A preparation method for increasing the size of black soldier flies based on gene editing
The torso gene of the black soldier flies was mutation through CRISPR/Cas9 gene editing technology, which solved the problem of difficulty in improving the body shape and processing ability of the black soldier flies in traditional breeding methods. It successfully cultivated a large individual strain with doubled weight, simplified breeding The process and improves the processing capacity of organic waste.
Patent Information
- Application Number
- CN202411274572.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-09-12
- Publication Date
- 2025-01-10
- Estimated Expiration
- Not applicable · inactive patent
AI Technical Summary
The prior art is difficult to effectively improve the size of the black soldier fly and the ability to deal with organic waste through traditional breeding methods, and the breeding process is complex and has a long cycle.
The torso gene of the black soldier flies was mutated by CRISPR/Cas9 gene editing technology, and the large black soldier flies were cultivated through gene editing methods. After the mutation, the individual's weight increased by more than doubled and was permanently in the larval feeding stage to enhance waste Processing capability.
It has successfully cultivated large individual strains with double weight in black soldier fly, simplified the breeding process, broke through the complexity and long cycle of traditional breeding, and significantly improved individuals' ability to deal with organic waste.
Smart Images
Figure CN118773261B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of biotechnology, and in particular to a preparation method for increasing the body size of black soldier flies based on gene editing. Background Art
[0002] Bright-spotted soldier fly ( Hermetia illTcens L.), commonly known as the black soldier fly, belongs to the order Diptera, family Schizontidae, and is an important resource insect. Its larvae feed on rotten organic matter and animal feces in nature. When artificially raised, black soldier flies can efficiently process a variety of complex organic wastes and inhibit the proliferation of pathogens therein. Black soldier fly larvae have high economic value. In the process of converting organic waste, they can accumulate a large amount of protein and fat, which can be used in the preparation of biodiesel, or as an animal feed additive to partially replace traditional animal and plant proteins such as fish meal and soybean meal. In addition, black soldier flies have a short growth cycle, strong reproductive ability, simple breeding, and do not carry and spread pathogens, making them very suitable for large-scale artificial breeding. In short, black soldier flies show great application value in the fields of alternative resources and environmental governance.
[0003] Increasing the production of black soldier flies has important production and economic value. In addition to conventional methods such as expanding production scale and improving production systems, breeding large-sized improved black soldier fly strains and improving the individual's ability to feed on organic waste is an important way to increase the production of black soldier flies.
[0004] Torso There are few reports on the function of this gene. It is involved in metamorphosis in fruit flies and silkworms, and its mutants show partial developmental delay and cause a certain degree of weight gain. torso The gene sequences in Drosophila melanogaster, silkworm and black soldier fly are highly homologous at the C-terminus, but generally conservative at the N-terminus. Due to differences in the metamorphosis regulation mechanism of black soldier flies, torso The mutation may cause an increase in size, which has application value in preparing black soldier flies with strong feeding ability.
[0005] Molecular breeding has become a fast and efficient breeding method. New gene mutation methods such as CRISPR / Cas9 can operate on single or multiple genes to achieve the purpose of gene mutation, with the advantages of clear targets and high specificity. Summary of the invention
[0006] The purpose of the present invention is to provide a preparation method for increasing the body size of black soldier flies based on gene editing.
[0007] Yet another object of the present invention is a method for breeding large-bodied black soldier fly strains.
[0008] The method for preparing a black soldier fly for increasing its body size based on gene editing according to the present invention comprises: torso The step of gene editing, wherein the torso The nucleotide sequence of the gene is shown in SEQ ID No:1.
[0009] According to the preparation method of increasing the size of black soldier flies based on gene editing of the present invention, the black soldier flies are mutated by the CRISPR / Cas9 gene editing method. torso Gene.
[0010] According to the method for preparing the enlarged black soldier fly based on gene editing of the present invention, the black soldier fly torso The target sequence of the gene is 5' AAATAGCGTAAAGCAAAAAACGG 3'.
