Reagents, kits and detection devices for detecting Mycobacterium tuberculosis complex and rifampicin resistance

Abstract

The present application discloses a reagent for detecting rifampicin resistance, a kit for detecting Mycobacterium tuberculosis complex and rifampicin resistance, and a detection device for Mycobacterium tuberculosis complex and rifampicin resistance. The reagent for detecting rifampicin resistance includes multiple probes covering the rifampicin resistance determining region of the rpoB gene, including: a first probe, the sequence of which is shown in SEQ ID NO.1; a second probe, the sequence of which is shown in SEQ ID NO.2; a third probe, the sequence of which is shown in SEQ ID NO.3; a fourth probe, the sequence of which is shown in SEQ ID NO.4, the first probe and the second probe share a quenching group, and the third probe and the fourth probe share a quenching group. According to the present application, simple, multiple, highly specific and sensitive detection of rifampicin resistance can be achieved in a single tube.

Description

Technical Field

[0001] The present application relates to the field of gene detection technology, and in particular to a reagent, a kit and a detection device for detecting Mycobacterium tuberculosis complex and rifampicin resistance. Background Art

[0002] Tuberculosis is a chronic infectious disease caused by Mycobacterium tuberculosis, Mycobacterium bovis and Mycobacterium africanum. The treatment of tuberculosis includes long-term administration of multiple drugs. The correct use of anti-tuberculosis drugs usually has a significant effect on the treatment of tuberculosis. However, drug-resistant tuberculosis (DR-TB) is becoming more and more common, and the treatment success rate of DR-TB is only about 60%. Among them, rifampicin-resistant bacteria have been confirmed to be related to mutations in the gene encoding the RNA polymerase β subunit (rpoB), of which about 95% of mutations occur in the rifampicin resistance-determining region of codons 507-533 (81bp in total) on rpoB. Therefore, by detecting mutations in this region, drug resistance information can be given.

[0003] At present, the clinical detection methods for rifampicin resistance of Mycobacterium tuberculosis mainly include culture-based drug sensitivity detection and nucleic acid-based molecular biology detection. Traditional drug sensitivity detection methods are time-consuming and complicated to operate. First, it takes 4 to 8 weeks to identify Mycobacterium tuberculosis based on isolation and culture, and then it takes 1 to 2 weeks for liquid drug sensitivity detection or 4 to 8 weeks for traditional solid ratio detection. Nucleic acid-based molecular biology detection mainly includes PCR-reverse dot hybridization and melting curve. Among them, PCR-reverse dot hybridization requires hybridization, membrane washing and color development after normal PCR amplification, so the operation is complicated and the total detection time is also long. The melting curve method is simple to operate and has high detection sensitivity, but due to the variability and complexity of the rifampicin resistance determining region sequence, and the design of multiple probes for one region using the melting curve method for detection, there may be interference between the two consecutive probes due to the fluorescent group and / or quenching group, resulting in complex interference peaks and affecting the result judgment. In order to avoid interference between the two probes, the existing technology uses a two-tube reaction system to detect rifampicin resistance for rpoB gene mutations. Although this solves the problem of probe interference in a single-tube reaction, the two-tube reaction increases the complexity of the operation and the reagent cost of the detection, and reduces the detection throughput, which is not conducive to widespread application.

[0004] Therefore, how to achieve simple, multiplex, highly specific and sensitive detection of rifampicin resistance in a single tube remains the research focus and difficulty in this field. Summary of the invention

[0005] The purpose of the present application is to provide a reagent, a kit and a detection device for detecting Mycobacterium tuberculosis complex and rifampicin resistance.

[0006] In order to solve the above problems, this application adopts the following technical solutions:

[0007] The first aspect of the present application discloses a reagent for detecting rifampicin resistance, the reagent comprising a plurality of probes covering the rifampicin resistance determining region of the rpoB gene, comprising: a first probe, the sequence of which is shown in SEQ ID NO.1; a second probe, the sequence of which is shown in SEQ ID NO.2; a third probe, the sequence of which is shown in SEQ ID NO.3; a fourth probe, the sequence of which is shown in SEQ ID NO.4; wherein: the plurality of probes comprise a dual-labeled probe and a single-labeled probe; one end of the dual-labeled probe is labeled with a fluorescent group, and the other end is labeled with a quenching group; one end of the single-labeled probe is labeled with a fluorescent group, and the other end is not labeled with a fluorescent group or a quenching group; the probe types of the first probe, the second probe, the third probe and the fourth probe are respectively: dual-labeled probe, single-labeled probe, dual-labeled probe and single-labeled probe; or, dual-labeled probe, single-labeled probe, single-labeled probe and dual-labeled probe; or, single-labeled probe, dual-labeled probe, single-labeled probe and dual-labeled probe; and the first probe and the second probe share a quenching group, and the third probe and the fourth probe share a quenching group. It should be noted that the first probe, the second probe, the third probe and the fourth probe cover the 81bp rifampicin resistance determining region of the 507-533 codons (sequence information: NC_000962.3) on the rpoB gene of Mycobacterium tuberculosis, and can detect mutations in this region, and then detect sensitivity or resistance to rifampicin. In addition, by making two adjacent probes share a quenching group, when performing melting curve analysis, dense single nucleotide variation detection can be performed through the positive and negative peaks formed in a single tube test, and rifampicin-sensitive Mycobacterium tuberculosis can be diagnosed in a single tube, which has the advantages of simplicity, convenience and multiple detection.

[0008] In one implementation of the present application, the multiple probes covering the rifampicin resistance determining region of the rpoB gene also include: a fifth probe, the sequence of which is shown in SEQ ID NO.5; a sixth probe, the sequence of which is shown in SEQ ID NO.6; wherein the fifth probe and the first probe have the same group labeling, and the sixth probe and the second probe have the same group labeling. It should be noted that the fifth probe and the sixth probe can detect common deletion mutations in the rpoB rifampicin resistance determining region, thereby further improving the detection rate of rifampicin resistance.

[0009] In one implementation of the present application, in the first probe, the second probe, the third probe, and the fourth probe, the fluorescent groups of the dual-labeled probes are different from each other, and the fluorescent groups of the single-labeled probes are different from each other. Thus, different positive peaks / negative peaks can be distinguished by different fluorescent signals, avoiding confusion between positive peaks / negative peaks.

[0010] In one implementation of the present application, the fluorescent group is selected from FAM, FITC, HEX, VIC, TET, JOE, ROX, CY3, CY5, CY5.5, CY7, ATTO 425 and SF670, and the quenching group is selected from BHQ1, BHQ2, BHQ3, MGB and DABCYL.

[0011] In one implementation of the present application, the reagent also includes a primer set for amplifying the rifampicin resistance determining region of the rpoB gene, including: a first upstream primer, the sequence of which is shown in SEQ ID NO.7; and a first downstream primer, the sequence of which is shown in SEQ ID NO.8.

[0012] The second aspect of the present application discloses a kit for detecting Mycobacterium tuberculosis complex and rifampicin resistance, comprising the reagents disclosed in the first aspect of the present application, and further comprising: a first primer probe set for specific detection of IS6110 and / or a second primer probe set for specific detection of IS1081. It should be noted that, thereby, whether the Mycobacterium tuberculosis complex and rifampicin-resistant bacteria are carried can be detected at the same time.

[0013] In one implementation of the present application, the first primer probe group includes: a second upstream primer, whose sequence is shown in SEQ ID NO.9; a second downstream primer, whose sequence is shown in SEQ ID NO.10; a seventh probe, whose sequence is shown in SEQ ID NO.11; the second primer probe group includes: a third upstream primer, whose sequence is shown in SEQ ID NO.12; a third downstream primer, whose sequence is shown in SEQ ID NO.13; and an eighth probe, whose sequence is shown in SEQID NO.14; wherein the seventh probe and the eighth probe are both dual-labeled probes.

[0014] The third aspect of the present application discloses a detection device for Mycobacterium tuberculosis complex and rifampicin resistance, characterized in that it comprises: an amplification module: using the kit of the second aspect of the present application to perform fluorescent quantitative PCR detection on the sample to be tested, and performing melting curve analysis; a judgment module: judging whether the sample to be tested contains Mycobacterium tuberculosis complex according to the CT value (Cycle Threshold, which refers to the number of cycles required for the PCR reaction to reach a preset threshold fluorescence signal intensity), and judging whether the sample to be tested contains rifampicin-resistant bacteria according to the Tm value (Melting Temperature, which refers to the temperature at which double-stranded DNA begins to melt into single-stranded DNA) of the melting curve.

[0015] In one implementation of the present application, in the PCR reaction system of the PCR amplification module, the molar ratio of the first upstream primer to the first downstream primer is 1:5. It should be noted that, during the amplification process, the polymerase has 5'-3' exonuclease activity, and the upstream and downstream primers are designed for asymmetric amplification, mainly amplifying the single strand targeted by the probe, which can help avoid the probe being hydrolyzed by the polymerase during the extension process. The present application found through experimental research that a stronger detection signal is obtained when the molar ratio of the first upstream primer to the first downstream primer is 1:5.

[0016] In one implementation of the present application, in the PCR reaction system of the PCR amplification module, the molar ratio of the second upstream primer or the second downstream primer to the seventh probe is 5: 1. It should be noted that the present application has found through experimental research that when the primer-probe concentration ratio for detecting IS6110 is 5: 1, it has a better and stronger detection signal and a smaller interference signal.

