum antibody detection method for Mycobacterium tuberculosis complex infection directly mediated by the conserved B cell epitope antigen of CFP10 as a diagnostic target antigen is worth exploring and looking forward to. Summary of the invention

[0005] Purpose of the invention: The technical problem to be solved by the present invention is to provide a characteristic sequence of a conserved functional B cell epitope of the type VII secretion system effector protein CFP10 of Mycobacterium tuberculosis complex and its application in serological detection of infection with members of the Mycobacterium tuberculosis complex.

[0006] Another technical problem to be solved by the present invention is to provide a nucleic acid molecule encoding the B cell epitope.

[0007] The technical problem that the present invention needs to solve is to provide a recombinant gene fragment containing the nucleic acid molecule.

[0008] The technical problem that the present invention needs to solve is to provide an expression cassette, a recombinant vector, a recombinant cell or a recombinant strain expressing a conserved functional B cell epitope of CFP10 and a serological detection system for infection with Mycobacterium tuberculosis complex pathogens.

[0009] The technical problem that the present invention is to solve is to provide a recombinant expression vector expressing the conserved functional B cell epitope of CFP10 and a method for constructing a serological detection system for Mycobacterium tuberculosis complex pathogen infection.

[0010] The technical problem that the present invention also aims to solve is to provide a B cell epitope, a nucleic acid molecule of the B cell epitope, a recombinant gene fragment, an expression cassette, a recombinant vector, a recombinant strain and a serological detection system for Mycobacterium tuberculosis complex pathogen infection, and use them in the preparation of a serological detection reagent or kit for detecting Mycobacterium tuberculosis complex pathogen infection.

[0011] The final technical problem to be solved by the present invention is to provide a reagent or a kit for detecting antibodies against Mycobacterium tuberculosis complex pathogen infection.

[0012] Technical solution: In order to solve the above technical problems, the present invention provides a B cell epitope of the Mycobacterium tuberculosis complex type VII secretion system effector protein CFP10, the amino acid sequence of the B cell epitope of CFP10 is shown in SEQ ID NO. 2. Wherein, the CFP10 is culture filtrate protein 10.

[0013] Among them, SEQ ID NO.2 (CFP-10 conservative functional B cell epitope amino acid sequence):

[0014] GSLQGQWRGA (GA10 for short).

[0015] The present invention also includes a nucleic acid molecule encoding the B cell epitope of the effector protein CFP10, and the DNA sequence of the nucleic acid molecule is shown in SEQ ID NO.1.

[0016] SEQ ID NO.1 (DNA sequence corresponding to the conserved functional B cell epitope of CFP-10):

[0017] GGTTCGTTGCAGGGCCAATGGCGCGGCGCG (abbreviated as GG30).

[0018] The present invention also includes a recombinant gene fragment, the sequence of which is shown as SEQ ID NO.3 or SEQ ID NO.5.

[0019] The recombinant gene fragment of the present invention includes a recombinant pegA gene fragment or a chimeric gene fragment, the DNA sequence of the recombinant pegA gene fragment is shown in SEQ ID NO.3; the amino acid sequence of its recombinant PegA protein is shown in SEQ ID NO.4, the recombinant peg operon sequence is peg-CFP10-GG30, and its gene sequence is shown in SEQ ID NO.5; the recombinant gene fragment is obtained by introducing the nucleic acid molecule into the pegA DNA sequence containing the Peg pili encoding gene.

[0020] SEQ ID NO.3 (recombinant pegA DNA sequence):

[0021]

[0022] SEQ ID NO.4 (amino acid sequence of recombinant PegA protein):

[0023]

[0024] The present invention also includes an expression cassette, a recombinant vector, a recombinant cell or a recombinant strain, which contains the nucleic acid molecule or the recombinant gene fragment.

[0025] The recombinant vector of the present invention is an expression vector pBR322-Peg-CFP10-GG30 constructed by inserting the nucleic acid molecule of the CFP10 conservative functional B cell epitope into a vector containing the coding gene sequence of Peg pili.

[0026] The present invention also includes a Mycobacterium tuberculosis complex pathogen infection antibody detection system, which includes the expression cassette, recombinant expression vector, recombinant cell or recombinant strain.

[0027] The Mycobacterium tuberculosis complex pathogen infection antibody detection system of the present invention further comprises introducing the expression vector pBR322-Peg-CFP10-GG30 into the carrier bacteria by electrotransformation to obtain the recombinant strain.

