A strain of Lactobacillus delbrueckii subsp. lactis MB4 and its application in preparing blood sugar lowering and sleep-promoting food and medicine

Abstract

The present invention belongs to the technical field of probiotics and their application, and specifically relates to a strain of Lactobacillus delbrueckii subsp. lactis MB4 and its application in the preparation of hypoglycemic and sleep-aiding food and medicine. The present invention separates and purifies a strain of Lactobacillus delbrueckii subsp. lactis MB4 from the feces of a healthy adult in Guangdong, China, and the strain can produce and secrete γ-aminobutyric acid, and can inhibit the activity of α-glucosidase, and has the functions of promoting the digestion and absorption of protein food, improving protein allergy, anti-depression and improving sleep, hypoglycemic and weight loss, etc., and can be used in the fields of hypoglycemic and sleep-aiding, for example, it can be made into hypoglycemic and sleep-aiding medicines, and has important application value and economic value.

Description

Technical Field

[0001] The invention belongs to the technical field of probiotics and their application, and particularly relates to a strain of Lactobacillus delbrueckii lactis subspecies MB4 and application thereof in the preparation of blood sugar lowering and sleep-aiding food and medicine. Background Art

[0002] Lactobacillus delbrueckii subsp. lactis is a Gram-positive bacillus belonging to the family Lactobacillaceae and the genus Lactobacillus. It is generally 0.6-0.9μm×1.5-5μm in size. It generally exists as single, twin, or chains with different lengths, with round ends. It is non-motile and has no flagella. The bacterium was first discovered and isolated in 1901 and named after the German bacteriologist M. Delbrück. The colony is round with neat edges and is milky white on the culture medium. It is acid-resistant and has an optimal growth temperature of 30-40℃. It mainly comes from external environments such as milk, cheese, compressed yeast, and grain wort, as well as internal environments such as the human mouth, intestines, and vagina. It has no special requirements for oxygen and can be detected in almost all secretions of the human body. Therefore, it is a lactobacillus widely present in the human body, which also shows that Lactobacillus delbrueckii subsp. lactis is a normal strain present in the human body. In addition, Lactobacillus delbrueckii subsp. lactis has good acid and bile salt resistance, can survive in the gastrointestinal tract of humans and animals, and is widely present in the intestines of humans and animals.

[0003] Lactobacillus delbrueckii subspecies lactis is one of the strains that can be used for production and processing, is widely present in the intestinal tract of humans and animals and is discharged with feces, is a part of the normal flora of the human body, and as an important component of the normal microbial system of the intestinal tract and accompanies the host throughout life, is of great significance for maintaining the balance of intestinal microecology. As the lactic acid bacteria probiotics in the intestinal flora, Lactobacillus delbrueckii subspecies lactis also plays the effect of helping intestinal peristalsis, and can also enhance the digestive ability of the human body and improve immunity. Therefore, Lactobacillus delbrueckii subspecies lactis has become the focus of recent research as a kind of probiotic lactobacillus with great potential, is widely used in the production of probiotic products, and is constantly being used to be made into the probiotic preparations applicable to humans and animals.