[0017] In one implementation of the present application, in the PCR reaction system of the PCR amplification module, the molar ratio of the third upstream primer or the third downstream primer to the eighth probe is 5: 1. It should be noted that the present application has found through experimental research that when the primer-probe concentration ratio for detecting IS1081 is 5: 1, it has a better and stronger detection signal and a smaller interference signal.

[0018] In one implementation of the present application, a PCR enhancer is used in the PCR amplification module, and the PCR enhancer includes betaine, dimethyl sulfoxide and 20000 polyethylene glycol. In the PCR reaction system, the concentration of betaine is 1M, the concentration of dimethyl sulfoxide is 2%, and the concentration of 20000 polyethylene glycol is 5%. It should be noted that the present application has found through experimental research that in the PCR reaction system, when the concentration of betaine is 1M, the concentration of dimethyl sulfoxide is 2%, and the concentration of 20000 polyethylene glycol is 5%, it has a good amplification effect. It should also be noted that in the present application, the concentration unit of betaine is mol / L, and the units of dimethyl sulfoxide and 20000 polyethylene glycol concentration are mass fractions, and the mass fraction of 1% represents a content of 1g / 100mL.

[0019] The beneficial effects of this application are:

[0020] In the present application, by making two adjacent probes share a quenching group, when performing melting curve analysis, dense single nucleotide variation detection can be performed through the positive peaks and negative peaks formed in a single tube detection, which has the advantages of simplicity, convenience and multiple detection; and the detection of sites covered by multiple probes does not affect each other, and multiple mutation sites can be accurately detected in a single tube. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 It is a schematic diagram of multiple probes covering the rifampicin resistance determining region of the rpoB gene involved in the present application.

[0022] Figure 2 This is a typical melting curve diagram of the rifampicin-sensitive type involved in this application.

[0023] Figure 3 It is the melting curve diagram and amplification curve diagram of different primer-probe ratios of IS6110 involved in this application.

[0024] Figure 4 It is the melting curve diagram and amplification curve diagram of different primer-probe ratios of IS1081 involved in this application.

[0025] Figure 5 It is a melting curve diagram and an amplification curve diagram of the rpoB gene involved in the present application with different front and rear primer ratios.

[0026] Figure 6 It is a graph showing the CT value results of the amplification curves of different PCR enhancer concentrations involved in the present application.

[0027] Figure 7 It is a graph showing the CT value results of the amplification curves for different PCR cycle numbers involved in this application.

[0028] Figure 8This is a graph showing the results of testing the national reference product of Mycobacterium tuberculosis involved in this application.

[0029] Fig. 9 This is a graph showing the results of testing the sensitive reference substance of the national reference substance resistant to rifampicin involved in this application.

[0030] Fig.10 This is a graph showing the results of testing the drug-resistant reference product of the national reference product for rifampicin resistance involved in this application.

[0031] Fig.11 This is a graph showing the results of testing the minimum detection amount reference substance of the national reference substance for rifampicin resistance involved in this application.

[0032] Fig.12 This is an analysis chart of the minimum detection limit of Mycobacterium tuberculosis and the minimum detection limit of rifampicin resistance involved in this application. DETAILED DESCRIPTION

[0033] The present invention is further described in detail below by specific embodiments in conjunction with the accompanying drawings. In the following embodiments, many detailed descriptions are intended to enable the present application to be better understood. However, those skilled in the art can effortlessly recognize that some of the features can be omitted in different situations, or can be replaced by other materials and methods. In some cases, some operations related to the present application are not shown or described in the specification, in order to avoid the core part of the present application being overwhelmed by too much description, and for those skilled in the art, it is not necessary to describe these related operations in detail, and they can fully understand the related operations according to the description in the specification and the general technical knowledge in the art.

[0034] In addition, the features, operations or characteristics described in the specification can be combined in any appropriate manner to form various implementations. At the same time, the steps or actions in the method description can also be interchanged or adjusted in a manner that is obvious to those skilled in the art. Therefore, the various sequences in the specification and the drawings are only for the purpose of clearly describing a certain embodiment and are not meant to be a required sequence, unless otherwise specified that a certain sequence must be followed.

[0035] The serial numbers assigned to the components in this article, such as "first", "second", etc., are only used to distinguish the objects described and do not have any order or technical meaning.

[0036] Tuberculosis is a chronic infectious disease caused by Mycobacterium tuberculosis, Mycobacterium bovis and Mycobacterium africanum. The treatment of tuberculosis includes long-term administration of multiple drugs. The correct use of anti-tuberculosis drugs usually has a significant effect on the treatment of tuberculosis. However, drug-resistant tuberculosis (DR-TB) is becoming more and more common, and one of the more common types is rifampicin-resistant DR-TB. Compared with other anti-tuberculosis drugs, the probability of single resistance to rifampicin is lower, but the detection of rifampicin resistance is also a marker for multidrug-resistant tuberculosis. It has been confirmed that rifampicin-resistant bacteria are associated with mutations in the gene encoding the RNA polymerase β subunit (rpoB), of which about 95% of the mutations occur in the rifampicin resistance-determining region (sequence number: NC_000962.3) of codons 507-533 (81bp in total) on rpoB. By detecting mutations in this region, drug resistance information can be given.

[0037] At present, the main clinical detection methods for rifampicin resistance of Mycobacterium tuberculosis are culture-based drug sensitivity detection and nucleic acid-based molecular biology detection. Traditional drug sensitivity detection methods are time-consuming and complicated to operate. First, it takes 4-8 weeks to identify Mycobacterium tuberculosis based on isolation and culture, and then it takes 1-2 weeks for liquid drug sensitivity detection or 4-8 weeks for traditional solid ratio detection. Nucleic acid-based molecular biology detection mainly includes PCR-reverse dot hybridization and melting curve. Among them, PCR-reverse dot hybridization requires hybridization, membrane washing and color development after normal PCR amplification, so the operation is complicated and the total detection time is also long. The melting curve method is simple to operate and has high detection sensitivity. However, due to the variability and complexity of the sequence of the rifampicin resistance determining region, for the dense single nucleotide variation region (multiple single nucleotide variation sites are concentrated in a short DNA sequence, that is, dense single nucleotide variation), multiple probes are designed and detected by the melting curve method. There may be interference between the fluorescent group and / or quenching group between the two consecutive probes, resulting in complex interference peaks and affecting the result judgment. In order to avoid interference between the two probes, the prior art uses a two-tube reaction system to detect rpoB gene mutations for rifampicin resistance, which increases the complexity of the operation and the cost of the test. In addition, the prior art detects Mycobacterium tuberculosis as a single target, IS6110. Although there are many copies of IS6110, there may be a situation where IS6110 is missing, which can easily cause missed detection and is not conducive to widespread application. Therefore, how to achieve simple, multiple, accurate, highly specific and sensitive detection of Mycobacterium tuberculosis complex and rifampicin resistance in a single tube is still a research focus and difficulty in this field.

[0038] In view of this, the present application creatively provides a reagent for detecting rifampicin resistance, a kit for detecting Mycobacterium tuberculosis complex and rifampicin resistance, and a device for detecting Mycobacterium tuberculosis complex and rifampicin resistance.

[0039] This application has the following main advantages:

[0040] (1) This application is aimed at detecting dense single nucleotide variant sites. The covering probes involved are detected by sharing a quenching group and based on the PCR melting curve analysis method. The positive and negative peaks formed in a single tube can be used for mutation detection without interfering with each other. It has the advantages of simplicity, convenience and multiple detection. This application is designed for rifampicin resistance probes. Multiple probes share a quenching group to form positive and negative peaks. The design of positive and negative peaks can increase the detection throughput of each channel. The 64 known rifampicin resistance mutations of rifampicin resistance genes can be realized on a conventional four-color fluorescence PCR instrument. At the same time, unreported or newly occurring mutations within the coverage range of the probe also have a prompting effect. The design of positive and negative peaks has low requirements for the equipment used. At the same time, the single-labeled probe has low requirements for the probe synthesis process and low cost.

[0041] (2) This application is aimed at the detection of rifampicin resistance genes. Some mutations can cause the Tm values ​​of the melting peaks of multiple channels to become lower. The multi-channel double insurance detection of mutation sites has better accuracy and specificity.

[0042] (3) The design of the probe of the present application introduces partial base mutations and locked nucleic acid modifications, which greatly changes the Tm value of the mutation site and better distinguishes the wild type and mutant type; in addition, the locked nucleic acid has a stronger recognition of mismatched bases during complementary pairing, which can greatly improve the specificity and accuracy of detecting mutation sites.

[0043] (4) This application is aimed at the detection of Mycobacterium tuberculosis complex, and the targets include two conserved sequences, IS6110 and IS1081. Dual target detection not only improves the sensitivity of detection, but also avoids missed detection due to the absence of the single target IS6110.

[0044] (5) This application improves the accuracy and sensitivity of detection by adding an appropriate amount of PCR enhancer, adjusting the number of amplification cycles, adjusting the reaction system, etc. Among them, the addition of enhancers can significantly improve the amplification efficiency of multiple targets in the reaction system, thereby improving the sensitivity of detecting Mycobacterium tuberculosis. The detection method of this application can stably detect 1 bacterium / mL.