[0028] The present invention also includes a method for constructing a recombinant vector, comprising the following steps:

[0029] (1) obtaining a B cell epitope DNA sequence of a type VII secretion system effector protein of Mycobacterium tuberculosis complex, wherein the DNA sequence is shown in SEQ ID NO.1;

[0030] (2) Inserting the DNA sequence obtained in step (1) into a vector containing the Peg pili encoding gene sequence to construct a recombinant vector.

[0031] The present invention also includes a method for constructing the recombinant strain, which includes the following steps: introducing the recombinant vector into the carrier bacteria by electrotransformation.

[0032] The present invention also includes the use of the B cell epitope, the nucleic acid molecule, the recombinant gene fragment, the expression cassette, the recombinant expression vector, the recombinant cell or recombinant strain, and the Mycobacterium tuberculosis complex pathogen infection antibody detection system in the preparation of a reagent or kit for detecting Mycobacterium tuberculosis complex pathogen infection antibodies.

[0033] The present invention also includes a reagent or kit for detecting Mycobacterium tuberculosis complex pathogen infection antibodies, wherein the reagent or kit includes the B cell epitope, the nucleic acid molecule, the expression cassette, the recombinant expression vector, the recombinant cell or the recombinant strain or the Mycobacterium tuberculosis complex infection antibody detection system.

[0034] Beneficial effects: Compared with the prior art, the present invention has the following significant advantages:

[0035] 1. The present invention utilizes the Peg pili of Salmonella pullorum to express the conserved antigenic epitope sequence of CFP10, and utilizes the CFP10 specific antigenic epitope sequence to replace the complete protein antigen. This antigenic epitope sequence is exactly the epitope determinant cluster of serum antibodies that recognize and bind to Mycobacterium tuberculosis complex infection. The antigen-antibody reaction directly mediated by the CFP10 specific antigenic epitope has good specificity.

[0036] 2. The present invention also verifies the expression of Peg pili on the surface of the carrier bacteria through an indirect agglutination test, and the functional display of the Peg pili on the surface of the carrier bacteria to express the specific antigen epitope sequence of the Mycobacterium tuberculosis complex CFP10. The epitope antigen determinant cluster can accurately identify and bind to antibodies against the CFP10 epitope antigen, thereby realizing specific, rapid and convenient detection of infectious antibodies in the pathogen of Mycobacterium tuberculosis complex.

[0037] 3. The antibody detection system of the present invention does not produce nonspecific reactions with positive infection sera of other Mycobacterium bacteria (Mycobacterium phlei, Mycobacterium intracellulare, Mycobacterium fortuitum, Mycobacterium avium subspecies paratuberculosis, Mycobacterium avium) and BCG immune sera. The present invention uses the conserved specific B cell epitope determinant cluster of the type VII secretion system effector protein CFP10 of the Mycobacterium tuberculosis complex to replace the complete protein antigen, so it has good specificity and no cross-reaction with other Mycobacterium bacteria, thus overcoming the technical bottleneck that traditional serological detection technology cannot eliminate nonspecific reactions.

[0038] In view of the advantages of replacing the complete protein antigen based on the conservative specific B cell epitope determinant cluster of the effector protein CFP10 and specifically detecting infection with Mycobacterium tuberculosis complex pathogens, the present invention is expected to become a technical means for accurate serological diagnosis and detection of infection with members of the Mycobacterium tuberculosis complex. BRIEF DESCRIPTION OF THE DRAWINGS

[0039] Figure 1 , alignment and conservation analysis of CFP10 sequences encoded by members of the Mycobacterium tuberculosis complex;

[0040] Figure 2 , the B cell epitope prediction results of the CFP10 protein system encoded by Mycobacterium tuberculosis H37Rv; Figure A: The scoring results of each amino acid of CFP10 by the BepiPred-3.0 B cell epitope prediction website tool. The score above the dotted line is a single amino acid site with a score of >0.1512. Multiple consecutive amino acid sites with a score of >0.1512 are considered to be B cell epitopes. The area selected by the black box is the B cell epitope region provided by the present invention. Figure B: The B cell epitope prediction results of CFP10 encoded by Mycobacterium tuberculosis H37Rv using the BepiPred-3.0 website tool. The uppercase bold letters are amino acids with a single amino acid site score of >0.1512. The red bold font shows the conserved B cell epitope amino acid sequence of the CFP10 protein provided by the present invention;

