A crRNA for detecting human Trichomonas and fetus Trichomonas and its application

Abstract

The present invention discloses a crRNA and application for detecting human Trichomonas foetus and Trichomonas fetus, and belongs to the field of medical detection technology. The method of the present invention designs specific RPA primers for the 18S rRNA gene of two Trichomonas, amplifies the target fragment, and the specific crRNA and Cas12a recognize the target fragment and activate the trans-cleavage activity of Cas12a, thereby cutting the single-stranded DNA probe modified by FAM and Biotin. The presence or absence of the T line of the lateral flow chromatography test strip indicates whether the sample contains the above two types of Trichomonas; the method is fast, visual, has good specificity, high sensitivity, and low equipment requirements. It is particularly suitable for rapid and accurate detection in the field environment, and provides a good technical means for grassroots monitoring and detection of human Trichomonas foetus and Trichomonas fetus infection.

Description

Technical Field

[0001] The present invention belongs to the field of medical detection technology, and specifically relates to a crRNA for detecting human Trichomonas foetus and Tritrichomonas fetus and an application thereof. Background Art

[0002] Trichomonas is a type of anaerobic protist belonging to the phylum Parabasal, which parasitizes the oral cavity, digestive system and urogenital system of invertebrates and vertebrates. It often has 3 to 5 proflagellum, 1 hydrogenosome, 1 parabasal body and a complex cytoskeleton. Trichomonas species that have been reported to parasitize humans or animals include Trichomonas vaginalis ( Trichomonas vaginalis )、Trichomonas humanis ( Pentatrichomonas hominis, P.hominis ), Tritrichomonas fetus ( Tritrichomonas foetus, T.foetus ) and Trichomonas avium ( Trichomonas gallinae ); among them, Trichomonas hominis is the only zoonotic Trichomonas.

[0003] Human Trichomonas trichomonas is similar to other Trichomonas, with only the trophozoite stage. The life cycle of the worm is simple, and the trophozoite is both its reproductive stage and its infectious stage. It is mainly transmitted through the fecal-oral route, and can also be directly transmitted between hosts. When the trophozoite is ingested by the host through the mouth, it mainly parasitizes in the host's large intestine and obtains nutrients from the host's intestinal contents through endocytosis, pinocytosis and intraosmosis. The trophozoite proliferates by binary fission and can be excreted from the body with feces. It can survive for several hours or days in a suitable external environment and remain infectious. The trophozoite of Trichomonas fetus is pear-shaped with a round front end and a pointed rear end, 10 μm~20 μm long, with a nucleus, and the flagella originate from the kinetoplastid at the front end of the worm body, containing 3 free front flagella and 1 rear flagellum extending to the back of the body. The undulating membrane accompanies the rear flagellum, extending from front to back along the body surface, with 3~5 wavy folds. When swinging, the worm body can show a characteristic tremor, thereby distinguishing it from other protozoa. There are many hosts for the infection of Pentacillarios foetida, and this parasite has been found in mammals, reptiles, and birds. The more common hosts of infection in mammals are humans, non-human primates, dogs, pigs, cats, etc., and the harm to the infected host is mainly manifested in causing diarrhea in the host or aggravating the original diarrhea symptoms. When humans are used as infected hosts, children are susceptible to the disease, which endangers the health of children; when infecting other animals, mucous diarrhea or hemorrhagic diarrhea may occur. Tritrichomonas foetus can infect cattle, cats, dogs, pigs, etc. When it parasitizes in the reproductive tract of cattle and the digestive tract of cats, it can cause trichomoniasis in cattle and cats. Among them, bovine trichomoniasis is mainly transmitted through the sexual route, which can cause symptoms such as bovine vaginitis, endometritis, miscarriage, and infertility; while feline trichomoniasis is mainly transmitted through the fecal-oral route, which can cause chronic diarrhea in cats or no symptoms after infection; when dogs and pigs are infected, they also cause diarrhea symptoms. Therefore, it is particularly important to establish a rapid, simple, accurate, and timely method for detecting human Pentacillarios foetus and Tritrichomonas foetus infection.