[0045] The present application relates to a reagent for detecting rifampicin resistance, a kit for detecting Mycobacterium tuberculosis complex and rifampicin resistance (hereinafter sometimes referred to as "kit"), and a device for detecting Mycobacterium tuberculosis complex and rifampicin resistance (hereinafter sometimes referred to as "detection device").

[0046] The specific implementation of the present application is further described below in conjunction with the accompanying drawings. In a specific embodiment, the reagent for detecting rifampicin resistance includes a plurality of probes covering the rifampicin resistance determining region of the rpoB gene.

[0047] Figure 1 Schematic diagram of multiple probes covering the rifampicin resistance determining region of the rpoB gene involved in the present application. Figure 1 As shown, in a specific embodiment, the reagent for detecting rifampicin resistance includes a first probe, a second probe, a third probe and a fourth probe. It should be noted that the first probe, the second probe, the third probe and the fourth probe can detect mutations in rpoB gene codons 510-533 (sequence information: NC_000962.3).

[0048] In a specific embodiment, the plurality of probes include dual-labeled probes and single-labeled probes. It should be noted that a dual-labeled probe refers to a probe having one end labeled with a fluorescent group and the other end labeled with a quenching group; a single-labeled probe refers to a probe having only one end labeled with a fluorescent group and the other end not labeled with a fluorescent group or a quenching group.

[0049] In a specific embodiment, the dual-labeled probe and the single-labeled probe can form a group and share a quencher group. It should be noted that sharing a quencher group means that the quencher group of the dual-labeled probe and the fluorescent group of the single-labeled probe are close to each other.

[0050] In a specific embodiment, the interval between two probes in the same group is 1 bp to 4 bp. That is, in the same group, the interval between the 3' end of the previous probe and the 5' end of the next probe is 1 bp, 2 bp, 3 bp or 4 bp. bp refers to a base pair (BasePair), which is used to describe the length of a nucleic acid, and an interval of 1 bp refers to an interval of 1 base. It should be noted that if the interval between two probes in the same group is too close, in this case, due to the large molecular weight of the fluorescent group and the quenching group, if a certain spacing distance is not reserved in space, it may cause the probe itself and the base connected to the fluorescent group or the quenching group to be unable to complementarily pair with the target, which will reduce the annealing temperature of the wild type and the mutant type, affecting the accuracy of the results; if the interval between two probes in the same group is too far, it may cause the fluorescent group and the quenching group to be unable to bind to each other, which will make the two probes in the same group unable to share the quenching group.

[0051] In a specific embodiment, if the number of bases between the same group of probes is less than or equal to 2bp (interval is 0bp, 1bp or 2bp), the positions where the fluorescent groups and / or quenching groups that are close to each other are connected can also be added with a few base "tails" that are not complementary to the target sequence, so that the fluorescent groups and / or quenching groups that are close to each other in the same group of probes can "float", so that the fluorescent groups and quenching groups that are close to each other have enough space, avoiding the steric hindrance of the nearby complementary paired bases being unable to pair and combine due to the fluorescent groups or quenching groups occupying the space, thereby affecting the annealing temperature of the probe and causing unstable results.

[0052] In a specific embodiment, the base "tail" that is added to the position connected to the fluorescent group or the quenching group and is not complementary to the target sequence can be specifically selected from the following bases: A, T, C and G.

[0053] In a specific embodiment, the number of bases in the base "tail" can be 2 to 10 bp. It should be noted that if the number of bases in the base "tail" is too small, the fluorescent group and the quenching group that are close to each other may not have enough space; if the number of bases in the base "tail" is too large, the distance between the fluorescent group and the quenching group may be too far, which may cause the fluorescent group and the quenching group between two probes in the same group to be unable to bind to each other.

[0054] The specific labeling conditions of the groups of the first probe, the second probe, the third probe, and the fourth probe are described in detail below. Figure 1 , the first probe, the second probe, the third probe and the fourth probe have the following forms:

[0055] ① The first probe is a dual-labeled probe, the second probe is a single-labeled probe, the third probe is a dual-labeled probe, and the fourth probe is a single-labeled probe (i.e., dual, single, dual, single in sequence); wherein the first probe has a fluorescent group at the 5' end and a quenching group at the 3' end, the second probe has a fluorescent group at the 5' end, and the second probe and the first probe share a quenching group; the third probe has a fluorescent group at the 5' end and a quenching group at the 3' end, the fourth probe has a fluorescent group at the 5' end, and the third probe and the fourth probe share a quenching group;

[0056] ② The first probe is a dual-labeled probe, the second probe is a single-labeled probe, the third probe is a single-labeled probe, and the fourth probe is a dual-labeled probe (i.e., dual, single, single, dual in sequence); wherein the first probe has a fluorescent group at the 5' end and a quenching group at the 3' end, the second probe has a fluorescent group at the 5' end, and the second probe and the first probe share a quenching group; the third probe has a fluorescent group at the 3' end, the fourth probe has a quenching group at the 5' end and a fluorescent group at the 3' end, and the third probe and the fourth probe share a quenching group;

[0057] ③ The first probe is a single-labeled probe, the second probe is a dual-labeled probe, the third probe is a single-labeled probe, and the fourth probe is a dual-labeled probe (that is, in order: single, dual, single, dual); the first probe has a fluorescent group at the 3' end, the second probe has a quenching group at the 5' end, a fluorescent group at the 3' end, and the second probe and the first probe share a quenching group; the third probe has a fluorescent group at the 3' end, the fourth probe has a quenching group at the 5' end, a fluorescent group at the 3' end, and the third probe and the fourth probe share a quenching group.

[0058] In the case where the first probe, the second probe, the third probe and the fourth probe are covered, since the second probe and the first probe share a quenching group, and the third probe and the fourth probe share a quenching group, when performing melting curve analysis:

[0059] If it is the first form, then: when the melting temperature (Tm) reaches the annealing temperature of the first probe (dual-labeled probe), the dual-labeled probe dissociates from the complementary target, the probe is in a natural curling state, the fluorescence decreases sharply, and the melting curve shows a positive peak; at the same time, the 5'-end fluorescent group of the second probe (single-labeled probe) separates from the quenching group of the first probe, the fluorescence of the single-labeled probe rises sharply, and the melting curve shows a negative peak; if the melting temperature (Tm) reaches the annealing temperature of the second probe (single-labeled probe), the single-labeled probe dissociates from the complementary target, the 5'-end fluorescent group of the single-labeled probe separates from the quenching group of the first probe, the fluorescence of the single-labeled probe rises sharply, and the melting curve shows a negative peak. The same is true for the third and fourth probes. Finally, the first form has positive, negative, positive, and negative peaks in sequence.

[0060] If it is the third form, then: when the melting temperature (Tm) reaches the annealing temperature of the first probe (single-labeled probe), the fluorescent group at the 3' end of the single-labeled probe separates from the quenching group of the second probe (double-labeled probe), the fluorescence of the single-labeled probe rises sharply, and the melting curve shows a negative peak; if the melting temperature (Tm) reaches the annealing temperature of the second probe (double-labeled probe), the double-labeled probe dissociates from the complementary target, the probe is in a natural curling state, the fluorescence drops sharply, and the melting curve shows a positive peak; at the same time, the fluorescent group at the 5' end of the first probe separates from the quenching group at the second position, the fluorescence of the single-labeled probe rises sharply, and the melting curve shows a negative peak. The same is true for the third and fourth probes. Finally, the third form has negative, positive, negative, and positive peaks in sequence.

[0061] If it is the second form, then: the situation of the first probe and the second probe is the same as the first probe and the second probe in the first form, and the situation of the third probe and the fourth probe is the same as the first probe and the second probe in the third form. Finally, the second form has positive, negative, negative, and positive peaks in sequence.

[0062] In addition, among the two probes (the same group of probes) that share a quenching group, if there is a mutation in the sequence targeted by the dual-labeled probe: the dual-labeled probe will form a positive mutation peak, and at the same time, the single-labeled probe will also form a negative melting peak, and the Tm value of the negative melting peak is almost the same as the Tm value of the positive mutation peak; at this time, if the Tm value is less than or equal to the Tm value of the sensitive peak of the single-labeled probe, the positive peak and negative peak in the same group of probes can be used as a double insurance to determine whether the sequence detected by the dual-labeled probe has a drug-resistant mutation, so that the detection has better accuracy and specificity; if the Tm value is greater than the Tm value of the sensitive peak of the single-labeled probe, then in the process of gradually increasing the temperature, when the Tm of the single-labeled probe is reached, the single-labeled probe will fall off first to form a negative sensitive peak, and the temperature will then increase to the mutation annealing temperature of the dual-labeled probe to form a positive mutation peak, and at this time the Tm value of the negative melting peak is inconsistent with the Tm value of the positive mutation peak.

[0063] In a specific embodiment, the reagent for detecting rifampicin resistance also includes a fifth probe and a sixth probe for detecting deletion mutations in the rifampicin resistance determining region of the rpoB gene. Among them, the target positions of the first probe and the fifth probe overlap, and the target positions of the second probe and the sixth probe overlap. It should be noted that due to the overlap of the target positions, the first probe and the fifth probe will not target the target area at the same time, that is, at most only one of the two probes will bind to the target area (for example, when the target position is missing, the fifth probe will bind to the target position, and the first probe will not bind to the target position), therefore, the two probes will not interfere with each other; the second probe and the sixth probe are the same and will not interfere with each other.