[0041] Figure 3 , Schematic diagram of the secretion pathway and structure of the effector protein CFP10 of the complex type VII secretion system of Mycobacterium tuberculosis. Figure A: After translation, CFP10 and ESAT6 form a heterodimer ESAT6 in the cytoplasm of Mycobacterium tuberculosis. CFP10 is then transported into the periplasm of Mycobacterium tuberculosis through the type VII secretion system ESX-1 of Mycobacterium tuberculosis and further secreted outside the mycobacterial cell. ESAT6.CFP10 is secreted outside the Mycobacterium tuberculosis cell and can exert its effector function in the form of a heterodimer or dissociated into two monomers, ESAT6 and CFP10; B: Schematic diagram of the secreted effector protein ESAT6.CFP10 heterodimer structure, wherein the green part is the ESAT6 protein structure, the yellow plus red part is the CFP10 protein structure, and the red part is the B cell epitope region of CFP10 provided by the present invention, which is exposed on the surface of the ESAT6.CFP10 complex; C: CFP10 monomer protein structure, the red part is the B cell epitope region of CFP10 provided by the present invention, and it is noted that this region is exposed on the surface of the CFP10 monomer protein;

[0042] Figure 4, Electrophoresis diagram of PCR amplification and identification of the recombinant operon peg-CFP10-GG30 expressing the conserved B cell epitope GA10 of CFP10 protein. Lane M is Trans 2K Plus II DNA Marker, Lane 1 is the PCR amplification product of the peg operon gene, and the template genomic DNA comes from the standard strain of Salmonella pullorum CVCC 526 as a positive control; Lane 2 is the PCR amplification product of peg-CFP10-GG30 (4850bp is the recovered DNA amplification product); Lane 3 is the negative control using the genomic DNA of Escherichia coli DH5α as a template;

[0043] Figure 5 , The restriction enzyme identification electrophoresis diagram of the recombinant expression plasmid pBR322-CFP10-GG30 containing the recombinant operon peg-CFP10-GG30 gene. Lane M is Trans 2K Plus II DNA Marker, Lane 1 is pBR322 plasmid; Lane 2 is pBR322-Peg-CFP10-GG30 circular plasmid; Lane 3 is the NheI and EagI double restriction enzyme digestion product of the recombinant plasmid pBR322-Peg-CFP10-GG30;

[0044] Figure 6 , Schematic diagram of the recombinant expression plasmid vector pBR322-Peg-CFP10-GG30;

[0045] Figure 7, the vector bacteria S9 carrying the recombinant expression plasmid pBR322-Peg-CFP10-GG30 (S9+pBR322-Peg-CFP10-GG30) and the recombinant expression plasmid carrying only the peg operon gene (S9+pBR322-Peg). The former is used as the Mycobacterium tuberculosis complex pathogen infection antibody detection system, and the latter is used as the detection system control. The specific agglutination reaction results are shown with the known positive sera of different members of the Mycobacterium genus and the sera of Helicobacter pylori-positive patient volunteers. A: Agglutination reaction results of Mycobacterium tuberculosis complex pathogen infection antibody detection system and detection system control with Mycobacterium tuberculosis positive volunteer patient serum; B: Agglutination reaction results of Mycobacterium tuberculosis complex pathogen infection antibody detection system and detection system control with Mycobacterium tuberculosis bovine variant positive serum; C: Agglutination reaction results of Mycobacterium tuberculosis complex pathogen infection antibody detection system with BCG immunized volunteer serum; D: Agglutination reaction results of Mycobacterium tuberculosis complex pathogen infection antibody detection system with Mycobacterium phlei known positive serum; E: Mycobacterium tuberculosis complex pathogen infection antibody detection system The results of the agglutination reaction between the antibody detection system and the known positive serum of Mycobacterium intracellulare; F: the results of the agglutination reaction between the antibody detection system for Mycobacterium tuberculosis complex pathogen infection and the known positive serum of Mycobacterium fortuitum; G: the results of the agglutination reaction between the antibody detection system for Mycobacterium tuberculosis complex pathogen infection and the known positive serum of Mycobacterium avium subspecies paratuberculosis; H: the results of the agglutination reaction between the antibody detection system for Mycobacterium tuberculosis complex pathogen infection and the known positive serum of Mycobacterium avium; I: the results of the agglutination reaction between the antibody detection system for Mycobacterium tuberculosis complex pathogen infection and the serum of volunteers from patients with Helicobacter pylori positive. DETAILED DESCRIPTION

[0046] Before further describing the specific embodiments of the present invention, it should be understood that the scope of protection of the present invention is not limited to the specific specific embodiments described below; it should also be understood that the terms used in the examples of the present invention are intended to describe specific specific embodiments rather than to limit the scope of protection of the present invention. Unless otherwise defined, all technical and scientific terms used in the present invention have the same meanings as those commonly understood by those skilled in the art. In addition to the specific methods, equipment, and materials used in the examples, according to the technical staff of the present art's grasp of the prior art and the description of the present invention, any methods, equipment, and materials of the prior art that are similar or equivalent to the methods, equipment, and materials in the examples of the present invention can also be used to implement the present invention.

