An armored RNA granule exocytosis system based on pepper visualization positioning

Abstract

The present invention discloses an armored RNA particle exocytosis system based on pepper visualization positioning, and belongs to the field of DNA recombination technology. The present invention inserts the OmpA signal peptide sequence, MS2-2CP sequence, pac-site sequence, Kil-M sequence and pepper gene specific sequence into the pRSF-Duet-1 expression vector to construct a recombinant expression vector, and transfers it into Escherichia coli to construct a recombinant bacterium; by inducing the expression of the recombinant bacterium, the prepared armored RNA particles can be excreted in the culture medium, simplifying the purification process of the armored RNA particles; in addition, the characteristics of pepper RNA specifically binding to HBC dye and emitting fluorescent signals are utilized to not only realize the visualization of nano-scale armored RNA particles, but also further verify the specificity of the particle packaging site to specifically recognize RNA and embed it.

Description

Technical Field

[0001] The present invention relates to the technical field of DNA recombination, and in particular to an armored RNA particle exocytosis system based on pepper visual positioning. Background Art

[0002] The Armored RNA preparation technology was first proposed by Pasloske et al. to mainly solve a series of defects of traditional RNA quality control products. Armored RNA particles are a kind of nano-scale biological particle material. With the advantages of "stability, biosafety, and full quality control", they are not only used in RNA pathogenic microorganisms, especially the nucleic acid detection quality control system in the field of highly pathogenic pathogenic microorganism research, but also gradually extended to the research and development of mRNA vaccines and drugs. Although the existing armored RNA particle preparation technology has undergone innovative improvements, the packaging length and packaging quality of exogenous genes have been greatly improved. However, the related preparation technology still has problems such as "complex purification processes such as cell wall breaking and difficulty in monitoring the morphology of exogenous RNA". It is urgent to break through the technical bottleneck, develop an armored RNA particle exocytosis system, further optimize the preparation process, and realize the visual monitoring of nanoparticles containing exogenous RNA.

[0003] Pepper is a new type of RNA fluorescent aptamer, a specific RNA sequence. HBC is a new type of dye ligand developed based on the fluorophore HBI (4-hydroxybenzylidene imidazolinone) of green fluorescent protein GFP. It does not fluoresce when free in the solution, but only emits light after restraining the movement of molecules. Pepper specifically binds to HBC (see the schematic diagram Figure 1 ), emits a strong fluorescent signal and is currently widely used in RNA live cell imaging. Summary of the invention

[0004] The purpose of the present invention is to provide an armored RNA particle exocytosis system based on pepper visualization positioning to solve the problems existing in the above-mentioned prior art. The present invention prepares nanoscale armored RNA particles, which are guided by secretion signal peptides and increase the permeability of the outer membrane to achieve exocytosis in the culture medium, and simplifies the purification process of the armored RNA particles, thereby achieving visualization of nanoscale particles.

[0005] To achieve the above object, the present invention provides the following solutions:

[0006] The present invention provides a recombinant expression vector for an armored RNA particle exocytosis system based on pepper visualization positioning, wherein the recombinant expression vector is constructed by inserting an OmpA signal peptide sequence, an MS2-2CP sequence, a pac-site sequence, a Kil-M sequence and a pepper gene into the expression vector;

[0007] Among them, the nucleotide sequence of the OmpA signal peptide sequence is shown in SEQ ID NO: 1, the nucleotide sequence of the MS2-2CP sequence is shown in SEQ ID NO: 2, the nucleotide sequence of the pac-site sequence is shown in SEQ ID NO: 3, the nucleotide sequence of the Kil-M sequence is shown in SEQ ID NO: 4, and the nucleotide sequence of the pepper gene is shown in SEQ ID NO: 5.

[0008] Preferably, the expression vector comprises pRSF-Duet-1 vector.

[0009] The present invention also provides a recombinant bacterium for an armored RNA granule exocytosis system based on pepper visual positioning, and the recombinant bacterium comprises the recombinant expression vector.