[0064] It should also be noted that the fifth probe needs to be labeled with the same group as the first probe, and the sixth probe needs to be labeled with the same group as the second probe. For example, the first probe is a dual-labeled probe and has a fluorescent group at its 5' end and a quenching group at its 3' end, then the fifth probe is also a dual-labeled probe and has a fluorescent group at its 5' end and a quenching group at its 3' end. It should also be noted that the types of specific fluorescent groups or quenching groups between the fifth probe and the first probe, or between the sixth probe and the second probe, may be the same or different. For example, if the fluorescent group at the 5' end of the first probe is ROX, then the fluorescent group at the 5' end of the fifth probe may be ROX or other fluorescent groups.

[0065] It should be noted that the detection object of the reagent for detecting rifampicin resistance is the site of the rifampicin resistance determining region of the rpoB gene (sequence number: NC_000962.3), wherein the first probe detects mutations in codons 511-513 (the mutation sites detected include: rpoB c.510CAG>CAC, rpoBc.511CTG>CCG, rpoB c.511CTG>CTC, rpoBrpoBc.511CTG>CGG, c.511CTG>TTG, rpoB c.512AGC>TGC, rpoB c.513CAA>AAA, rpoBc.513CAA>CCA, rpoB c.513CAA>CAC, rpoB c.513CAA>TTA, rpoB c.513CAA>CTA, rpoBc.513CAA>CGA), and the second probe detected mutations in codons 515-518 (the mutation sites detected included: rpoBc.515ATG>ATT, rpoB c.516GAC>CAC, rpoB c.516GAC>TAC, rpoB c.516GAC>GGC, rpoBc.516GAC>GTC, rpoB c.516GAC>GCC, rpoB c.516GAC>TTC, rpoB c.516GAC>AAA, rpoBc.516GAC>AAC, rpoB c.516GAC>ACC, rpoB c.516GAC>CCC, rpoB c.516GAC>CAA, rpoBc.518AAC>CAC, rpoB c.518AAC>GAC), and the third probe detected mutations in codons 522-526 (the mutation sites detected included: rpoB c.522TCG>GCG, rpoBc.522TCG>CAG, rpoB c.522TCG>TTG, rpoBc.523GGG>GGC, rpoB c.524TTG>CTC, rpoBc.526CAC>AAC, rpoB c.526CAC>GAC, rpoBc.526CAC>TAC, rpoB c.526CAC>CCC, rpoBc.526CAC>CGC, rpoB c.526CAC>CTC, rpoBc.526CAC>AGC, rpoB c.526CAC>GGC, rpoB c.526CAC>GTC, rpoB c.526CAC>TGC, rpoBc.526CAC>CAG, rpoB c.526CAC>CAA, rpoBc.526CAC>TTC, rpoB c.526CAC>CTT, rpoBc.526CAC>GCC, rpoB c.526CAC>ACC, rpoBc.The fourth probe detects mutations in codons 529-533 (the mutation sites detected include: rpoB c.529CGA>CGG, rpoB c.530CTG>ATG, rpoB c.530CTG>CTT, rpoB c.531TCG>TGG, rpoB c.531TCG>TTG, rpoB c.531TCG>TAC, rpoB c.531TCG>TAT, rpoB c.531TCG>TTC, rpoB c.531TCG>ACG, rpoB c.531TCG>TGT, rpoB c.531TCG>TTT, rpoB c.531TCG>CAG, rpoB c.533CTG>CCG, rpoB c.533CTG>TTG). The fifth probe detects the deletion of codons 511-512 (the mutation sites detected include: rpoB del510, rpoB del511, rpoB del512), and the sixth probe detects the deletion of codons 517-518 (the mutation sites detected include: rpoBdel517, rpoB del518).

[0066] In a specific embodiment, the reagent for detecting rifampicin resistance includes the first probe, the second probe, the third probe, the fourth probe, the fifth probe and the sixth probe, thereby being able to detect mutations and common deletions in the rpoB rifampicin resistance determining region.

[0067] In a specific embodiment, the first probe sequence is shown as SEQ ID NO.1; the second probe sequence is shown as SEQ ID NO.2; the third probe sequence is shown as SEQ ID NO.3; and the fourth probe sequence is shown as SEQ ID NO.4.

[0068] In a specific embodiment, the fifth probe sequence is shown as SEQ ID NO. 5; the sixth probe sequence is shown as SEQ ID NO. 6. It should be noted that the fifth probe and the sixth probe detect the deletion of the site of the rifampicin resistance determining region of rpoB, thereby being able to detect the deletion of the rpoB gene and further improve the detection rate of rifampicin resistance.

[0069] In a specific embodiment, the fluorescent group of the above-mentioned probe can be selected from but not limited to FAM, FITC, HEX, VIC, TET, JOE, ROX, CY3, CY5, CY5.5, CY7, ATTO 425 and SF670.

[0070] In a specific embodiment, the quencher group of the above probe can be selected from but not limited to BHQ1, BHQ2, BHQ3, MGB and DABCYL.

[0071] In a specific embodiment, the fluorescent groups of the double-labeled probes in the first probe, the second probe, the third probe and the fourth probe are different from each other, so that different positive peaks can be distinguished by different fluorescent signals to avoid confusion between positive peaks.

[0072] In a specific embodiment, the fluorescent groups of the single-labeled probes in the first probe, the second probe, the third probe and the fourth probe are different from each other, so that different negative peaks can be distinguished by different fluorescent signals to avoid confusion between negative peaks.

[0073] In a specific embodiment, the fluorescent groups of each probe in the first probe, the second probe, the third probe and the fourth probe are different from each other. In this case, all peaks can be distinguished according to different fluorescent signals to avoid confusion.

[0074] In a specific embodiment, the 5' end of the first probe is labeled with FAM and the 3' end is labeled with BHQ1; the 5' end of the second probe is labeled with VIC and the 3' end has no quenching group; the 5' end of the third probe is not labeled and the 3' end is labeled with ROX; the 5' end of the fourth probe is labeled with BHQ2 and the 3' end is labeled with CY5; the 5' end of the fifth probe is labeled with FAM and the 3' end is labeled with BHQ1; the 5' end of the sixth probe is labeled with VIC and the 3' end has no quenching group.

[0075] In a specific embodiment, the first probe, the second probe, the third probe and the fourth probe are reacted in one PCR reaction system, that is, the first probe, the second probe, the third probe and the fourth probe are reacted in the same PCR amplification tube, without the need for multiple tubes.

[0076] In a specific embodiment, the first probe, the second probe, the third probe, the fourth probe, the fifth probe and the sixth probe are reacted in a PCR reaction system, that is, the first probe, the second probe, the third probe, the fourth probe, the fifth probe and the sixth probe are reacted in the same PCR amplification tube, without the need to react in multiple tubes.

[0077] In a specific embodiment, a single-labeled probe among the plurality of probes may have a blocking modification, thereby preventing the extension and amplification of the probe.

[0078] In a specific embodiment, the blocking modification may include at least one of phosphorylation modification (PHO), amino modification and Spacer C3 modification.

[0079] In a specific embodiment, at least one of the multiple probes may be modified with a locked nucleic acid (LNA). Thus, the annealing temperature of the probe can be increased. It should also be noted that the locked nucleic acid has a stronger recognition of mismatched bases during complementary pairing, which can greatly improve the specificity and accuracy of detecting mutation sites. The probe has one or more base mutations relative to the sensitive type to make it easier to distinguish drug resistance.

[0080] In a specific embodiment, at least one of the multiple probes may contain one or more base mutations relative to the wild-type probe, thereby increasing the difference in annealing temperature between the targeted wild-type nucleic acid and the targeted mutant nucleic acid, thereby increasing the specificity of the probe.

[0081] In a specific embodiment, the plurality of probes have different melting point (Tm) values ​​when hybridizing with the wild-type nucleic acid and the mutant nucleic acid, thereby being able to determine whether a mutation exists in the target region based on the Tm value.

[0082] In a specific embodiment, when performing melting curve analysis, the dual-labeled probe channel selects the positive peak, and the single-labeled probe channel selects the negative peak.

[0083] In a specific embodiment, when performing melting curve analysis, the melting peak Tm value judgment rule is: when the melting peak Tm value detected in any channel among all channels is less than the wild-type melting peak Tm value range of the corresponding channel, it is determined that the sequence targeted by the probe has mutated.

[0084] In a specific embodiment, the temperature range of the rifampicin-sensitive type is: the channel of the first probe or the fifth probe is 58.00~62.25℃, the channel of the second probe or the sixth probe is 55.01~59.57℃, the channel of the third probe is 61.12~64.42℃, and the channel of the fourth probe is 62.05~65.48℃.

[0085] In a specific embodiment, the reagent for detecting rifampicin resistance also includes a primer set for amplifying the rifampicin resistance determining region of the rpoB gene, including: a first upstream primer, the sequence of which is shown in SEQ ID NO. 7; a first downstream primer, the sequence of which is shown in SEQ ID NO. 8. It should be noted that the primer set can amplify both the wild-type target region and the mutant target region.

[0086] In a specific embodiment, when used, the first downstream primer is in excess relative to the first upstream primer. It should be noted that during the amplification process, the polymerase has 5'-3' exonuclease activity, and the upstream and downstream primers are designed for asymmetric amplification, mainly amplifying the single strand targeted by the probe, which can help avoid the probe being hydrolyzed by the polymerase during the extension process.