[0011] According to the preparation method for increasing the body size of black soldier flies based on gene editing of the present invention, the nucleotide sequence of the sgRNA used in the CRISPR / Cas9 gene editing method is shown in SEQ ID No: 7.
[0012] The method for cultivating a large black soldier fly strain according to the present invention comprises the following steps:
[0013] Against black soldier flies torso Gene editing is performed to select black soldier fly mutants with enlarged body size, wherein the torso The nucleotide sequence of the gene is shown in SEQ ID No: 1;
[0014] Screening for black soldier fly homozygotes.
[0015] The present invention uses a gene editing method to mutate black soldier flies torso Gene, established a large black soldier fly strain, this method can obtain a large black soldier fly with a weight more than doubled, which is permanently in the larval feeding stage, enhances the individual's ability to handle waste, and breaks through the complexity and long cycle of traditional breeding methods. BRIEF DESCRIPTION OF THE DRAWINGS
[0016] Figure 1 The results of the genome mutation detection are shown. The red sequence represents the PAM base, the blue represents the sgRNA target sequence, the numbers represent the number of missing bases, the black represents the bases around the target, WT represents the wild-type individual, and M1-M2 represents two homozygous mutation types;
[0017] Figure 2 The individual sizes of mutant and wild-type larvae are shown, where the wild-type is the last instar, the fifth instar larvae, and the mutant is the seventh instar larvae that grow extra;
[0018] Figure 3The weight difference between mutants and wild types is shown, where the wild type is the maximum weight stage of the last instar, the fifth instar larvae, and the mutant is the seventh instar larvae that have grown extra. DETAILED DESCRIPTION
[0019] The present invention is further described in detail below in conjunction with specific examples. It should be understood that the following examples are only used to illustrate the present invention and are not used to limit the scope of the present invention.
[0020] The present invention combines black soldier fly embryo microinjection technology, genome editing technology and molecular biological operations to successfully construct a case of using gene editing technology to achieve large black soldier flies. In the following examples, gene editing technology was used to achieve development-related genes torso The gene was successfully knocked out and mutations were detected at the target site on the genome. torso The presence of gene mutation can be determined by observing whether there is a significant increase in body weight, and the correctness of the gene mutation can be detected by PCR amplification and sequencing.
[0021] The molecular biology experiments in the following examples, including plasmid construction, enzyme digestion, competent cell preparation, transformation, etc., are mainly performed with reference to the Molecular Cloning Experiment Guide (3rd Edition). The operations can be performed according to the instructions of the relevant kits. If necessary, the specific experimental conditions, such as PCR conditions, can be determined by simple experiments.
[0022] Example 1: Cloning of torso gene
[0023] The RNA of black soldier fly was extracted and reverse transcribed into cDNA. The primers torso-F: (SEQ ID No: 2) and torso-R: (SEQ ID No: 3) were designed to torso The gene was cloned from the black soldier fly cDNA, connected to the P-Jet-1.2 vector and sequenced for verification. The obtained gene sequence is shown in SEQ ID No: 1.
[0024] SEQ ID No: 1
[0025]
[0026] Example 2: Knockout of the black soldier fly torso gene
[0027] exist torso A target with a length of 23 bases and a PAM sequence of NGG (5'-3') was selected on the first exon of the gene. The selected target sequence was 5' AAATAGCGTAAAGCAAAAAACGG 3' (SEQ ID No: 4). Primers were designed to synthesize the corresponding sgRNA template. The primer sequences are as follows. sgRNA-F: (SEQ ID No: 5); the reverse primer is universal primer R: SEQ ID No: 6).
[0028] The obtained sgRNA template was amplified in vitro using a kit to obtain a single-stranded sgRNA (SEQ ID No: 7).
[0029] The synthesized sgRNA was mixed with Cas9 protein (333ng / µL) at a concentration of 400ng / µL and injected into the newly laid black soldier fly embryos using a microinjector. The injected eggs were aged at 25°C until they hatched, and the hatched larvae were raised, part of which was used to extract genomic DNA, and part of which was used for multi-generation hybridization to screen homozygotes.