[0010] The present invention also provides an armored RNA particle exocytosis system based on pepper visualization positioning, which is obtained by inducing the expression of the recombinant bacteria, removing the bacteria, and collecting the supernatant. When the above-mentioned armored RNA particle exocytosis system is used, HBC is added, and whether pepper RNA is present can be judged based on whether green fluorescence is displayed; of course, other types of RNA can also be used in practical applications.

[0011] Preferably, the method for inducing expression of the recombinant bacteria comprises: culturing the recombinant bacteria at 37° C., adding IPTG, and then inducing expression at 25-28° C. and 100-150 rpm for 12-20 h.

[0012] The present invention also provides a method for preparing an armored RNA particle exocytosis system based on pepper visual positioning, comprising the following steps:

[0013] Inserting the OmpA signal peptide sequence and the MS2-2CP sequence into an expression vector to construct a recombinant plasmid; synthesizing the Kil-M sequence, the pac-site sequence and the pepper gene in vitro, and inserting them into the recombinant plasmid to construct a recombinant expression vector; wherein the nucleotide sequence of the OmpA signal peptide sequence is shown in SEQ ID NO: 1, the nucleotide sequence of the MS2-2CP sequence is shown in SEQ ID NO: 2, the nucleotide sequence of the pac-site sequence is shown in SEQ ID NO: 3, the nucleotide sequence of the Kil-M sequence is shown in SEQ ID NO: 4, and the nucleotide sequence of the pepper gene is shown in SEQ ID NO: 5;

[0014] Transforming the recombinant expression vector into a competent host bacterium to construct a recombinant bacterium;

[0015] The recombinant bacteria are induced to express, and then the bacteria are removed and the supernatant is collected to obtain the armored RNA particle exocytosis system based on pepper visual positioning.

[0016] Preferably, after the OmpA signal peptide sequence and MS2-2CP sequence are connected in series, BamHI and HindIII restriction sites are added at both ends;

[0017] After the Kil-M sequence, pac-site sequence and pepper gene were synthesized in vitro, BglII and KpnI restriction sites were added at both ends.

[0018] Preferably, the expression vector includes pRSF-Duet-1 vector, and the host bacteria includes Escherichia coli BL21 (DE3).

[0019] Preferably, the method for inducing expression of the recombinant bacteria comprises: culturing the recombinant bacteria at 37° C., adding IPTG, and then inducing expression at 25-28° C. and 100-150 rpm for 12-20 h.

[0020] The present invention also provides the use of the recombinant expression vector or the recombinant bacteria or the armored RNA particle exocytosis system in any of the following:

[0021] (1) Application in the preparation of products for nucleic acid quality control systems;

[0022] (2) Application in the preparation of products for RNA live cell imaging;

[0023] (3) Application in the preparation of mRNA vaccines or drugs.

[0024] The present invention discloses the following technical effects:

[0025] (1) The armored RNA particles prepared by the present invention are nanometer-sized and secreted into the culture medium by means of secretion signal peptide guidance and increased outer membrane permeability, thereby avoiding cell wall rupture, reducing the toxic properties of toxic proteins, and simplifying the purification process of armored RNA particles.

[0026] (2) The present invention enhances the correct folding of recombinant proteins and improves the biological activity of proteins through secretory expression of constructed recombinant bacteria.

[0027] (3) The pepper target gene was transcribed in the E. coli expression system and embedded in the armored RNA particles in the form of RNA. By taking advantage of the characteristics of pepper RNA specifically binding to HBC dye and emitting fluorescent signals, not only the nanoscale particles can be visualized, but also the specificity of the particle packaging site to specifically recognize RNA rather than DNA and embed it is further verified. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0029] Figure 1 Schematic diagram of the binding of pepper aptamer and HBC dye;

[0030] Figure 2 Schematic diagram for the construction of the pRSF-OMS-PP expression vector;