[0087] In a specific embodiment, the molar ratio of the first upstream primer to the first downstream primer is 1:4 to 1:30. Preferably, the molar ratio of the first upstream primer to the first downstream primer is 1:5.

[0088] In a specific embodiment, a kit for detecting Mycobacterium tuberculosis complex and rifampicin resistance is provided, and the kit includes the aforementioned reagent for detecting rifampicin resistance.

[0089] In a specific embodiment, the kit may further include: a first primer probe set for specific detection of IS6110 and / or a second primer probe set for specific detection of IS1081.

[0090] In a specific embodiment, the first primer probe set includes: a second upstream primer, whose sequence is shown in SEQ ID NO.9; a second downstream primer, whose sequence is shown in SEQ ID NO.10; and a seventh probe, whose sequence is shown in SEQ ID NO.11.

[0091] In a specific embodiment, the second primer probe set includes: a third upstream primer, the sequence of which is shown in SEQ ID NO. 12; a third downstream primer, the sequence of which is shown in SEQ ID NO. 13; and an eighth probe, the sequence of which is shown in SEQ ID NO. 14. It should be noted that both the seventh probe and the eighth probe are dual-labeled probes, and the fluorescent group of the seventh probe or the eighth probe is different from the fluorescent group of the dual-labeled probe in the first probe to the sixth probe, and the fluorescent group of the seventh probe or the eighth probe can be the same as or different from the fluorescent group of the single-labeled probe in the first probe to the sixth probe.

[0092] In a specific embodiment, the fluorescent groups of the seventh probe and the eighth probe may be the same. Thus, the Mycobacterium tuberculosis complex can be detected simultaneously through a single channel and dual targets, thereby improving the sensitivity of Mycobacterium tuberculosis complex detection and reducing the missed detection rate.

[0093] In a specific embodiment, the kit may further include: a third primer probe set for specifically detecting the internal reference gene β-actin.

[0094] In a specific embodiment, the third primer probe set includes: a third upstream primer, the sequence of which is shown in SEQ ID NO. 15; a third downstream primer, the sequence of which is shown in SEQ ID NO. 16; and a ninth probe, the sequence of which is shown in SEQ ID NO. 17. It should be noted that the ninth probe is a dual-labeled probe, and the fluorescent group of the ninth probe is different from the fluorescent group of the dual-labeled probe in the first to sixth probes, and the fluorescent group of the ninth probe can be the same as or different from the fluorescent group of the single-labeled probe in the first to sixth probes.

[0095] In a specific embodiment, the fluorescent group of the probe involved in this specific embodiment can be selected from but not limited to FAM, FITC, HEX, VIC, TET, JOE, ROX, CY3, CY5, CY5.5, CY7, ATTO 425 and SF670.

[0096] In a specific embodiment, the quenching group of the probe involved in this specific embodiment can be selected from but not limited to BHQ1, BHQ2, BHQ3, MGB and DABCYL.

[0097] In a specific embodiment, the kit may also include reagents required for PCR amplification and / or melting curve analysis, including buffer, DNA polymerase, UNG enzyme, dNTPs, PCR reaction enhancer and Mg. 2+ At least one of .

[0098] In a specific embodiment, the PCR reaction enhancer can be one or more of dimethyl sulfoxide, formamide, bovine serum albumin, 20,000 polyethylene glycol, betaine and ammonium sulfate. It should be noted that the PCR reaction enhancer can improve the efficiency of PCR amplification of high GC targets in the rifampicin resistance-determining region of Mycobacterium tuberculosis, and can also increase the interaction between the components in the reaction system, thereby promoting amplification efficiency and melting effect. It should also be noted that 20,000 polyethylene glycol (PEG 20,000) is a high molecular weight polyethylene glycol (PEG) compound with an average molecular weight of approximately 20,000 Daltons.

[0099] In a specific embodiment, the kit may further include a nucleic acid extraction reagent for extracting nucleic acid from a sample.

[0100] In a specific embodiment, the kit may further include negative controls and positive controls, including negative controls and positive controls for Mycobacterium tuberculosis complex, and negative controls and positive controls for rifampicin-resistant bacteria.

[0101] In a specific embodiment, a device for detecting Mycobacterium tuberculosis complex and rifampicin resistance is provided.

[0102] In a specific embodiment, the detection device includes an amplification module and a judgment module.

[0103] In a specific embodiment, the amplification module includes: using the aforementioned kit to perform fluorescent quantitative PCR detection on the sample to be tested, and performing melting curve analysis.

[0104] In a specific embodiment, the judgment module includes: judging whether the sample to be tested contains Mycobacterium tuberculosis complex according to the CT value, and judging whether the sample to be tested contains rifampicin-resistant bacteria according to the Tm value of the melting curve.

[0105] In a specific embodiment, the sample to be tested may come from human body, animal, plant and microorganism.

[0106] In a specific embodiment, in the PCR reaction system of the amplification module, the molar ratio of the first upstream primer to the first downstream primer is 1:5 to 1:20. Preferably, in the PCR reaction system of the amplification module, the molar ratio of the first upstream primer to the first downstream primer is 1:5.

[0107] In a specific embodiment, in the reaction system of the amplification module: the molar ratio of the second upstream primer or the second downstream primer to the seventh probe is 5:1 to 6:1. Preferably, in the reaction system of the amplification module: the molar ratio of the second upstream primer or the second downstream primer to the seventh probe is 5:1.

[0108] In a specific embodiment, in the PCR reaction system of the amplification module, the molar ratio of the third upstream primer or the third downstream primer to the eighth probe is 5: 1 to 6: 1. Preferably, in the reaction system of the amplification module: the molar ratio of the third upstream primer or the third downstream primer to the eighth probe is 5: 1.

[0109] In one embodiment, a PCR enhancer is used in the amplification module.

[0110] In a specific embodiment, in the amplification module, the number of PCR amplification cycles is 45 to 55 cycles. Preferably, the number of PCR amplification cycles is 50 cycles.

[0111] In one specific embodiment, the PCR enhancer includes betaine, dimethyl sulfoxide and 20,000 polyethylene glycol.

[0112] In a specific embodiment, in the PCR reaction system, the concentration of betaine is 0.5M~2M, the concentration of dimethyl sulfoxide is 2%~3%, and the concentration of 20000 polyethylene glycol is 5%~6%. Preferably, in the PCR reaction system, the concentration of betaine is 1M, the concentration of dimethyl sulfoxide is 2%, and the concentration of 20000 polyethylene glycol is 5%. It should be noted that in this application, the concentration unit of betaine is mol / L, and the units of dimethyl sulfoxide and 20000 polyethylene glycol concentration are mass fractions, and a mass fraction of 1% represents a content of 1g / 100mL.

[0113] In a specific embodiment, the judgment module further comprises judging whether the sample to be tested contains Mycobacterium tuberculosis complex according to the CT value of the amplification curve.

[0114] In a specific embodiment, in the judgment module, if the CT value of the probe channel of the ninth probe (the probe for detecting the internal reference gene β-actin) is less than 50, and the CT value of the probe channel of the seventh probe or the eighth probe is ≤44.49, it is judged as Mycobacterium tuberculosis complex group positive; if the CT value of the probe channel of the ninth probe (the probe for detecting the internal reference gene β-actin) is less than 50, and the probe channel of the seventh probe or the eighth probe has no CT value or the amplification curve has no obvious logarithmic growth period, it is judged as Mycobacterium tuberculosis complex group negative.

[0115] In a specific embodiment, in the judgment module, on the premise that the Mycobacterium tuberculosis complex detection result is positive, the rifampicin resistance mutation detection result is interpreted, and whether the sample is mutated is determined by analyzing the melting peak Tm value of the sample to be tested.

[0116] The interpretation rules for rifampicin resistance testing are as follows:

[0117] Rifampicin sensitive: When the effective melting peak Tm values ​​in the channels of all probes detecting the rpoB gene rifampicin resistance-determining region in the sample to be tested are within the melting peak Tm value range of the sensitive type, the result is reported as rifampicin sensitive;

[0118] Rifampicin resistance: When the effective melting peak Tm value in any channel of all probes detecting the rpoB gene rifampicin resistance-determining region in the sample to be tested is less than the minimum Tm value of the corresponding channel sensitivity type, the result is reported as rifampicin resistance;

[0119] Rifampicin resistance is unclear: If one or more channels of the sample to be tested have no valid melting peak, the result will be reported as rifampicin resistance is unclear.

[0120] In a specific embodiment, the positive judgment value of rifampicin resistance: the Tm value range in each channel is shown in the following table:

[0121] aisle Sensitive test results (℃) Drug resistance test results (℃) The first or fifth probe channel 58.00~62.25 Tm value<58.00 The second or sixth probe channel 55.01~59.57 Tm value<55.01 The third probe channel 61.12~64.42 Tm value<61.12 The fourth probe channel 62.05~65.48 Tm value<62.05

[0122] The present application is further described in detail below by specific examples. The following examples are only further described for the present application and should not be construed as limiting the present application. It should be noted that the reagents, test kits, instruments, etc. used in the examples are all commercially available, and the operating steps are carried out according to the instructions or the general operating steps in the art.