[0004] At present, the detection of Trichomonas is mainly carried out by microscopy and PCR. Although the microscopy method is simple to operate and low in cost, the detection sensitivity is low, and the operator needs to have certain professional knowledge to identify the worm species. The PCR method includes conventional PCR and fluorescent quantitative PCR, which is recognized as a detection method with both high sensitivity and specificity, greatly improving the accuracy of the test results. However, this method requires expensive experimental instruments, the operation process is complicated, time-consuming, and costly. It also requires relevant professional knowledge and cannot be tested on-site in non-experimental environments. Recombinase polymerase amplification technology (RPA) is based on the T4 phage nucleic acid replication mechanism. Through the action of recombinase protein (T4 uvs X), single-stranded binding protein (T4 gp32) and DNA polymerase (Bsu), the isothermal amplification reaction of nucleic acids is completed in vitro. This technology has low requirements for instruments and equipment, and only requires constant temperature conditions (37~42℃) to complete the reaction, without the need for precision instruments. However, the detection method based on this technology has the disadvantage of false positives.

[0005] Existing technologies have developed CRISPR / Cas12a into a gene editing tool, and the trans-cleavage activity of CRISPR / Cas12a has also been reported, that is, once the double-stranded DNA cleavage activity of Cas12a is activated, it can cleave single-stranded DNA of any sequence with extremely high activity. Using this feature, CRISPR / Cas12a was subsequently developed into a nucleic acid detection tool, but the detection sensitivity of CRISPR / Cas12a itself is limited.

[0006] It is worth noting that the combination of CRISPR / Cas detection system and isothermal amplification technology achieves perfect technical complementarity. Isothermal amplification technology can improve the sensitivity of CRISPR / Cas detection. The CRISPR / Cas system uses the specific recognition ability of guide RNA (hereinafter referred to as crRNA) to improve the specificity of detection. At present, the combination of CRISPR / Cas detection system and isothermal amplification technology has been used for the detection of various pathogens. However, there are no reports on the establishment of a sensitive, specific, non-expensive and visual detection method for human Trichomonas and Fetus Trichomonas based on CRISPR / Cas detection system and isothermal amplification technology. Summary of the invention

[0007] The present invention provides a crRNA for detecting human Pentrickoniasis and Tritrichomonas fetus and its application, aiming to solve the technical problems that the existing detection methods of human Pentrickoniasis and Tritrichomonas fetus are time-consuming, have a high false positive rate, require expensive instruments or professional technicians, and cannot achieve on-site real-time detection.

[0008] The technical solution of the present invention is as follows:

[0009] One of the objects of the present invention is to provide a crRNA for detecting human Trichomonas foetus and Trichomonas fetus nucleic acids based on the RPA-CRISPR-Cas12a system, the sequence of the crRNA being shown in SEQ ID NO.19.

[0010] The second object of the present invention is to provide a reagent for detecting human Trichomonas and Fetalis nucleic acids based on the RPA-CRISPR-Cas12a system, wherein the reagent contains the above-mentioned crRNA.

[0011] The third object of the present invention is to provide the use of the above-mentioned crRNA or the above-mentioned reagent in the preparation of a kit for detecting human Trichomonas and Fetalis nucleic acids.

[0012] A kit for detecting human Pentatomonas and Tritrichomonas fetus nucleic acids based on the RPA-CRISPR-Cas12a system, the kit comprising the above-mentioned crRNA, Cas12a protein, a DNA probe double-labeled with a fluorescent group and a fluorescent quenching group, and an upstream primer and a downstream primer for recombinase polymerase nucleic acid amplification.

[0013] Furthermore, the sequences of the upstream primer and the downstream primer of the recombinase polymerase nucleic acid amplification are shown as SEQ ID NO.28 and SEQ ID NO.38 respectively.

[0014] Furthermore, the DNA probe is FAM-TTATT-Biotin.

[0015] A fourth object of the present invention is to provide the use of the above-mentioned kit in visually detecting human Trichomonas and Fetalis for non-disease diagnosis purposes.

[0016] A fifth object of the present invention is to provide a method for visually detecting human Trichomonas and Trichomonas fetus for non-disease diagnosis purposes, using the above crRNA for detection, comprising the following steps:

[0017] S1, preparing sample nucleic acid template;

[0018] S2, reacting the nucleic acid template obtained in S1, the Cas12a protein, the DNA probe double-labeled with the fluorescent group and the fluorescent quenching group, and the crRNA in the CRISPR-Cas12a system;

[0019] S3. Detect the fluorescence intensity of the S2 reaction system and directly determine with the naked eye whether the sample is infected with Trichomonas humanis and Tritrichomonas fetus.