[0047] Example 1. Conservation analysis of the effector protein CFP10 of the type VII secretion system of Mycobacterium tuberculosis complex

[0048] The Mycobacterium tuberculosis complex and other common Mycobacterium members were retrieved through the NCBI (https: / / www.ncbi.nlm.nih.gov / ) nucleic acid database (Nucleotide). Only strains with complete genome information were collected, including 599 Mycobacterium tuberculosis, 22 Mycobacterium tuberculosis variant bovis, 2 Mycobacterium tuberculosis variant africanum, 1 Mycobacterium tuberculosis variant caprae, 6 Mycobacterium canettii, 2 Mycobacterium orygis, 11 Bacille Calmette Guérin (BCG), 41 Mycobacterium intracellulare, and 1 Mycobacterium tuberculosis variant caprae. intracellulare), 5 strains of Mycobacterium avium, 21 strains of Mycobacterium avium subsp. hominissuis, 23 strains of Mycobacterium avium subsp. paratuberculosis, and 3 strains of Mycobacterium leprae. The CFP10 protein information in the genome of the reference strain H37Rv (Mycobacterium tuberculosis H37Rv, GenBank accession number: AL123456.3) was used as the reference sequence, and the CFP10 amino acid sequences of the above mycobacterium strains were aligned and analyzed using MegAlign 11.1.0 software.

[0049] The results are shown in Table 1. Among the members of the genus Mycobacterium, the conservation of the CFP10 protein sequence of Mycobacterium tuberculosis (599 strains) with the reference strain at the same site (meaning that the amino acid sequence is exactly the same) is 99.92%±0.02%; the conservation of the CFP10 protein sequence of 22 strains of Mycobacterium tuberculosis variant bovis with the reference strain at the same site is 100%±0.00%; the conservation of the CFP10 protein sequence of 2 strains of Mycobacterium tuberculosis variantafricanum with the reference strain at the same site is 100%±0.00%; the conservation of the CFP10 protein sequence of 1 strain of Mycobacterium tuberculosis variant africanum with the reference strain at the same site is 100%±0.00%; the conservation of the CFP10 protein sequence of 1 strain of Mycobacterium tuberculosis variant goat with the reference strain is 100%±0.00%. caprae) compared with the reference strain, the conservation of the same sites was 100%±0.00%; the conservation of the CFP10 protein sequences of 6 Mycobacterium canettii and the reference strain was 100%±0.00%; the conservation of the CFP10 protein sequences of 2 Mycobacterium orygis and the reference strain was 100%±0.00%. It is worth noting that Bacille Calmette Guérin (BCG), Mycobacterium intracellulare, Mycobacterium avium, Mycobacterium avium subsp. hominissuis, Mycobacterium avium subsp. paratuberculosis and Mycobacterium leprae do not contain homologous sequences of the CFP10 reference sequence. Therefore, in summary, the results of bioinformatics analysis show that CFP10 exists in the pathogens of Mycobacterium tuberculosis complex and is highly conserved. If the conserved B cell epitopes contained in CFP10 can be further explored and optimized, it can provide a basis for finding detection targets for specific detection and monitoring technology of tuberculosis.

[0050] Table 1 Conservative analysis and results of CFP10 proteins of common members of the genus Mycobacterium

[0051]

[0052]

[0053] Note: "0%" means no sequence homologous to Mycobacterium tuberculosis CFP10 was found.

[0054] Example 2: Bioinformatics prediction of conserved B cell epitopes in CFP10 protein of Mycobacterium tuberculosis complex strains

[0055] MegAlign 11.1.0 software was used to perform an amino acid sequence alignment analysis of the CFP10 protein of the following Mycobacterium tuberculosis complex strains: Mycobacterium tuberculosis H37Rv (GenBank accession number AL123456.3), Mycobacterium tuberculosis bovis AF2122 / 97 (GenBank accession number LT708304.1), Mycobacterium tuberculosis africanus GM041182 (GenBank accession number FR878060.1), Mycobacterium tuberculosis caprae Allgaeu (GenBank accession number CP016401.1), Mycobacterium canetti 140010059 (GenBank accession number HE572590.1), Mycobacterium antelope NIAB_BDWBCSHFL_1 (GenBank accession number CP138660.1). The amino acid sequence alignment results are shown in Figure 1. Figure 1 As shown, the CFP10 proteins encoded by all the above-mentioned Mycobacterium tuberculosis complex strains are 100% conserved.