[0123] Embodiment 1:

[0124] 1. Primer and probe design:

[0125] In this embodiment, upstream primers, downstream primers and probes for amplification are designed based on the IS6110 sequence and IS1081 sequence of Mycobacterium tuberculosis (sequence number: NC_000962.3); at the same time, 6 specific probes are designed based on the site of the rifampicin resistance determining region of the rpoB gene (sequence number: NC_000962.3), of which 4 probes cover the 81bp resistance determining region and detect mutations in codons 510-533, and the other 2 probes detect deletions. The specific sequences of each primer and probe are shown in the following table:

[0126] name Serial number Modification / marking type Sequence (5'-3') Upstream primer IS6110-F SEQ ID NO.9 / atgaccaaactcggcctgtcc Downstream primer IS6110-R SEQ ID NO.10 / ccctgcccaggtcgacacata IS6110 Probe SEQ ID NO.11 5'ROX-3'BHQ2 tcccgccgatctcgtccagc Upstream primer IS1081-F SEQ ID NO.12 / caatctgatggcagccaccc Downstream primer IS1081-R SEQ ID NO.13 / ccagatctgcttggggaaggc IS1081 Probe SEQ ID NO.14 5'ROX-3'BHQ2 accctgctgcactccatctacgac Upstream primer β-actin-F SEQ ID NO.15 / cttccccagtgtgacatggtgta Downstream primer β-actin-R SEQ ID NO.16 / catacccctcgtagatgggcac β-actin probe SEQ ID NO.17 5'VIC-3'BHQ1 ccatgtacgttgctatccaggctgt Upstream primer rpoB-F SEQ ID NO.7 / ggcgatcacaccgcagacgt Downstream primer rpoB-R SEQ ID NO.8 / gtttcgatcgggcacatcc 511-513 mutation probe SEQ ID NO.1 5'FAM-3'BHQ1 caccagccagctgagccaatt 511-512 deletion probe SEQ ID NO.5 5'FAM-3'BHQ1 tcttcgAcaccagccagcaatt 515-518 mutation probe SEQ ID NO.2 5'VIC-3'PHO AAatggaccagaacaacccgct 517-518 deletion probe SEQ ID NO.6 5'VIC-3'PHO atggacaacccgctTtcgTg 522-526 mutation probe SEQ ID NO.3 -3'ROX, LNA tAtcggggttga+cAcacaagc 529-533 mutation probe SEQ ID NO.4 5'BHQ2-3'CY5, LNA AAcAgactgtcggc+gctggggAc

[0127] Note: The bases in capital letters indicate that the base is mismatched with the target sequence, and the base after the “+” has a locked nucleic acid modification (LNA).

[0128] 2. Detection

[0129] The detection of Mycobacterium tuberculosis complex and rifampicin resistance using the above primer probes comprises the following steps:

[0130] (1) Extraction of template DNA: Use Yaneng Biotechnology Nucleic Acid Extraction Reagent (Model: MTP8A, Guangdong Shenzhen Machinery No. 20240420) to extract sputum samples: place >1 mL of sputum sample at room temperature, and then add 2 times the volume of MTB liquefaction agent to the sputum sample; cover the container tightly, shake vigorously 20 times or vortex oscillate for 20 seconds, and incubate the sample at room temperature for 10 minutes; shake vigorously 20 times or vortex oscillate for 20 seconds again, and incubate the sample at room temperature for 5 minutes; after complete liquefaction, use nucleic acid extraction reagent to extract nucleic acid according to the instructions, and the extracted nucleic acid is used as template DNA.

[0131] (2) Prepare PCR amplification reaction solution: In a single 200 μL PCR tube, add 0.5 μL of 5U / μL DNA polymerase, 0.1 μL of 1U / μL UNG enzyme, 2.5 μL of 10× PCR reaction buffer (manufacturer: TAKARA, catalog number: 9151A), 5 uL of PCR reaction enhancer (containing 5 M betaine (manufacturer: Sigma, catalog number: B0300), 10% dimethyl sulfoxide (manufacturer: Sigma, catalog number: 41640) and 25% 20,000 polyethylene glycol (manufacturer: Sigma, catalog number: 95172)), 0.2 μL of 25 mM dN(U)TP, and 100 mM dUTP. 0.1 μL, 10 μM primer probe set (upstream primer IS6110-F, downstream primer IS6110-R, upstream primer IS1081-F, downstream primer IS1081-R, upstream primer β-actin-F and downstream primer β-actin-R are 10 μM, IS6110 probe and IS1081 probe are 2 μM, β-actin probe is used at a concentration of 4 μM, the concentrations of the six probes for drug resistance detection are all 4 μM, upstream primer rpoB-F is used at a concentration of 2 μM, and downstream primer rpoB-R is used at a concentration of 10 μM) 10.4 μL was mixed with 2 μL DNA template, and the rest was prepared with nuclease-free water to obtain 25 μL PCR amplification reaction solution.

[0132] (3) PCR amplification and melting analysis: Perform amplification and melting analysis according to the following amplification procedure:

[0133] Step 1: 50°C for 2 min, 1 cycle;

[0134] Step 2: 95°C for 2 min, 1 cycle;

[0135] Step 3: 95°C for 10 sec, 60°C for 30 sec, 50 cycles, collecting the fluorescence signals of all channels during the 60°C extension in each cycle;

[0136] Step 4: 95°C for 1 min, 35°C for 1 min, 35°C-80°C, heating rate 0.06°C / s, collecting fluorescence signals of FAM, VIC, ROX, and CY5 channels every 1°C.

[0137] (4) Result analysis:

[0138] Figure 2 This is a typical melting curve diagram of the rifampicin-sensitive type involved in this application. The specific interpretation rules are shown in the table below:

[0139] Rifampicin resistance loci FAM channel VIC Channel ROX Channel CY5 channel Mycobacterium tuberculosis complex negative / CT value ≤50 / / Mycobacterium tuberculosis complex positive * CT value ≤50 CT value ≤44.49 * Rifampicin sensitive temperature range (℃) 58.5~62.0 55.5~59.5 61.5~64.5 62.0~65.5 rpoB c.510CAG>CAC 54.15 54.89 - - rpoB c.511CTG>CCG 54.99 - - - rpoB c.511CTG>CTC 51.32 53.29 - - rpoB c.511CTG>CGG 50.8 52.68 - - rpoB c.511CTG>TTG 51.94 51.57 - - rpoB c.512AGC>TGC 53.93 55.14 - - rpoB c.513CAA>AAA 49.9 51.2 - - rpoB c.513CAA>CCA 54.89 - - - rpoB c.513CAA>CAC 57.2 - - - rpoB c.513CAA>TTA 48.41 48.22 - - rpoB c.513CAA>CTA 49.29 49.31 - - rpoB c.513CAA>CGA 53.88 54.36 - - RpoB del510 / 511 / 512 56.18 - - - rpoB c.515ATG>ATT - 52.24 - - rpoB c.516GAC>CAC - 51.77 - - rpoB c.516GAC>TAC - 52.54 - - rpoB c.516GAC>GGC - 50.97 - - rpoB c.516GAC>GTC - 51.62 - - rpoB c.516GAC>GCC - 53.58 - - rpoB c.516GAC>TTC - 50.14 - - rpoB c.516GAC>AAA - 50.62 - - rpoB c.516GAC>AAC - 50.04 - - rpoB c.516GAC>ACC - 52.47 - - rpoB c.516GAC>CCC - 51.39 - - rpoB c.516GAC>CAA - 48.46 - - rpoB c.518AAC>CAC - 53.02 - - rpoB c.518AAC>GAC - 45.97、50.29 - - rpoB del517 / 518 - 45.19 - - rpoB c.522TCG>GCG - 53.29 - - rpoB c.522TCG>CAG - 51.96 - - rpoB c.522TCG>TTG - - 57.58 - rpoB c.523GGG>GGC - - 58.98 - rpoB c.524TTG>CTC - - 49.76 - rpoB c.526CAC>AAC - - 57.58 - rpoB c.526CAC>GAC - - 53.8 - rpoB c.526CAC>TAC - - 53.27 - rpoB c.526CAC>CCC - - 57.99 - rpoB c.526CAC>CGC - - 55.07 - rpoB c.526CAC>CTC - - 55.75 - rpoB c.526CAC>AGC - - 50.86 - rpoB c.526CAC>GGC - - 48.73 - rpoB c.526CAC>GTC - - 49.6 - rpoB c.526CAC>TGC - - 50.27 - rpoB c.526CAC>CAG - - 55.12 - rpoB c.526CAC>CAA - - 53.41 - rpoB c.526CAC>TTC - - 49.59 - rpoB c.526CAC>CTT - - 50.27 - rpoB c.526CAC>GCC - - 53.06 - rpoB c.526CAC>ACC - - 51.36 - rpoB c.526CAC>CGA - - 48.83 - rpoB c.529CGA>CGG - - 60.21 60.31 rpoB c.530CTG>ATG - - 60.21 60.31 rpoB c.530CTG>CTT - - 57.54 57.45 rpoB c.531TCG>TGG - - 55.24 54.96 rpoB c.531TCG>TTG - - 57.67 57.34 rpoB c.531TCG>TAC - - 54.73 50.74、54.62 rpoB c.531TCG>TAT - - 52.66 52.5 rpoB c.531TCG>TTC - - 54.53 50.48、54.52 rpoB c.531TCG>ACG - - 58.61 58.37 rpoB c.531TCG>TGT - - 55.14 54.84 rpoB c.531TCG>TTT - - 51.39 51.05 rpoB c.531TCG>CAG - - 56.18 55.63 rpoB c.533CTG>CCG - - 59.87 59.6 rpoB c.533CTG>TTG - - 60.24 60.42

[0140] Note: First, perform amplification curve analysis. When the CT value of the VIC channel is less than 50 and the CT value of the ROX channel is less than or equal to 44.49, it is judged as positive for Mycobacterium tuberculosis complex, and then perform rifampicin resistance interpretation. In the table, " / " represents no amplification curve; "*" represents whether there is an amplification curve or not; "-" represents that the melting temperature is within the melting temperature range of the sensitive type.