[0031] Figure 3 This is the fluorescence PCR amplification identification diagram of pRSF-OMS-PP recombinant bacteria; 1-3 are recombinant bacteria of different concentrations, and the others are negative controls;

[0032] Figure 4 This is a fluorescence image of pRSF-OMS-PP armored RNA particles stained with HBC;

[0033] Figure 5 This is the dynamic diffraction pattern of pRSF-OMS-PP armored RNA particles;

[0034] Figure 6 This is a transmission electron micrograph of pRSF-OMS-PP armored RNA particles;

[0035] Figure 7 These are the results of RT-PCR detection of orf1ab gene and N gene. DETAILED DESCRIPTION

[0036] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0037] It should be understood that the terms described in the present invention are only for describing a particular embodiment and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. The intermediate value in any stated value or stated range, and each smaller range between any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0038] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0039] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to those skilled in the art. The present invention description and examples are exemplary only.

[0040] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0041] Example 1

[0042] 1. Construction of pRSF-OMS recombinant plasmid

[0043] The OmpA signal peptide sequence and MS2-2CP sequence were synthesized in series, and BamHI / HindIII restriction sites were added at both ends and constructed into the pRSF-Duet-1 vector to obtain a recombinant plasmid named pRSF-OMS.

[0044] OmpA signal peptide sequence (SEQ ID NO: 1):

[0045] ATGAAAAAGACAGCTATCGCGATTGCAGTGGCACTGGCAGGTTTCGCTACCGTCGC TCAGGCT.

[0046] MS2-2CP sequence (SEQ ID NO: 2):

[0047]

[0048] 2. Construction of pRSF-OMS-PP expression vector

[0049] The Kil-M sequence, pac-site sequence and pepper gene sequence were synthesized in vitro, and BglII / KpnI restriction sites were added at both ends to construct the pRSF-OMS vector to obtain the recombinant plasmid pRSF-OMS-PP (see Figure 2 ).

[0050] Pac-site sequence (SEQ ID NO: 3): AAACATGAGGATTACCCATGT.

[0051] Kil-M sequence (SEQ ID NO: 4):

[0052] ATGAGGAAAAGATTTTTTGTGGGAATATTCGCGATAAAGGGCCTCCTTGTTGGATGT CAGGCTAACTATATACCTGATGTTCAGGGAGGGACCATCGCACCATCCTCCTCTCTAAA CTGACGATCGCGGTTCAGTAG.

[0053] Pepper gene sequence (SEQ ID NO: 5):

[0054] GGCGCACTGGCGCTGCGCCATCGGGCGCCAATCGTAGCGTCTCGGCGCC.

[0055] 3. Identification and sequencing evaluation of pRSF-OMS-PP recombinant bacteria

[0056] The recombinant plasmid pRSF-OMS-PP was transformed into BL21 (DE3) competent cells, and the positive clones were obtained by resistance combined with blue-white screening. The pRSF-OMS-PP recombinant bacteria were identified by fluorescence PCR and sequencing using a specific primer / probe system (see Table 1).

[0057] Table 1 Primer and probe sequences

[0058]

[0059] Reaction system: 2x TaqMan PCR mix 10μL, 10μmol / L pSRF-F 1.0μL, 10μmol / L pSRF-R 1.0μL, 10μmol / L pSRF-P 0.5μL, then add 5.0μL pRSF-OMS-PP recombinant bacteria, and add sterile double distilled water to make the volume to 20μL.

[0060] Reaction procedure: 95℃ pre-denaturation for 2 min; 95℃ for 5 s; 60℃ for 20 s, 40 cycles. After each cycle, the fluorescence signal data of FAM and VIC channels were collected.

[0061] Prepare different concentrations of recombinant bacteria for detection, and the fluorescence PCR amplification curve is as follows Figure 3 As shown, it indicates that the pRSF-OMS-PP recombinant bacterial nucleic acid is positive. Sequencing (BGI Genomics Co., Ltd.) shows that the OmpA signal peptide sequence, MS2-2CP sequence, pac-site sequence, Kil-M sequence and pepper sequence are correctly inserted into the vector pRSF-Duet-1.