[0004] Studies have shown that different strains of Lactobacillus salivarius WB21 have different probiotic functions: (1) Mayanagi et al. found that oral administration of tablets containing Lactobacillus salivarius WB21 can reduce the number of periodontitis pathogens, regulate the balance of oral microecology, and have a certain protective effect on the periodontal environment (Mayanagi G, Kimura M, Nakaya S, et al. Probiotic effects of orally administered Lactobacillus salivarius WB21-containing tablets on periodontopathic bacteria: a double-blinded, placebo-controlled, randomized clinical trial. J Clin Periodontol. 2009 Jun; 36(6): 506-13. doi: 10.1111 / j.1600-051X.2009.01392.x. Epub 2009 Apr 22. PMID: 19453574.). (2) Lactobacillus delbrueckii subsp. lactis has a certain adsorption effect and can colonize and grow well on the surface of the intestine, thereby exerting its immune effect. For example, Lactobacillus delbrueckii subsp. lactis 200 can improve the intestinal microorganisms of piglets and increase the number of immune-active cells in the intestine, which is beneficial to improve the immune system of piglets and activate local immune activity (Burns P, Reinheimer J, Vinderola G. Impact of bile salt adaptation of Lactobacillus delbrueckii subsp. lactis 200 on its interaction capacity with the gut. Res Microbiol. 2011 Oct; 162 (8): 782-90. doi: 10.1016 / j.resmic.2011.07.005. Epub 2011 Jul 23. PMID: 21820507.).(3) The effect of Lactobacillus delbrueckii subsp. lactis KUMS Y33 on the differentiation of human adipose-derived mesenchymal stem cells (hADSCs) into osteocytes resulted in a significant increase in ALP activity, expression levels of RUNX2 and osteocalcin, and protein levels of type I collagen and FGF-23 (osteoblast-specific markers), indicating that the osteogenesis process was enhanced and it has a positive role in the prevention and treatment of osteoporosis, thus clarifying its role in the prevention and treatment of bone age diseases (Goudarzi F, Kiani A, Nami Y, et al. Potential probiotic Lactobacillus delbrueckii subsp. lactis KUMS-Y33 suppresses adipogenesis and promotes osteogenesis in human adipose-derived mesenchymal stem cell. Sci Rep. 2024Apr 27;14(1):9689.doi:10.1038 / s41598-024-60061-2.PMID:38678043;PMCID:PMC11055903.). (4) As people's living standards continue to improve, their nutritional intake has become more abundant, which has led to an increase in serum cholesterol levels in the body, thus causing a series of diseases such as hypertension, coronary heart disease, and arteriosclerosis. Studies have shown that Lactobacillus delbrueckii subspecies CGMCC 1.2625 has a cholesterol-degrading effect in vitro (Ren D, Li C, Qin Y, et al. In vitro evaluation of the probiotic and functional potential of Lactobacillus strains isolated from fermented food and human intestine. Anaerobe. 2014 Dec; 30: 1-10. doi: 10.1016 / j.anaerobe.2014.07.004. Epub 2014 Jul 19. PMID: 25046742.).

[0005] Because Lactobacillus delbrueckii subspecies has source diversity, it has genetic diversity and functional diversity. However, the current research on the separation and identification, probiotic characteristics and metabolic mechanism of Lactobacillus delbrueckii subspecies is still less, which also affects the development and utilization of Lactobacillus delbrueckii subspecies to a certain extent. Therefore, it is necessary to dig out more new strains according to the different sources of Lactobacillus delbrueckii subspecies, and then determine its efficacy according to the function of the strain or the probiotic metabolites, clarify its application prospects, and make it better play a probiotic role. In summary, the research and application of probiotic Lactobacillus delbrueckii subspecies has a broad development space. Summary of the invention

[0006] In order to overcome the shortcomings of the above-mentioned prior art, the present invention isolates and purifies a strain of Lactobacillus delbrueckii subsp. lactis MB4 from the feces of a healthy adult in Guangdong, China. The strain can produce and secrete γ-aminobutyric acid and inhibit the activity of α-glucosidase, and has important potential application value in the fields of lowering blood sugar and helping sleep.

[0007] In order to achieve the above object, the technical solution adopted by the present invention is:

[0008] The first aspect of the present invention provides a Lactobacillus delbrueckii subsp. lactis MB4 strain, which was deposited in the China Center for Type Culture Collection on October 25, 2023, with the accession number: CCTCC NO: M 20232017; the 16S rDNA sequence of the Lactobacillus delbrueckii subsp. lactis MB4 strain is shown in SEQ ID No: 1.

[0009] The second aspect of the present invention provides the use of the Lactobacillus delbrueckii subsp. lactis MB4 strain described in the first aspect in producing γ-aminobutyric acid.

[0010] The third aspect of the present invention provides use of the Lactobacillus delbrueckii subsp. lactis MB4 strain described in the first aspect in the preparation of an α-glucosidase inhibitor.

[0011] The fourth aspect of the present invention provides a bacterial agent with probiotic function, wherein the bacterial agent comprises the Lactobacillus delbrueckii subsp. lactis MB4 strain described in the first aspect.

[0012] Preferably, the bacterial agent is a fermentation product of the Lactobacillus delbrueckii subsp. lactis MB4 strain described in the first aspect.

[0013] Preferably, in the field of medical applications, the bacterial agent also includes pharmaceutically acceptable excipients.