[0141] Embodiment 2:

[0142] This example performs an optimization test on the reaction system. The amplification efficiency of the Mycobacterium tuberculosis complex and rifampicin resistance mutation gene detection method is related to multiple reaction conditions, including primer-probe ratio, PCR enhancer concentration, different amplification programs and cycle numbers, etc. Therefore, more amplification products and better binding effects can be obtained by adjusting various conditions. This example optimizes the reaction conditions of the Mycobacterium tuberculosis complex and rifampicin resistance mutation gene detection method established in Example 1, and optimizes the primer-probe ratio, PCR enhancer concentration and different amplification cycle numbers respectively.

[0143] (1) Optimization of primer-probe ratio

[0144] IS6110 primer-probe ratio optimization:

[0145] Based on 10 μM IS6110 primers (the concentrations of both the upstream primer and the downstream primer were 10 μM), primer-probe ratios (concentration ratios) of 2:1, 2.5:1, 4:1, 5:1 and 6:1 were prepared, respectively, and used for the Mycobacterium tuberculosis complex and rifampicin-resistant mutation gene detection methods to detect the same Mycobacterium tuberculosis-positive sample (concentration of 100 bacteria / mL). Figure 3 The melting curve and amplification curve of different primer-probe ratios of IS6110 involved in this application are shown in FIG. Figure 3 As shown in the figure, when the primer-probe ratio is 5:1, the detection effect is optimal, the ROX channel has a better amplification curve, and there is no obvious interference peak in the ROX channel during the melting stage.

[0146] IS1081 primer-probe ratio optimization:

[0147] Based on 10 μM IS1081 primers (the concentrations of both the upstream primer and the downstream primer were 10 μM), primer-probe ratios (concentration ratios) of 2:1, 2.5:1, 4:1, 5:1, and 6:1 were prepared, respectively, for use in the Mycobacterium tuberculosis complex and rifampicin-resistant mutation gene detection methods to detect the same Mycobacterium tuberculosis positive sample (concentration of 100 bacteria / mL). Figure 4 The melting curve and amplification curve of different primer-probe ratios of IS1081 involved in this application are shown in FIG. Figure 4As shown in the figure, when the primer-probe ratio is 5:1, the detection effect is optimal, the ROX channel has a better amplification curve, and there is no obvious interference peak in the ROX channel during the melting stage.

[0148] Optimization of the ratio of rpoB primers

[0149] Based on 10 μM downstream primer rpoB, the ratios (concentration ratios) of upstream and downstream primers were prepared at 1:6, 1:5, 1:4, 1:3 and 1:2, respectively, and used for the Mycobacterium tuberculosis complex and rifampicin resistance mutation gene detection methods to detect the same Mycobacterium tuberculosis rifampicin resistance sample (concentration of 100 bacteria / mL). Figure 5 The melting curve and amplification curve of the rpoB gene involved in this application with different front and rear primer ratios are shown in FIG. Figure 5 As shown, when the concentration ratio of the downstream primer to the upstream primer is 5:1, the detection effect is optimal and the peak shape of each channel is higher.

[0150] (2) Optimization of PCR enhancer concentration

[0151] The PCR enhancers used in this example are betaine, dimethyl sulfoxide and 20,000 polyethylene glycol. Betaine at concentrations of 0 M, 0.5 M, 1 M, 1.5 M, and 2 M, dimethyl sulfoxide at 0%, 1%, 2%, 3%, and 4%, and 20,000 polyethylene glycol at 0%, 3%, 4%, 5%, and 6% are prepared respectively. The detection is performed using the same method as above, and the experiment is repeated three times. Figure 6 is a graph showing the CT value of the amplification curves of different PCR enhancer concentrations involved in this application. The results are as follows: Figure 6 As shown, the best amplification effect was achieved when the concentration of betaine was 1 M, the concentration of dimethyl sulfoxide was 2%, and the concentration of 20,000 polyethylene glycol was 5%.

[0152] (3) Optimization of amplification cycle number

[0153] In this example, 40, 45, 50, and 55 cycles of amplification were performed, and the detection was performed using the same method as above, and the experiment was repeated three times. Figure 7 It is a graph of the CT value results of the amplification curves of different PCR cycle numbers involved in this application. The results are as follows Figure 7 As shown, the amplification effect is optimal when the number of amplification cycles is 50.

[0154] Example 3: National reference product testing

[0155] The reagents and methods of Example 1 were used to detect Mycobacterium tuberculosis and the national reference plate of rifampicin resistance genes.

[0156] In this example, the test results of 15 positive reference products and 15 negative reference products are: the positive reference product compliance rate is 100%, and the negative reference product compliance rate is 100%; in this example, the precision reference CV is <5%, and the minimum detection amount reference product S4 (1 bacterium / mL) can be detected. The national reference product plate of Mycobacterium tuberculosis is shown in the table below, and the test results are shown in Figure 8 , Figure 8 This is a graph showing the results of testing the national reference product of Mycobacterium tuberculosis involved in this application.

[0157] category serial number concentration Strain type Positive reference P1~P15 1×10^3 bacteria / mL Mycobacterium tuberculosis Negative reference N1 1×10^3 bacteria / mL Mycobacterium avium Negative reference N2 1×10^3 bacteria / mL Mycobacterium terrestris Negative reference N3 1×10^3 bacteria / mL Mycobacterium stutzeri Negative reference N4 1×10^3 bacteria / mL Mycobacterium kansasii Negative reference N5 1×10^3 bacteria / mL Mycobacterium asiatica Negative reference N6 1×10^3 bacteria / mL Mycobacterium scrofula Negative reference N7 1×10^3 bacteria / mL Mycobacterium gordonii Negative reference N8 1×10^3 bacteria / mL Mycobacterium chelonae Negative reference N9 1×10^3 bacteria / mL Mycobacterium fortuitum Negative reference N10 1×10^3 bacteria / mL Mycobacterium phlei Negative reference N11 1×10^3 bacteria / mL Nocardia brasiliensis Negative reference N12 1×10^3 bacteria / mL Corynebacterium pekinensis Negative reference N13 1×10^3 bacteria / mL Pneumococcus Negative reference N14 1×10^3 bacteria / mL Legionella pneumophila Negative reference N15 1×10^3 bacteria / mL Bordetella pertussis Precision (Repeatability) Reference J 1×10^2 bacteria / mL Mycobacterium tuberculosis (CMCC 93009) Minimum detection reference S1 1×10^3 bacteria / mL Mycobacterium tuberculosis (CMCC 93009) single cell suspension Minimum detection reference S2 1×10^2 bacteria / mL Mycobacterium tuberculosis (CMCC 93009) single cell suspension Minimum detection reference S3 1×10^1 bacteria / mL Mycobacterium tuberculosis (CMCC 93009) single cell suspension Minimum detection reference S4 1×10^0 bacteria / mL Mycobacterium tuberculosis (CMCC 93009) single cell suspension

[0158] In this example, the reagent and method of Example 1 were used to detect the national reference plate of rifampicin resistance genes. The compliance rate of the sensitive reference was 100%, the compliance rate of the resistant reference was 100%, the minimum detection amount reference RIF-L2 (5 bacteria / mL) was detectable, and the minimum detection amount reference RIF-L3 (1% resistance ratio) was detectable. The test results are shown in Fig. 9 , Fig.10 and Fig.11 , Fig. 9 This is a result graph of testing the sensitive reference substance of the rifampicin-resistant national reference substance involved in this application, Fig.10 is a result graph of testing the drug-resistant reference product of the national reference product of rifampicin resistance involved in this application, Fig.11 This is the result of testing the minimum detection amount reference of the national reference of rifampicin resistance involved in this application. The national reference of rifampicin resistance gene is shown in the following table:

[0159] category serial number Strain number (CMCC) Final concentration Mutation site Sensitive reference N1 95102 10^4 bacteria / mL None (sensitive) Sensitive reference N2 95103 10^4 bacteria / mL None (sensitive) Sensitive reference N3 95104 10^4 bacteria / mL None (sensitive) Sensitive reference N4 95105 10^4 bacteria / mL None (sensitive) Sensitive reference N5 95106 10^4 bacteria / mL None (sensitive) Sensitive reference N6 95119 10^4 bacteria / mL None (sensitive) Sensitive reference N7 95121 10^4 bacteria / mL None (sensitive) Sensitive reference N8 95122 10^4 bacteria / mL None (sensitive) Sensitive reference N9 95123 10^4 bacteria / mL None (sensitive) Sensitive reference N10 95125 10^4 bacteria / mL None (sensitive) Minimum detection amount reference (drug resistance) RIF-L2 94002 5 bacteria / mL rpoB 531 mutation Minimum detection amount reference (1% drug resistance ratio) RIF-L3 94015、93009 1% resistant rpoB 531 mutation