[0056] In order to further clarify the conserved B cell epitopes in the conserved CFP10 protein, the B epitope prediction website tool (BepiPred-3.0, https: / / services.healthtech.dtu.dk / services / BepiPred-3.0 / ) was used to predict the linear B cell epitopes contained in the CFP10 protein sequence of Mycobacterium tuberculosis H37Rv. The database scored each amino acid residue and used the default threshold of 0.1512 for epitope classification. Multiple consecutive amino acid residues with a score of >0.1512 were identified as B cell epitopes. The prediction results are as follows: Figure 2 As shown, the conserved B cell epitope region in the Mycobacterium tuberculosis complex CFP10 was obtained. The three-dimensional spatial structure of the H37RvESAT-6.CFP10 protein complex was retrieved from the PDB database (https: / / www.rcsb.org / ) (PDB: 1WA8), and the protein analysis software Pymol (https: / / pymol.org / ) was used to further analyze the spatial structure. The secretion pathway and protein structure of CFP10 are shown in Figure 3The optimization screening resulted in a target antigen with good surface exposure and high antigenicity, namely, CFP10 amino acid sequence 37-46: GSLQGQWRGA; the corresponding DNA coding sequence is GGTTCGTTGCAGGGCCAATGGCGCGGCGCG.

[0057] Example 3: Construction of Peg pili operon expression vector carrying the conserved B cell epitope GSLQGQWRGA of CFP10 protein

[0058] The DNA coding sequence (GGTTCGTTGCAGGGCCAATGGCGCGGCGCG) of the predicted and preferred early secretory effector protein CFP10 conserved B cell epitope GSLQGQWRGA was inserted into the gene sequence of the Peg pili operon of Salmonella pullorum to construct the pBR322 expression recombinant plasmid pBR322-Peg-CFP10-GG30, and the vector bacteria S9 (an inert carrier Salmonella and its potential application, national invention patent, patent number: ZL201910424369.8) was introduced to obtain the S9 recombinant strain S9+pBR322-Peg-CFP10-GG30. The specific implementation procedures are as follows:

[0059] A chimeric gene containing peg (reference sequence is Salmonella enterica SP strain, GenBank accession number CP077668.1, 1831920-1827125) and CFP10-GG30 gene was synthesized by Nanjing Qingke Biotechnology Co., Ltd., and the sites of part of the gene sequence in the peg operon were replaced by CFP10-GG30. The obtained chimeric gene was named peg-CFP10-GG30. The peg-CFP10-GG30 gene sequence (SEQ ID NO.5) is as follows:

[0060] SEQ ID NO.5 (gene sequence of recombinant peg-CFP10-GG30):

[0061]

[0062]

[0063]

[0064]

[0065] The upstream and downstream primer information for amplifying the complete gene of the peg operon is as follows: Upstream primer SP Peg Up: 5'-CGC GCTA GCATGAAACGTTCACTTATTGCTGCT-3' downstream primer SP Peg Down: 5'-CT CGGCCG TTAATTATAAGATACCACGATTAATGC-3', the underlined sequences represent NheI and EagI restriction enzyme sites, respectively. The above primers were synthesized by Nanjing Qingke Biotechnology Co., Ltd. The chimeric gene was used as a template, the genomic DNA of Salmonella pullorum standard strain CVCC 526 (purchased from China Veterinary Drug Administration, China Veterinary Microbiological Culture Collection Center) was used as a positive control, and the genomic DNA of Escherichia coli DH5α was used as a negative control. PCR amplification was performed using the upstream and downstream primers SP Peg Up / Down. The amplification system was: pfu high-fidelity DNA Polymerase (Beijing Quanshijin Biotechnology Co., Ltd., 2.5 units / ul) 1μL, 5×pfu DNA polymerase buffer 10μL, dNTPs 5μL, upstream and downstream primers (10mM) 2μL each, chimeric gene (250ng / μL), CVCC 526 genome or DH5α genome DNA 2μL, ultrapure water 28μL. After the above system was mixed evenly, PCR amplification was performed using a thermal cycler (Bio-Red). The procedure was as follows: pre-denaturation at 94°C for 5 min, amplification stage for 30 cycles, including denaturation at 94°C for 30 s, annealing at 52°C for 30 s, and extension at 72°C for 5 min, further amplification at 72°C for 10 min, and the temperature was lowered to 12°C after the amplification. A 1% agarose gel was prepared, and electrophoresis was performed at 110 V for 45 min, followed by staining with ethidium bromide and imaging under a UV imager. The PCR results were shown in Figure 1. Figure 4 As shown, the amplified size of the positive control is 4850 bp; the PCR product of peg-CFP10-GG30 is: 4850 bp (if there are other bands, they are non-specific amplified products, and only 4850 bp of DNA products will be recovered in subsequent experiments); there is no amplified band in the negative control. The PCR amplified product (4850 bp) of peg-CFP10-GG30 was recovered using a universal DNA purification kit (Tiangen Biochemical Technology (Beijing) Co., Ltd.).