[0014] More preferably, the excipients include carriers and excipients. The excipients refer to diluents, adhesives, lubricants, disintegrants, solubilizers, stabilizers, etc. that can be used in the pharmaceutical field, as well as some pharmaceutical matrices. The carrier is a functional pharmaceutical excipient available in the pharmaceutical field, including surfactants, suspending agents, emulsifiers, and some new pharmaceutical polymer materials, such as cyclodextrin, chitosan, polylactic acid (PLA), polyglycolic acid polylactic acid copolymer (PLGA), hyaluronic acid, etc.

[0015] Preferably, in the field of medical applications, the dosage form of the bacterial agent includes but is not limited to tablets, granules, capsules, pellets, sustained-release agents, oral liquid preparations, and injections. The above dosage forms refer to dosage forms commonly used in clinical practice. The pharmaceutical preparation can be administered orally or parenterally (e.g., intravenously, subcutaneously, intraperitoneally or topically). If some drugs are unstable under gastric conditions, they can be prepared into enteric-coated tablets.

[0016] Compared with the prior art, the present invention has the following beneficial effects:

[0017] The present invention separates and purifies a strain of Lactobacillus delbrueckii subsp. lactis MB4 from the feces of a healthy adult in Guangdong, China. The strain has multiple prebiotic effects, including the ability to produce and secrete γ-aminobutyric acid and inhibit the activity of α-glucosidase. Therefore, the Lactobacillus delbrueckii subsp. lactis MB4 strain has multiple functions such as promoting the digestion and absorption of protein foods, improving protein allergies, anti-depression and improving sleep, lowering blood sugar and losing weight. It can be seen that the newly isolated Lactobacillus delbrueckii subsp. lactis MB4 strain of the present invention has multiple prebiotic effects and can be used in the fields of lowering blood sugar and helping sleep. For example, it can be made into medicines for lowering blood sugar and helping sleep, which has important application value and economic value. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 This is the phylogenetic tree of Lactobacillus delbrueckii subsp. lactis MB4 strain (all strains are derived from the Genome database of NCBI);

[0019] Figure 2 Lactobacillus delbrueckii subspecies MB4 can produce and secrete γ-aminobutyric acid;

[0020] Figure 3 The fermentation broth of Lactobacillus delbrueckii subspecies MB4 can secrete substances that significantly inhibit the activity of α-glucosidase. DETAILED DESCRIPTION

[0021] The specific embodiments of the present invention are further described below. It should be noted that the description of these embodiments is used to help understand the present invention, but does not constitute a limitation of the present invention. In addition, the technical features involved in each embodiment of the present invention described below can be combined with each other as long as they do not conflict with each other.

[0022] The experimental methods in the following examples are conventional methods unless otherwise specified, and the experimental materials used in the following examples are commercially available unless otherwise specified.

[0023] The experimental materials involved in the following examples are as follows:

[0024] (1) Lactobacillus delbrueckii subsp. lactis MB4 strain was isolated from the feces of a healthy adult in Guangdong, China by the Runze Laboratory of the Intestinal Microbiology Research Group and stored in a glycerol tube at -80°C. Generally, colonies can be obtained by inoculating the strain on the surface of an MRS solid culture medium plate and inverting it in a 37°C constant temperature anaerobic incubator for 24 hours, or by shaking and culturing it in an MRS liquid culture medium in a 37°C constant temperature anaerobic incubator for 24-48 hours to obtain a fermentation liquid.

[0025] (2) Kits: γ-aminobutyric acid (GABA) detection kit (Cloud-Clone Corp., Cat: CEA900Ge), α-glucosidase inhibitor screening kit (abcam, Cat: ab284520).

[0026] (3) MRS plate: beef extract 10 g, peptone 10 g, yeast extract 5 g, triammonium citrate 2 g, sodium acetate 5 g, glucose 20 g, potassium dihydrogen phosphate 2 g, Tween 80 1 mL, magnesium sulfate 0.58 g, manganese sulfate 0.25 g, agar 15 g, ddH2O to 1 L, adjust pH to 6.2-6.6, autoclave at 121°C for 20 min, and prepare MRS plate.

[0027] (4) MRS liquid medium: beef extract 10 g, peptone 10 g, yeast extract 5 g, triammonium citrate 2 g, sodium acetate 5 g, glucose 20 g, dipotassium phosphate 2 g, Tween 80 1 mL, magnesium sulfate 0.58 g, manganese sulfate 0.25 g, make up to 1 L with ddH2O, adjust the pH to 6.2-6.6, and sterilize at 121°C for 20 min to prepare MRS liquid medium.