[0020] Furthermore, the sample nucleic acid template described in S1 is prepared by recombinase polymerase nucleic acid amplification.

[0021] Compared with the prior art, the present invention has the following beneficial effects:

[0022] 1. The present invention provides a detection tool for human Trichomonas humanus and Trichomonas fetus based on RPA-CRISPR-Cas12a, which comprises a lateral flow chromatography test strip, and can realize convenient, fast and visual result interpretation.

[0023] 2. The test method of the present invention is completed under isothermal conditions, does not require professional instruments and equipment, and can be used for rapid and accurate detection in the field environment, providing a good technical means for grassroots monitoring and detection of human Trichomonas and Fetal Trichomonas infection.

[0024] 3. The combination of CRISPR / Cas detection system and isothermal amplification technology makes the method of the present invention have good sensitivity and specificity, and is suitable for the detection of clinical samples of dogs and cats. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 The electrophoresis analysis diagram of the upstream primer screening by matching the downstream primer R10 with all the upstream primers in Example 1 is shown in Figure 1. 3 The pMD19T-18S rRNA plasmid with a certain number of copies was used as a template, and the upstream primers included: F1~F8; M: DNA Marker.

[0026] Figure 2 The electrophoresis analysis results of the upstream primer F7 matching all downstream primers for downstream primer screening in Example 1 are shown in Figure 1. 3 The pMD19T-18S rRNA plasmid with a certain copy number was used as a template, and the downstream primers included: R1~R10; M: DNA Marker.

[0027] Figure 3 The electrophoresis analysis of the amplification product with the upstream primer F7 matching the downstream primer R9 in Example 1 with the negative control added; M: DNA Marker; F7 / R9: 10 3 NC: amplification results using F7 / R9 primers and pMD19T-18S rRNA plasmid with high copy number as template; NC: amplification results using F7 / R9 primers and nuclease-free water as template.

[0028] Figure 4 The results of screening different crRNAs using the fluorescence method in Example 1, where NC is a negative control; the concentration of each crRNA is 1.9 µg / µL.

[0029] Figure 5It is the specific analysis result of RPA-Cas12a-LF in Example 1.

[0030] Figure 6 It is the sensitivity analysis result of RPA-Cas12a-LF in Example 1.

[0031] Figure 7 It is the detection result of RPA-Cas12a-LF in dog and cat fecal DNA samples in Example 1, wherein 1-3: known human Pentacillarios positive DNA samples; NC: negative control; 4-20: known human Pentacillarios and Fetal Tritrichomonas negative DNA samples. DETAILED DESCRIPTION

[0032] The following will be combined with the drawings in the embodiments of the present application to clearly and completely describe the technical solutions in the embodiments of the present application. Obviously, the described embodiments are only part of the embodiments of the present application, rather than all of the embodiments. The following description of at least one exemplary embodiment is actually only illustrative and is by no means intended to limit the present application and its application or use. Based on the embodiments in the present application, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of this application.

[0033] Example 1

[0034] 1. Composition: RPA amplification kit, RPA amplification primers, crRNA, single-stranded DNA probe modified with FAM and Biotin at both ends, and lateral flow test strips.

[0035] 2. Methods:

[0036] 2.1 Design of crRNA primers

[0037] Ten crRNA-corresponding downstream primers (crRNA_175-R, crRNA_215-R, crRNA_239-R, crRNA_254-R, crRNA_148-R, crRNA_78-R, crRNA_69-R, crRNA_70-R, crRNA_212-R, crRNA_213-R) and a common upstream primer (crRNA-F) were designed based on the conserved sequences of the 18S rRNA genes of human Pentosternum and Tritrichomonas fetus (see Table 2-1).

[0038] Table 2-1 crRNA primers

[0039]

[0040] 2.2 Preparation of crRNA

[0041] Double-stranded DNA was obtained using the PCR method and upstream / downstream primers, and in vitro transcription was performed using Novozymes' T7 high-yield RNA transcription kit to obtain crRNA_175, crRNA_215, crRNA_239, crRNA_254, crRNA_148, crRNA_78, crRNA_69, crRNA_70, crRNA_212, and crRNA_213 (see Table 2-2).