[0160] And the following table:

[0161] category serial number Strain number (CMCC) Final concentration Mutation site Drug-resistant reference R1-IR-1 94002 10^4 bacteria / mL rpoB 531 mutation Drug-resistant reference R2-IR-2 94003 10^4 bacteria / mL rpoB 516 mutation Drug-resistant reference R3-IR-3 94004 10^4 bacteria / mL rpoB 531 mutation Drug-resistant reference R4-IR-4 94008 10^4 bacteria / mL rpoB 526 mutation Drug-resistant reference R5-IR-5 94010 10^4 bacteria / mL rpoB 526 mutation Drug-resistant reference R6-IR-6 94011 10^4 bacteria / mL rpoB 526 mutation Drug-resistant reference R7-IR-7 94015 10^4 bacteria / mL rpoB 531 mutation Drug-resistant reference R8-IR-8 94019 10^4 bacteria / mL rpoB 516 mutation Drug-resistant reference R9-IR-9 94020 10^4 bacteria / mL rpoB 531 mutation Drug-resistant reference R10-IR-10 94288 10^4 bacteria / mL rpoB 526 mutation Drug-resistant reference R11-IR-11 95377 10^4 bacteria / mL rpoB 522 mutation Drug-resistant reference R12-IR-12 95577 10^4 bacteria / mL rpoB 510-512 deletion Drug-resistant reference R13-IR-13 94024 10^4 bacteria / mL rpoB 526 mutation Drug-resistant reference R14-IR-14 94286 10^4 bacteria / mL rpoB 531 mutation Drug-resistant reference R15-R-1 95113 10^4 bacteria / mL rpoB 513 mutation Drug-resistant reference R16-R-2 95329 10^4 bacteria / mL rpoB 533 mutation Drug-resistant reference R17-R-3 95581 10^4 bacteria / mL rpoB 517-518 deletion

[0162] Example 4: Limit of Detection (LoD)

[0163] This example uses the reagents and methods of Example 1 to test the minimum detection limit LoD of Mycobacterium tuberculosis complex and rifampicin resistance.

[0164] The Mycobacterium tuberculosis reference substance S1 of Example 3 was diluted to a concentration of 1 bacterium / mL sample, and the sample of this concentration was tested using the method of Example 1, and the test was repeated 20 times. Fig.12 This is the analysis chart of the minimum detection limit of Mycobacterium tuberculosis and the minimum detection limit of rifampicin resistance involved in the present application, Fig.12It can be seen that there are obvious amplification curves in 20 repeated tests, the CT value range is 37-42, and the detection rate is 100%, which is greater than 95%. Therefore, the minimum detection limit LoD of the reagent provided in this application for detecting Mycobacterium tuberculosis complex is 1 bacterium / mL.

[0165] The reference substance RIF-L2 (5 bacteria / mL) for the minimum detection amount of rifampicin resistance in Example 3 was used as the test object, and the sample was repeatedly measured 20 times using the method in Example 1. Fig.12 It can be seen that 20 repeated tests all showed rifampicin resistance, with a detection rate of 100%, which is greater than 95%. Therefore, the minimum detection limit LoD of the reagent provided in this application for detecting rifampicin resistance is 5 bacteria / mL.

[0166] Example 5: Clinical sample testing

[0167] The reagents and methods of Example 1 were used to detect the Mycobacterium tuberculosis complex and rifampicin resistance genes in clinical samples. A total of 804 sputum samples were collected, of which 431 were positive for Mycobacterium tuberculosis culture and 372 were negative for Mycobacterium tuberculosis culture. In addition, 384 Mycobacterium tuberculosis cultures were collected, of which 104 were rifampicin resistant and 280 were sensitive in drug sensitivity tests.

[0168] The test results are as follows: The above 804 sputum samples were tested by this embodiment, of which 431 were positive for Mycobacterium tuberculosis culture, 372 were negative for Mycobacterium tuberculosis culture, 1 was a difference result, the positive compliance rate was 99.77%, the negative compliance rate was 100%, and the total compliance rate was 99.88%. Among them, 104 cases were rifampicin resistant in the drug sensitivity test, 280 were sensitive, the positive compliance rate was 100%, the negative compliance rate was 100%, and the total compliance rate was 100%.

[0169] The statistical results of Mycobacterium tuberculosis detection are as follows:

[0170]

[0171] The statistical results of the consistency of the results are shown in the following table:

[0172]

[0173] The statistical results of rifampicin resistance detection are as follows:

[0174]

[0175] The statistical results of the consistency of the results are shown in the following table:

[0176]

[0177] The above contents are further detailed descriptions of the present application in combination with specific implementation methods, and it cannot be determined that the specific implementation of the present application is limited to these descriptions. For ordinary technicians in the technical field to which the present application belongs, several simple deductions or substitutions can be made without departing from the concept of the present application.

Claims

1. A reagent for detecting rifampicin resistance, the reagent is used to detect mutations in the rifampicin resistance determining region of the rpoB gene, characterized in that: The reagent includes a primer set for amplifying the rifampicin resistance determining region of the rpoB gene, including: a first upstream primer, the sequence of which is shown in SEQ ID NO.7; a first downstream primer, the sequence of which is shown in SEQ ID NO.8; the reagent includes a plurality of probes covering the rifampicin resistance determining region of the rpoB gene, including: a first probe, the sequence of which is shown in SEQ ID NO.1; a second probe, the sequence of which is shown in SEQ ID NO.2; a third probe, the sequence of which is shown in SEQ ID NO.3; and a fourth probe, the sequence of which is shown in SEQ ID NO.4; wherein: The plurality of probes include dual-labeled probes and single-labeled probes; one end of the dual-labeled probe is labeled with a fluorescent group, and the other end is labeled with a quenching group; one end of the single-labeled probe is labeled with a fluorescent group, and the other end is not labeled with a fluorescent group or a quenching group; The probe types of the first probe, the second probe, the third probe and the fourth probe are respectively: dual-labeled probe, single-labeled probe, dual-labeled probe and single-labeled probe; or, dual-labeled probe, single-labeled probe, single-labeled probe and dual-labeled probe; or, single-labeled probe, dual-labeled probe, single-labeled probe and dual-labeled probe; and the first probe and the second probe share a quenching group, and the third probe and the fourth probe share a quenching group.

2. The reagent according to claim 1, characterized in that The multiple probes covering the rifampicin resistance determining region of the rpoB gene also include: a fifth probe, whose sequence is shown in SEQ ID NO.5; a sixth probe, whose sequence is shown in SEQ ID NO.6; wherein the group labeling conditions of the fifth probe and the first probe are the same, and the group labeling conditions of the sixth probe and the second probe are the same.

3. The reagent according to claim 1, characterized in that Among the first probe, the second probe, the third probe and the fourth probe, the fluorescent groups of the dual-labeled probes are different from each other, and the fluorescent groups of the single-labeled probes are different from each other.

4. The reagent according to claim 3, characterized in that The fluorescent group is selected from FAM, FITC, HEX, VIC, TET, JOE, ROX, CY3, CY5, CY5.5, CY7, ATTO 425 and SF670, and the quenching group is selected from BHQ1, BHQ2, BHQ3, MGB and DABCYL.

5. A kit for detecting Mycobacterium tuberculosis complex and rifampicin resistance, characterized in that: The reagent comprises the reagent according to any one of claims 1 to 4, further comprising: a first primer probe set for specifically detecting IS6110 and / or a second primer probe set for specifically detecting IS1081, and a third primer probe set for specifically detecting an internal reference gene β-actin.

6. The kit according to claim 5, characterized in that The first primer probe group includes: a second upstream primer, whose sequence is shown in SEQ ID NO.9; a second downstream primer, whose sequence is shown in SEQ ID NO.10; and a seventh probe, whose sequence is shown in SEQ ID NO.11; the second primer probe group includes: a third upstream primer, whose sequence is shown in SEQ ID NO.12; a third downstream primer, whose sequence is shown in SEQ ID NO.13; and an eighth probe, whose sequence is shown in SEQ ID NO.14; wherein the seventh probe and the eighth probe are both dual-labeled probes.

7. A detection device for Mycobacterium tuberculosis complex and rifampicin resistance, characterized in that: include: Amplification module: using the kit as claimed in claim 6 to perform fluorescence quantitative PCR detection on the sample to be tested, and performing melting curve analysis; Judgment module: judging whether the sample to be tested contains Mycobacterium tuberculosis complex according to the CT value, and judging whether the sample to be tested contains rifampicin-resistant bacteria according to the Tm value of the melting curve.

8. The detection device according to claim 7, characterized in that: In the fluorescent quantitative PCR detection reaction system of the amplification module, the molar ratio of the first upstream primer to the first downstream primer is 1:5; the molar ratio of the second upstream primer or the second downstream primer to the seventh probe is 5:1; the molar ratio of the third upstream primer or the third downstream primer to the eighth probe is 5:

1.

9. The detection device according to claim 7, characterized in that: In the fluorescent quantitative PCR detection reaction system of the amplification module, a PCR enhancer is used, and the PCR enhancer includes betaine, dimethyl sulfoxide and 20000 polyethylene glycol; in the fluorescent quantitative PCR detection reaction system of the amplification module, the concentration of betaine is 1M, the concentration of dimethyl sulfoxide is 2%, and the concentration of 20000 polyethylene glycol is 5%.

Images