[0066] The PCR amplification product of peg-CFP10-GG30 and the pBR322 plasmid were double-digested with NheI and EagI restriction endonucleases (NEB), and then the linear DNA fragments were connected in a 16°C metal bath overnight with T4 DNA ligase (NEB). The next day, the ligation product was transformed into S9 competent cells (an inert carrier Salmonella and its potential applications, national invention patent, patent number: ZL201910424369.8), and resistance screening was performed by coating solid culture medium containing 100 μg / mL ampicillin. A single colony on the plate was picked and inoculated into LB liquid culture medium containing 100 μg / mL ampicillin and grown to the stationary phase. After the plasmid was recovered, it was double-digested with NheI and EagI restriction endonucleases. A 1% agarose gel was prepared, and after electrophoresis at 110V for 45 minutes, it was stained with ethidium bromide and imaged under a UV imager. The results are as follows Figure 5 As shown, the double enzyme digestion product of the vector contains a 3651 bp linear vector and a 4850 bp peg-CFP10-GG30 linear DNA fragment, which is consistent with the expected size. The schematic diagram of the pBR322 expression recombinant plasmid pBR322-Peg-CFP10-GG30 is shown in Figure 6 shown.

[0067] Example 4: Expression of CFP10 conserved B cell epitopes on the surface of S9 recombinant bacteria carrying the recombinant plasmid pBR322-Peg-CFP10-GG30 and functional verification

[0068] The S9 inert carrier bacteria carrying the recombinant plasmid pBR322-Peg-CFP10-GG30 were grown in LB liquid medium containing 100 μg / mL ampicillin to the stationary phase, centrifuged at 4000 rpm for 5 min, discarded the supernatant, and resuspended with an equal volume of sterile saline. The bacterial suspension (final concentration 1×10 10CFU / mL). The recombinant S9 inert carrier bacteria suspension carrying the above recombinant plasmid pBR322-Peg-CFP10-GG30 was subjected to agglutination test with anti-Salmonella Peg fimbriae monoclonal antibody 3D12 (Yang Yi, Yang Weifeng, Zhang Dong, et al. Preparation and preliminary clinical application of anti-Salmonella PEG fimbriae monoclonal antibody [J]. Chinese Journal of Preventive Veterinary Medicine, 2018, 40(05): 438-442.) and Salmonella negative serum (5 copies of SPF mouse serum). The bacterial suspension of S9 inert carrier bacteria was used as a negative control. The results are shown in Table 2. The bacterial suspensions of all strains did not react with negative serum; the recombinant S9 inert carrier bacteria suspension carrying the recombinant plasmid pBR322-Peg-CFP10-GG30 showed obvious agglutination with 3D12 monoclonal antibody, with large agglutination particles and clear background. The results showed that the Peg pili were successfully expressed on the surface of the recombinant S9 inert vector bacteria carrying the recombinant plasmid pBR322-Peg-CFP10-GG30.

[0069] The recombinant S9 inert carrier bacterial suspension carrying the recombinant plasmid pBR322-Peg-CFP10-GG30 was further compared with volunteers with clinical tuberculosis infection provided by Yangzhou Third People's Hospital, Nanjing Drum Tower Hospital and Institute of Dermatology, Chinese Academy of Medical Sciences (through sputum smear, IGRA and GeneXport A total of 23 sera from individuals diagnosed with Mycobacterium tuberculosis infection by comprehensive analysis of MTB and other methods and 36 known negative sera of Mycobacterium tuberculosis provided by the above-mentioned units; a total of 30 known positive sera of Mycobacterium tuberculosis bovine variant infection provided by the National Animal Disease Control Center, Jiangsu Animal Disease Control Center, and Suining Veterinary Station and 50 known negative sera of Mycobacterium tuberculosis bovine variant provided by the above-mentioned units were subjected to agglutination tests, and a bacterial suspension of S9 inert carrier bacteria containing pBR322-Peg (Zhu Guoqiang, Yang Bin, Yang Yang, Meng Xia, Xia Pengpeng, Duan Qiangde, Zhu Xiaofang, an inert carrier Salmonella and its potential applications, national invention patent, patent number: ZL201910424369.8) was used as a negative control. The results are shown in Table 3. The bacterial suspension of the recombinant S9 inert carrier bacteria carrying the recombinant plasmid pBR322-Peg-CFP10-GG30 showed obvious agglutination with the positive serum, agglutination particles appeared, and the background was clear; while the bacterial suspension of the S9 inert carrier bacteria containing only the pBR322-Peg plasmid did not agglutinate with the positive serum, no agglutination particles appeared, and the background was turbid; and the bacterial suspensions of all strains (including the recombinant S9 inert carrier bacteria carrying the recombinant plasmid pBR322-Peg-CFP10-GG30 and the S9 inert carrier bacteria containing only the pBR322-Peg plasmid) did not react with the known negative serum of Mycobacterium tuberculosis (36 copies) and the known negative serum of Mycobacterium tuberculosis bovis (50 copies). The results indicate that the conserved B cell epitope GSLQGQWRGA of the Mycobacterium tuberculosis CFP10 protein can be functionally expressed on the surface of the S9 inert carrier bacteria through Peg pili. The conserved B cell epitope antigen based on CFP10 can be used as a diagnostic target antigen to directly mediate the recognition and binding of specific serum antibodies infected with the Mycobacterium tuberculosis complex.