[0030] Ten hatched larvae were mixed and genomic DNA was extracted. Primers were designed upstream and downstream of the target site, and PCR was used to detect whether the genomic sequence had changed. The mutation detection primers were torso-TS-F: (SEQ ID No: 8);
[0031] torso-TS-R: (SEQ ID No: 9).
[0032] PCR was performed according to the operation, and the concentration of template DNA was controlled between 100ng-150ng, not too much, and the system was 50TL. The fragments amplified by PCR were connected to the P-Jet-1.2 vector for sequencing, and the comparison was made to confirm whether mutations occurred. Generally, there are two types of mutations, namely point mutations and fragment deletions. Figure 1 The results of the genome mutation detection are shown. The red sequence represents the PAM base, the blue represents the sgRNA target sequence, the number represents the number of missing bases, the black represents the bases around the target, WT represents the wild-type individual, and the larvae are mixed to detect mutations. Two types of mutations are detected, and M1-M2 represents two homozygous mutation types. After confirming the mutation, the remaining larvae are hybridized. After hybridization, the black soldier flies used for passage obtain effective mutants carrying these two types of mutations, and the above two effective mutation types are still selected in the hybrid offspring.
[0033] The mutant larvae of the same age are still larger than the wild type. Since the mutant can feed permanently and has the ability to continuously consume organic waste, the extra-grown mutant seventh-instar larvae were selected for comparison with the last instar of the wild type, the fifth-instar larvae. Figure 2 The individual sizes of mutant and wild-type larvae are shown. The wild-type larvae are the fifth-instar larvae, the last instar of the larvae, and the mutant larvae are the seventh-instar larvae that have grown extra. Compared with the wild-type larvae, the size of the mutant larvae has increased significantly. Figure 3 The figure shows the weight difference between mutants and wild types. The wild type is the fifth-instar larvae, the last instar with the largest weight, while the mutant is the seventh-instar larvae with additional growth. The weight of the mutant is more than doubled.
[0034] Using piggyBac transgenic technology, we injected and screened transgenic lines with EGFP inserted into chromosome 1 as balancer tools. torso The gene is located on chromosome 1 and will knock out the current torso The mutant was hybridized with the balancer soldier fly to obtain a green fluorescent torso Heterozygous, homozygous obtained after self-pollination.
[0035] The above experiments show that the present invention can successfully achieve development-related genes in black soldier flies torso The knockout of the gene was achieved and large black soldier flies were obtained whose weight increased by more than double. Therefore, this non-transgenic breeding method is of great value in improving the ability of single black soldier flies to process waste.
[0036] It should be understood that after reading the above content of the present invention, those skilled in the art may make various changes or modifications to the present invention, and these equivalent forms also fall within the protection scope of the present invention.
Claims
1. A method for increasing the size of black soldier flies based on gene editing, characterized in that: The method comprises treating black soldier flies torso The step of knocking out a gene, wherein the torso The nucleotide sequence of the gene is shown in SEQ ID No:
1.
2. The method for increasing the size of black soldier flies based on gene editing according to claim 1, characterized in that: Knockout of black soldier flies by CRISPR / Cas9 gene editing torso Gene.
3. The method for increasing the size of black soldier flies based on gene editing according to claim 2, characterized in that: The black soldier fly torso The target sequence of the gene is 5' AAATAGCGTAAAGCAAAAAACGG 3'.
4. The method for increasing the size of black soldier flies based on gene editing according to claim 2, characterized in that: The nucleotide sequence of the sgRNA used in the CRISPR / Cas9 gene editing method is shown in SEQ ID No:
7.
5. A method for breeding a large black soldier fly strain, characterized in that: The method comprises the following steps: Against black soldier flies torso The gene is knocked out to select black soldier fly mutants with enlarged body size, wherein the torso The nucleotide sequence of the gene is shown in SEQ ID No: 1; Screening for black soldier fly homozygotes.