[0028] (5) MP plate: 10 g skim milk powder, 1 g sodium chloride, 10 g beef extract, 10 g peptone, 5 g yeast extract, 20 g glucose, 2 g triammonium citrate, 5 g sodium acetate, 2 g dipotassium hydrogen phosphate, 0.5 mL Tween 80, 0.58 g magnesium sulfate, 0.25 g manganese sulfate, 15 g agar, make up to 1 L with ddH2O, adjust pH to 6.2-6.6, sterilize by autoclave at 121°C for 20 min, and prepare MP plate.

[0029] Example 1 Isolation and Identification of Lactobacillus delbrueckii subsp. lactis MB4 Strain

[0030] Lactobacillus delbrueckii subsp. lactis strain MB4 was isolated from the feces of a healthy adult (BMI=20.6) in Guangdong Province, China, as follows:

[0031] The fecal sample was repeatedly washed 3 times with sterile water, placed in a mortar, 500uL sterile water was added for every 100mg of feces, the homogenate was thoroughly ground, an appropriate amount of grinding liquid was taken with a pipette, and it was spread on an MRS plate and cultured at room temperature for 3 days. Then the colonies to be streaked and purified in the separation experiment plate were numbered with a marker, and the strain number was marked on the plate accordingly. After marking, the colonies were picked and inoculated on the MRS plate, and the strains were purified by the plate streaking method. If this method cannot separate the strains, it is necessary to pick the colonies from the enrichment plate, dilute them with the MRS liquid culture medium gradient, and spread them on the culture medium. Finally, referring to the Bergey Bacterial Identification Manual (Eighth Edition) and the Fungal Classification and Identification Manual, the strains belonging to bacteria were first distinguished. A purified strain was initially isolated, the strain number was MB4, and the colonies of the strain were observed to be round, milky white, and neatly edged after 48 hours of culture.

[0032] Then, the isolated MB4 strain was molecularly identified by 16S rDNA universal primers (27F: AGAGTTTGATCCTGGCTCAG, 1492R: TACGGCTACCTTGTTACGACTT), and the whole genome of the isolated MB4 strain was sequenced by Beijing Biomaike Biotechnology Co., Ltd. The obtained 16S rDNA sequence (SEQ ID No: 1) was BLAST-aligned in the Genome database of NCBI. The results showed that the homology of the MB4 strain with the known 16S rDNA sequence of Lactobacillus delbrueckii subsp. lactis was >99%, and evolutionary analysis was performed with homologous strains ( Figure 1 ), confirming that strain MB4 is a different strain of the same species, Lactobacillus delbrueckii subsp. lactis.

[0033] Finally, the strain MB4 was deposited, and the deposit information is as follows: deposit time: October 25, 2023; name of the depository: China Center for Type Culture Collection (CCTCC); deposit number: CCTCC NO:M 20232017; address of the depository: Wuhan University, Wuhan, China; classification name: Lactobacillus delbrueckii subsp.lactis.

[0034] Lactobacillus delbrueckii subsp. lactis is a probiotic strain with a wide range of probiotic effects, but strains from different sources have different effects, indicating that the new Lactobacillus delbrueckii subsp. lactis MB4 isolated from human feces in the present invention can be used as a probiotic and may have new effects and functions.

[0035] Lactobacillus delbrueckii subsp.Lactis MB4 16S rDNA sequence (1417bp, SEQ ID No: 1):

[0036]

[0037] Example 2 Function and application of Lactobacillus delbrueckii subsp. lactis strain MB4

[0038] (1) Lactobacillus delbrueckii subsp. lactis MB4 strain can produce and secrete γ-aminobutyric acid (GABA)

[0039] Lactobacillus delbrueckii subsp. lactis MB4 cultured to the stable phase in MRS liquid medium was expanded to a new MRS liquid medium at a dilution multiple of 1:30. The bacterial suspension was collected at 24 hours after the stable phase, and the fermentation supernatant was collected after centrifugation at 10,000×g and 4°C for 10 minutes. The GABA concentration in the fermentation supernatant was then determined by a GABA-specific ELISA kit (CEA900Ge). The results showed that compared with the low concentration of GABA in the blank medium MRS, the concentration of GABA in the fermentation supernatant of strain MB4 increased significantly, and the accumulated amount was 8.30 pg / mL, indicating that Lactobacillus delbrueckii subsp. lactis MB4 can produce and secrete γ-aminobutyric acid ( Figure 2 ).