[0042] Table 2-2 crRNA sequence

[0043]

[0044] 2.3 Design of RPA primers

[0045] According to the RPA primer design principles, 8 upstream RPA primers (F1, F2, F3, F4, F5, F6, F7, F8) and 10 downstream RPA primers (R1, R2, R3, R4, R5, R6, R7, R8, R9, R10) were designed around the crRNA target site and synthesized by Sangon Biotech (Shanghai) Co., Ltd. The primer sequences are shown in Table 2-3.

[0046] Table 2-3 RPA amplification primers

[0047]

[0048] 2.4 Preparation of plasmids and standards

[0049] The 18S rRNA partial gene (SEQ ID NO.40: TGTAAACGATGCCGACAGAGGTTTGTCATTTTATAATGGCAGAACTTTTAGAGAAATCATAGTTCTTGGGCTCTGGGGGAACTACGACCGCAAGGCTGAAACTTGAAGGAATTGACGGAAGGGCACACCAGGGGTGGAGCCTGTGGCTTAATTTGAATCAACACGGGGAAACTTACCAGGACCAGATGTTTTTTATGACTGACAGGCTTCGGGTCTTTCAGGATATTGCTTTTGGTGGTGCATGGCCGTTGGTGGTGCGTGGGTTGACCTGTCTAGCGTTGATTCAGCTAACGAGCGAGATTATCGCCAATTATATAGCTCGCATTGGCTTCAGTGTTG) was amplified by PCR and ligated to the pMD19T vector. The recombinant plasmid was named pMD19T-18S rRNA. The plasmid was diluted to a corresponding concentration of 1010 Copies / μL~10 0 copies / μL.

[0050] 2.5 Screening of RPA primer pairs

[0051] The downstream primer R10 was randomly selected to match all the upstream primers, and the RPA amplification reaction was performed to screen out the best upstream primer. Then the best upstream primer was used to match all the downstream primers, and the RPA amplification reaction was performed to screen out the best downstream primer. In this way, the best primer pair was finally determined. The amplification reaction was carried out according to the instructions of the RPA amplification kit of TwistDx. The reaction system: 1 tube of reaction dry powder, 29.5 μL of reaction buffer, 2.4 μL of upstream primer (10 μM), 2.4 μL of downstream primer (10 μM), 11.2 μL of water, 2 μL of DNA sample, and 2.5 μL of 280 mM activator (MgOAc). The reaction conditions were 39°C and 20 min. The amplification product was treated with a mixture of phenol-chloroform-isoamyl alcohol and analyzed by agarose gel electrophoresis to screen the best primer pair. Sterile enzyme-free water is used as a DNA sample for a negative control. The primer pair with no bands or only primer dimers in the negative control is the best and can be selected as the subsequent primer pair for use.

[0052] 2.6 Screening of crRNA

[0053] The cleavage reaction system was configured as follows: 5 μL of Cas12a protein (1 μmol / L, purchased from Life Science Reagent Company), 1 μL each of purified crRNA (crRNA_175, crRNA_215, crRNA_239, crRNA_254, crRNA_148, crRNA_78, crRNA_69, crRNA_70, crRNA_212, crRNA_213, 400 ng / μL), and NE Buffer. TM r2.1 (10×) 3 μL, nuclease-free water 17 μL, DNA sample (gel recovery product of PCR amplification of partial 18S rRNA gene) 3 μL, and 1 μL of 10 μM fluorescent probe (SEQ ID NO.41: 5′6-FAM-CCGGAAAAAAAAAAAACCGG-3′ BHQ1) were placed in a fluorescent quantitative PCR instrument, and the crRNA with the best trans-cleavage efficiency was selected according to the fluorescence value and peak time of the amplification curve.

[0054] 2.7 Specificity analysis of RPA-CRISPR-Cas12a detection method

[0055] Pentagonomus hominis, Tritrichomonas fetus, Giardia lamblia ( Giardia lamblia, G. lamblia ), Isospora canis ( Isospora canis, I. canis ), Cryptosporidium ( Cryptosporidium, C.dium ), Toxoplasma gondii ( Toxoplasma gondii, T. gondii ), Toxocara canis ( Toxocara canis, T. canis ), Toxocara canis ( Toxascaris leonina, T.leonina ) genome as a template, and RPA amplification was performed using F7 / R9. 10 μL of RPA amplification product, 5 μL of Cas12a protein, 1 μL of 100 nM single-stranded DNA probe (5′6-FAM-TTATT-3′Biotin), 1 μL of 400 ng / μL crRNA_70, and 3 μL of NE Buffer were added. TM Mix r2.1 (10×) and 10 μL of water, incubate for 30 min, then add 20 μL of water. Insert the lateral flow chromatography test strip into the above reaction solution for observation.