[0070] Table 2 Functional verification of the expression of Peg on the surface of S9 recombinant vector bacteria carrying the recombinant plasmid pBR322-Peg-CFP10-GG30 and agglutination test

[0071]

[0072]

[0073] Note: “-” represents negative agglutination reaction; “+” represents positive agglutination reaction; “( / )” represents the number and proportion of samples

[0074] Table 3 Functional verification of expression of Peg-CFP10-GG30 on the surface of inert carrier bacteria S9 and agglutination test

[0075]

[0076] Note: “-” represents negative agglutination reaction; “+” represents positive agglutination reaction; “( / )” represents the number and proportion of samples

[0077] Example 5: Inert recombinant vector bacteria S9+pBR322-Peg-CFP10-GG30 expresses CFP10 conservative B cell epitopes that directly mediate recognition and binding of Mycobacterium tuberculosis complex pathogen infection-specific antibodies

[0078] Based on the functional verification of the CFP10 conserved B cell epitope CFP10-GA10 expressed on the surface of the inert carrier bacteria S9, the specificity of the antibody against Mycobacterium tuberculosis complex pathogen infection was further tested and verified. The specific implementation procedures are as follows:

[0079] According to the same method as in Example 4, a control system S9+pBR322-Peg bacterial suspension and a detection system S9+pBR322-Peg-CFP10-GG30 bacterial suspension were prepared respectively. The above two bacterial suspensions were subjected to agglutination tests with sera from different background sources to test and verify the specificity of CFP10 conserved functional B cell epitopes in directly mediating recognition and binding to antibodies infected with Mycobacterium tuberculosis complex pathogens. The sera involved in the test and their background sources included: 55 sera from volunteers with known positive clinical Mycobacterium tuberculosis (41 provided by Yangzhou Third People's Hospital, 8 provided by Nanjing Drum Tower Hospital, and 6 provided by the Institute of Dermatology, Chinese Academy of Medical Sciences), 73 sera with known positive Mycobacterium tuberculosis bovis (15 provided by the National Animal Disease Control Center, 22 provided by Jiangsu Animal Disease Control Center, and 36 provided by Suining Veterinary Station), 86 BCG immune sera (provided by the Inspection Center of Subei People's Hospital), 1 known positive serum of Mycobacterium phlei, 1 known positive serum of Mycobacterium intracellulare, 1 known positive serum of Mycobacterium fortuitum, 1 known positive serum of Mycobacterium avium subspecies paratuberculosis, 1 known positive serum of Mycobacterium avium, and 10 sera from volunteers with Helicobacter pylori infection (provided by Wuxi Xishan People's Hospital). The test results are shown in Table 4. 55 sera from clinically tuberculosis-positive patient volunteers and 73 known positive sera of Mycobacterium tuberculosis bovine variant did not agglutinate with the control system (S9+pBR322-Peg), but agglutinated with the Mycobacterium tuberculosis complex pathogen infection antibody detection system (S9+pBR322-Peg-CFP10-GG30); at the same time, the above control system and detection system did not agglutinate with all 86 BCG-immunized volunteer sera, 1 known positive serum of Mycobacterium phlei, 1 known positive serum of Mycobacterium intracellulare, 1 known positive serum of Mycobacterium fortuitum, 1 known positive serum of Mycobacterium paratuberculosis subspecies, 1 known positive serum of Mycobacterium avium, and 10 sera from Helicobacter pylori-infected patient volunteers. The above results indicate that its specificity is 100%. The agglutination diagram of the serum sample is shown in Figure 7 shown.