[0062] 4. Preparation of pRSF-OMS-PP armored RNA particles and visual evaluation of the exocytosis system

[0063] The pRSF-OMS-PP recombinant bacteria were cultured at 37°C, IPTG (final concentration of 1mM) was added, and the expression was induced at 28°C / 150rpm for 16h. The bacteria were removed at 10000rpm and 4°C, and the supernatant was collected. The supernatant was sterilized and concentrated using a bacterial filter membrane (0.45μM) and an ultrafiltration membrane (10KD). 10μL of the concentrated supernatant was dropped on a glass slide, HBC was added at a final concentration of 2μM, mixed, and incubated in the dark for 5min. After adding a coverslip, it was observed with the aid of an inverted fluorescence microscope (model) EVOS fl. ​​The observation results are as follows Figure 4 As shown in (400X), there is a green fluorescent signal, which is produced by the complex of pepper RNA and HBC, indicating that armored RNA particles are secreted in the culture medium, and the type of nucleic acid encapsulated by the particles is RNA.

[0064] 5. Morphological identification of pRSF-OMS-PP armored RNA particles

[0065] The purified armored RNA particles were negatively stained and observed under transmission electron microscopy; the armored RNA particles were analyzed using a dynamic diffractometer to evaluate the morphology of armored RNA particle exosomes and the uniformity of the solution.

[0066] The solution containing the armored RNA particles was analyzed by dynamic diffraction, e.g. Figure 5 As shown, the results show that the particle size is concentrated around 26-50nm (diameter), and the particles are evenly distributed; the particles are observed by transmission electron microscopy after negative staining, and the morphology is as follows Figure 6 As shown, the results show polygonal regular particles, the size of which is equivalent to the diffraction analysis results.

[0067] 6. Development of armored RNA particles for the new coronavirus (SARS-CoV-2)

[0068] Based on the gene sequence of the Wuhan-Hu-1 isolate (accession number NC_045512.2) published by GenBank, the target gene orf1ab gene (corresponding to sites 13322-13531) and the N gene (corresponding to sites 28274-29533) were selected for splicing and recombination, artificially synthesized and inserted into the pGEM-T vector to obtain the plasmid pGEM-T-SARS-CoV2. The pGEM-T-SARS-CoV2 (containing orf1ab / N gene) plasmid and the pRSF-OMS-PP plasmid prepared above were double-digested with KpnI and HindIII, gel-recovered, purified, connected, and sequenced to construct the pRSF-OMS-PP-SARS-CoV-2 recombinant plasmid.

[0069] The pRSF-OMS-PP-SARS-CoV-2 recombinant bacteria were induced to express, and the expression product was treated in the same way as in "4. Preparation of pRSF-OMS-PP armored RNA particles and visual evaluation of the exocytosis system". The recovered armored RNA particles were extracted with the QIAamp ViralRNAMini Kit (QIAGEN) commercial kit, eluted with 50 μL elution buffer, and RNA templates were prepared. RNA fluorescent RT-PCR detection was performed according to the orf1ab gene and N gene detection system recommended by the National CDC. The results are shown in Figure 7 The results showed that the armored RNA particles can achieve full quality control of the sample nucleic acid extraction, reverse transcription and amplification detection process, and can be used as a positive quality control product in the universal fluorescent RT-PCR detection method of the new coronavirus (orf1ab / N gene).

[0070] At the same time, the purified armored RNA particles were observed under transmission electron microscopy and were in polygonal particle morphology and evenly distributed. The purified armored RNA particles were combined with HBC dye and treated in the same way as "4. Preparation of pRSF-OMS-PP armored RNA particles and visual evaluation of the exocytosis system". When observed under an inverted fluorescence microscope EVOS fl (400X), a green fluorescent signal was visible, which was produced by the complex of pepper RNA packaged in the particles and HBC binding.