[0040] GABA is an important inhibitory neurotransmitter of the central nervous system, which is widely found in animals, plants and microorganisms. It has been confirmed that GABA, a small molecular weight non-protein amino acid, is safe for consumption and can be used as a food additive. Studies have shown that taking a certain amount of GABA can improve the body's sleep quality, resist depression, antianxiety, lower blood pressure, improve lipid metabolism, enhance memory and improve brain activity, accelerate brain metabolism, strengthen the liver and kidneys, promote ethanol metabolism (detoxification), and improve menopausal syndrome.

[0041] Therefore, the probiotic Lactobacillus delbrueckii subsp. lactis MB4 strain can achieve the above multiple uses by producing γ-aminobutyric acid.

[0042] (2) The fermentation broth of Lactobacillus delbrueckii subspecies MB4 can effectively inhibit the activity of α-glucosidase

[0043] Lactobacillus delbrueckii subspecies MB4 cultured to the stable phase in MRS liquid medium was expanded into new MRS liquid medium at a dilution multiple of 1:30. The bacterial suspension was collected when the culture reached the stable phase for 24 hours, and the fermentation supernatant was collected after centrifugation at 10,000×g and 4°C for 10 minutes. The effect of the fermentation supernatant on the enzymatic activity of α-glucosidase to hydrolyze glucose was then determined using the α-glucosidase inhibitor screening kit (ab284520). The results showed that compared with the blank medium MRS without inhibition, the fermentation supernatant of strain MB4 significantly inhibited the ability of α-glucosidase to hydrolyze glucose, with an inhibition rate of about 16.27%, indicating that the fermentation broth of Lactobacillus delbrueckii subspecies MB4 can effectively inhibit the activity of α-glucosidase ( Figure 3 ).

[0044] α-glucosidase is an enzyme that plays a role in the breakdown of carbohydrates and is associated with type 2 diabetes. Inhibiting α-glucosidase is one of the ways to control postprandial hyperglycemia, thereby contributing to the treatment of diabetes. Therefore, α-glucosidase inhibitors help maintain blood sugar levels and can improve diabetic complications. In addition, inhibiting the activity of α-glucosidase can control obesity.

[0045] Therefore, the probiotic Lactobacillus delbrueckii subsp. lactis MB4 strain has the ability to inhibit α-glucosidase activity, which makes it a potential probiotic for lowering blood sugar and inhibiting obesity.

[0046] In summary, the newly isolated Lactobacillus delbrueckii subsp. lactis MB4 strain of the present invention can produce and secrete γ-aminobutyric acid, and can inhibit the activity of α-glucosidase. It can be seen that the newly isolated Lactobacillus delbrueckii subsp. lactis MB4 strain of the present invention has important application value and economic value in the fields of lowering blood sugar and helping sleep.

[0047] The embodiments of the present invention are described in detail above, but the present invention is not limited to the described embodiments. For those skilled in the art, various changes, modifications, substitutions and variations of these embodiments are made without departing from the principles and spirit of the present invention, and still fall within the protection scope of the present invention.

Claims

1. A strain of Lactobacillus delbrueckii subsp. lactis MB4, characterized in that: The Lactobacillus delbrueckii subsp. lactis MB4 strain was deposited in the China Center for Type Culture Collection on October 25, 2023, with the deposit number: CCTCC NO: M 20232017; the 16S rDNA sequence of the Lactobacillus delbrueckii subsp. lactis MB4 strain is shown in SEQ ID No:

1.

2. Use of the Lactobacillus delbrueckii subsp. lactis MB4 strain according to claim 1 in producing γ-aminobutyric acid.

3. Use of the Lactobacillus delbrueckii subsp. lactis MB4 strain according to claim 1 in the preparation of α-glucosidase inhibitors.

4. A bacterial agent with probiotic function, characterized in that: The bacterial agent comprises the Lactobacillus delbrueckii subsp. lactis MB4 strain according to claim 1.

5. The bacterial agent with probiotic function according to claim 4, characterized in that: The bacterial agent is a product obtained by fermentation of the Lactobacillus delbrueckii subsp. lactis MB4 strain described in claim 1.

Images