[0080] Table 4 Conserved functional B cell epitopes of CFP10 directly mediate recognition and binding of Mycobacterium tuberculosis complex pathogen infection antibodies and specificity verification of agglutination assays

[0081]

[0082]

[0083] Note: “-” represents negative agglutination reaction; “+” represents positive agglutination reaction; “( / )” represents the number and proportion of samples

[0084] According to the same method as in Example 4, the Mycobacterium tuberculosis complex pathogen infection antibody detection system was prepared: S9+pBR322-Peg bacterial suspension and S9+pBR322-Peg-CFP10-GG30 bacterial suspension. And in accordance with the published patents, the following were prepared: Hp-CagA agglutination antibody detection system: DH5α+pBR-SadA, DH5α+pBR-Sada-Hp-CagA-TBEA-GD11, Hp-VacA agglutination antibody detection system DH-5α+pBR-YaiU, DH-5α+pBR-YaiU-Hp-VacA-TBEA-AD11 (B cell epitope target antigen carrying Helicobacter pylori virulence factor and its expression vector and application, national invention patent, patent number: ZL202211587776.9) and new coronavirus agglutination antibody detection system: DH5α+pBR-Peg, DH5α+pBR-Peg-SARS-CoV-2-AT30 (target antigen of B cell epitope of new coronavirus receptor binding domain and its expression and application in Peg pili display, patent number: ZL202211488632.8). Agglutination tests were performed with positive sera of Mycobacterium tuberculosis complex infection from different sources. The sera involved in the test and their sources included: 6 positive sera of Mycobacterium tuberculosis infection (2 provided by Yangzhou Third People's Hospital, 2 provided by Yangzhou University Affiliated Hospital, and 2 provided by Xishan People's Hospital), 8 positive sera of Mycobacterium tuberculosis bovine variant (3 provided by the National Animal Disease Control Center, 2 provided by Jiangsu Provincial Animal Disease Control Center, and 3 provided by Suining Veterinary Station). The test results are shown in Table 5: All positive sera of Mycobacterium tuberculosis complex infection only reacted with the S9+pBR322-Peg-CFP10-GG30 bacterial suspension in the Mycobacterium tuberculosis complex pathogen infection antibody detection system and formed obvious agglutination particles, but did not undergo agglutination reactions with other detection systems.

[0085] Table 5 Results of different pathogen-specific antibody detection systems for detecting positive sera infected with members of the Mycobacterium tuberculosis complex

[0086]

[0087]

[0088] Note: “-” represents negative agglutination reaction; “+” represents positive agglutination reaction; “( / )” represents the number and proportion of samples

[0089] In summary, the present invention provides a specific B cell epitope of the effector protein CFP10 of the type VII secretion system of the Mycobacterium tuberculosis complex, and successfully presents the CFP10 specific B cell epitope on the surface of the carrier bacteria S9 through the Peg pili of Salmonella pullorum. The Mycobacterium tuberculosis complex infection antibody detection system of the present invention replaces the traditional serological detection method based on the complete protein antigen, and can specifically detect the Mycobacterium tuberculosis complex pathogen infection antibody at the individual level, and can specifically agglutinate with the Mycobacterium tuberculosis complex pathogen infection antibody without cross-reacting with other bacterial infection positive sera. It can be used for rapid and specific serological diagnosis of clinical tuberculosis.

Claims

1. A recombinant gene fragment, characterized in that: The sequence of the recombinant gene fragment is shown as SEQ ID NO.3 or SEQ ID NO.

5.

2. A recombinant protein, characterized in that The amino acid sequence of the recombinant protein is shown in SEQ ID NO.

4.

3. An expression cassette, a recombinant vector, a recombinant cell or a recombinant strain, characterized in that: It comprises the recombinant gene segment according to claim 1.

4. A Mycobacterium tuberculosis complex pathogen infection antibody detection system, characterized in that: The Mycobacterium tuberculosis complex pathogen infection antibody detection system comprises the expression cassette, recombinant expression vector, recombinant cell or recombinant strain according to claim 3.

5. Use of the recombinant gene fragment according to claim 1, the expression cassette, the recombinant expression vector, the recombinant cell or the recombinant strain according to claim 3, and the Mycobacterium tuberculosis complex pathogen infection antibody detection system according to claim 4 in the preparation of a reagent or a kit for detecting Mycobacterium tuberculosis complex pathogen infection antibodies.

6. A reagent or kit for detecting antibodies against Mycobacterium tuberculosis complex pathogen infection, characterized in that: The reagent or kit comprises the recombinant gene fragment according to claim 1, the expression cassette, recombinant expression vector, recombinant cell or recombinant strain according to claim 3 or the Mycobacterium tuberculosis complex infection antibody detection system according to claim 4.

Images