[0071] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. A recombinant expression vector for an armored RNA particle exocytosis system based on pepper visualization positioning, characterized in that: The recombinant expression vector is constructed by inserting the OmpA signal peptide sequence, MS2-2CP sequence, Kil-M sequence, pac-site sequence and pepper gene into the expression vector in order from the 5' end to the 3' end; Among them, the nucleotide sequence of the OmpA signal peptide sequence is shown in SEQ ID NO: 1, the nucleotide sequence of the MS2-2CP sequence is shown in SEQ ID NO: 2, the nucleotide sequence of the pac-site sequence is shown in SEQ ID NO: 3, the nucleotide sequence of the Kil-M sequence is shown in SEQ ID NO: 4, and the nucleotide sequence of the pepper gene is shown in SEQ ID NO:

5.

2. The recombinant expression vector according to claim 1, characterized in that The expression vector includes pRSF-Duet-1 vector.

3. A recombinant bacterium for an armored RNA particle exocytosis system based on pepper visualization positioning, characterized in that: The recombinant bacteria include the recombinant expression vector according to claim 1 or claim 2.

4. An armored RNA particle exocytosis system based on pepper visualization positioning, characterized in that: The method is obtained by inducing the expression of the recombinant bacteria according to claim 3, removing the bacteria, and collecting the supernatant.

5. The armored RNA particle exocytosis system based on pepper visual positioning as claimed in claim 4, characterized in that: The method for inducing expression of the recombinant bacteria comprises: culturing the recombinant bacteria at 37° C., adding IPTG, and then inducing expression at 25-28° C. and 100-150 rpm for 12-20 hours.

6. A method for preparing an armored RNA particle exocytosis system based on pepper visual positioning, characterized in that: The following steps are involved: The OmpA signal peptide sequence and the MS2-2CP sequence were connected in series and inserted into the expression vector to construct a recombinant plasmid; The Kil-M sequence, pac-site sequence and pepper gene are synthesized in vitro, and inserted into the recombinant plasmid to construct a recombinant expression vector; wherein the nucleotide sequence of the OmpA signal peptide sequence is shown in SEQ ID NO: 1, the nucleotide sequence of the MS2-2CP sequence is shown in SEQ ID NO: 2, the nucleotide sequence of the pac-site sequence is shown in SEQ ID NO: 3, the nucleotide sequence of the Kil-M sequence is shown in SEQ ID NO: 4, and the nucleotide sequence of the pepper gene is shown in SEQ ID NO: 5; the recombinant expression vector comprises the OmpA signal peptide sequence, MS2-2CP sequence, Kil-M sequence, pac-site sequence and pepper gene inserted in sequence from the 5' end to the 3' end; Transforming the recombinant expression vector into a competent host bacterium to construct a recombinant bacterium; The recombinant bacteria are induced to express, and then the bacteria are removed and the supernatant is collected to obtain the armored RNA particle exocytosis system based on pepper visual positioning.

7. The preparation method according to claim 6, characterized in that: After the OmpA signal peptide sequence and MS2-2CP sequence were connected in series, BamHI and HindIII restriction sites were added at both ends; After the Kil-M sequence, pac-site sequence and pepper gene were synthesized in vitro, BglII and KpnI restriction sites were added at both ends.

8. The preparation method according to claim 6, characterized in that: The expression vector includes the pRSF-Duet-1 vector, and the host bacteria includes Escherichia coli BL21 (DE3).

9. The preparation method according to claim 6, characterized in that: The method for inducing expression of the recombinant bacteria comprises: culturing the recombinant bacteria at 37° C., adding IPTG, and then inducing expression at 25-28° C. and 100-150 rpm for 12-20 hours.

10. Use of the recombinant expression vector according to any one of claims 1 to 2, the recombinant bacteria according to claim 3, or the armored RNA particle exocytosis system according to any one of claims 4 to 5 in the preparation of products for detecting nucleic acid quality control systems.

Images