[0056] 2.8 Sensitivity analysis of the RPA-CRISPR-Cas12a detection method

[0057] Take 2 μL of the serially diluted pMD19T plasmid (10 2 Copies / μL~10 0 Copies / μL) were used as templates, and F7 / R9 was used for RPA amplification. For the subsequent cleavage reaction, refer to the system and conditions in "2.7 Analysis of the specificity of the RPA-CRISPR-Cas12a detection method". After the reaction, the lateral flow chromatography test strip was inserted into the liquid for observation.

[0058] 2.9 Clinical sample testing

[0059] Using 20 known dog and cat fecal DNA samples as templates, RPA amplification was performed using F7 / R9. The subsequent cleavage reaction refers to the system and conditions in "2.7 Specificity analysis of RPA-CRISPR-Cas12a detection method". After the reaction, the lateral flow chromatography test strip was inserted into the liquid for observation.

[0060] 3. Results

[0061] 3.1 Screening of RPA primer pairs

[0062] The electrophoresis results of RPA amplification in which the downstream primer R10 matched all the upstream primers showed that the upstream primer F7 had the best effect ( Figure 1 The electrophoresis results of RPA amplification using the best upstream primer F7 to match all downstream primers showed that the downstream primer R9 had the best effect ( Figure 2 The negative control with primer pair F7 / R9 was normal ( Figure 3 ). Therefore, the F7 / R9 primer pair was selected for subsequent experiments.

[0063] 3.2 Screening of crRNA

[0064] After annealing the upstream and downstream primers, 10 crRNAs were successfully obtained using an in vitro transcription kit. The cleavage reaction system was configured with these 10 crRNAs. The results showed that the fluorescence value corresponding to the crRNA_70 group was the highest and the peak was the earliest ( Figure 4 ). Therefore, crRNA_70 was selected for subsequent experiments.

[0065] 3.3 Specificity analysis results

[0066] Using the genomic DNA samples of Giardia, Isospora canis, Cryptosporidium, Toxoplasma gondii, Toxocara canis, and Toxocara canis as controls, the results of the RPA-CRISPR-Cas12a method showed that only the genomic DNA sample groups of Trichomonas hominis and Trichomonas fetus had bands on the T line, while the genomic DNA sample groups of the other six protozoa had bands on the C line but no bands on the T line ( Figure 5 ), indicating that the established RPA-CRISPR-Cas12a method has good specificity.

[0067] 3.4 Sensitivity analysis results

[0068] Different copy numbers (5×10 2 ~5×10 0 The results showed that the plasmid copy number was 5×10 1 When the number of copies / μL or above is 1, the corresponding bands can be detected ( Figure 6 ), indicating that the minimum detection limit of the method established in this study is 5×10 1 copies / μL.

[0069] 3.5 Test results of 20 known dog and cat fecal DNA samples

[0070] The results of the detection of 20 dog and cat fecal DNA samples using the RPA-CRISPR-Cas12a system established above to visualize the detection of human Pentococcus and Fetus Tritrichomonas showed that the results of the known negative and positive samples were consistent with the method, with a coincidence rate of 100% ( Figure 7 ).

[0071] Finally, it should be emphasized that the above is only a preferred embodiment of the present invention and is not intended to limit the present invention. For those skilled in the art, the present invention may have various changes and modifications. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.

Claims

1. A kit for detecting human Trichomonas and Fetalis nucleic acids based on the RPA-CRISPR-Cas12a system, characterized in that: The kit includes a crRNA for detecting human Trichomonas foetus and Trichomonas fetus nucleic acids based on the RPA-CRISPR-Cas12a system, a Cas12a protein, a DNA probe double-labeled with a fluorescent group and a fluorescent quenching group, and an upstream primer and a downstream primer for recombinase polymerase nucleic acid amplification; Among them, the sequence of the crRNA is shown as SEQ ID NO.19, and the sequences of the upstream primer and downstream primer of the recombinase polymerase nucleic acid amplification are shown as SEQ ID NO.28 and SEQ ID NO.38 respectively.

2. The kit according to claim 1, characterized in that The DNA probe is FAM-TTATT-Biotin.

Images