Bacillus paralicheniformis and its application in preventing and controlling ginseng rust

Abstract

The present invention relates to the field of microbial technology, and specifically to a Bacillus paralicheniformis and its application in preventing and controlling ginseng rust rot. The Bacillus paralicheniformis MZ28 described in the present invention is isolated from rhizosphere soil samples with continuous cropping obstacles and frequent ginseng rust rot. The plate confrontation method experiment shows that the strain has an inhibition rate of 55.54% on the pathogens of ginseng rust rot. Bacillus paralicheniformis MZ28 has a good inhibitory effect on the pathogens of ginseng rust rot at a temperature suitable for the growth of the pathogens of ginseng rust rot. The potted plant experiment further verified that the potted control effect of Bacillus paralicheniformis MZ28 on ginseng rust rot is 56.46%, so it has a good control effect on ginseng rust rot.

Description

Technical Field

[0001] The invention relates to the technical field of microorganisms, and in particular to a Bacillus paralicheniformis and application thereof in preventing and treating ginseng rust rot. Background Art

[0002] The information disclosed in this background technology section is only intended to enhance the understanding of the overall background of the invention, and should not necessarily be regarded as an admission or any form of suggestion that the information constitutes the prior art already known to a person skilled in the art.

[0003] Ginseng (Panax ginseng CA Meyer) is an herbaceous plant of the Araliaceae family. As a kind of precious Chinese medicinal material, it is recorded in many pharmacopoeias and has a long history of application in the field of traditional Chinese medicine.

[0004] Due to long-term continuous cropping and irrational use of drugs, ginseng diseases have increased, affecting ginseng yield and quality. Ginseng rust is a soil-borne fungal disease with a high incidence and severe disease conditions. Ginseng rust is highly destructive to ginseng. The pathogen not only exists in the soil and rhizosphere, but also exists as endophytes in the ginseng root system. This fungal disease is also one of the main factors leading to ginseng continuous cropping problems. The occurrence of continuous cropping problems will also increase the frequency of disease attacks, thus forming a vicious circle.

[0005] Due to the adverse effects of chemical agents on environmental sustainability, biological agents, as an environmentally friendly and sustainable prevention and control method, have received more and more attention. In recent years, with the enrichment of the application of biocontrol strains in disease prevention, the research on biocontrol bacteria for ginseng rust has also increased day by day, but biocontrol bacteria with significant prevention and control effects on a single symptom of rust rot have yet to be further discovered. Summary of the invention

[0006] In order to overcome the above problems, the present invention provides a Bacillus paralicheniformis and application thereof in preventing and treating ginseng rust rot.

[0007] In order to achieve the above technical objectives, the present invention adopts the following technical solutions:

[0008] The first aspect of the present invention provides a Bacillus paralicheniformis MZ28, which was deposited in the General Microbiology Center of China National Microbiological Culture Collection Administration on August 2, 2024, with a deposit number of CGMCC No.31526.

[0009] The 16S rDNA sequence of Bacillus paralicheniformis MZ28 is shown in SEQ ID NO.1.

[0010] The morphological characteristics of the Bacillus paralicheniformis MZ28 in the present invention are: white, raised and rough surface, irregular colony edges, and agglomerated texture.

[0011] The second aspect of the present invention provides a fermentation method of Bacillus paralicheniformis MZ28 according to the first aspect, comprising: inoculating Bacillus paralicheniformis MZ28 into a culture medium, fermenting, and obtaining a fermentation liquid of Bacillus paralicheniformis MZ28.

[0012] In one or more embodiments, the fermentation temperature is 15-25°C, preferably 25°C.

[0013] In one or more embodiments, the formula of the culture medium includes: 41.4 g / L corn flour, 16.54 g / L soybean meal, and 4.75 g / L potassium dihydrogen phosphate.

[0014] The third aspect of the present invention provides a microbial preparation, wherein the microbial preparation comprises the Bacillus paralicheniformis MZ28 described in the first aspect.

[0015] A fourth aspect of the present invention provides a biocontrol agent comprising the Bacillus paralicheniformis MZ28 described in the first aspect.

[0016] The fifth aspect of the present invention provides the use of the Bacillus paralicheniformis MZ28 of the first aspect and / or the microbial preparation of the third aspect and / or the biocontrol agent of the fourth aspect in any of the following:

[0017] (A1) Prevent and control ginseng rust;

[0018] (A2) Preparing a product for preventing and controlling ginseng rust.

[0019] The sixth aspect of the present invention provides the use of the Bacillus paralicheniformis MZ28 of the first aspect and / or the microbial preparation of the third aspect and / or the biocontrol agent of the fourth aspect in any of the following:

[0020] (B1) inhibiting plant pathogenic fungi;

[0021] (B2) preparing products for inhibiting plant pathogenic fungi;

[0022] (B3) prevention and control of diseases caused by plant pathogenic fungi;

[0023] (B4) Preparation of products for controlling diseases caused by plant pathogenic fungi.

[0024] In one or more embodiments, the plant pathogenic fungus includes Ilyonectria robusta, the pathogen of ginseng rust.

[0025] The seventh aspect of the present invention provides the use of the Bacillus paralicheniformis MZ28 of the first aspect and / or the microbial preparation of the third aspect and / or the biocontrol agent of the fourth aspect in any of the following:

[0026] (C1) catalyzes the decomposition of hydrogen peroxide;

[0027] (C2) preparing a product for catalyzing the decomposition of hydrogen peroxide;

[0028] (C3) nitrate reduction;

[0029] (C4) Preparation of products for the reduction of nitrates.

[0030] The seventh aspect of the present invention provides a method for preventing and controlling ginseng rust, comprising: applying the Bacillus paralicheniformis MZ28 provided in the first aspect and / or the microbial preparation described in the third aspect and / or the biocontrol agent described in the fourth aspect to the rhizosphere soil of ginseng plants.

[0031] The beneficial effects of the present invention are:

[0032] The paralicheniformis MZ28 of the present invention is isolated from rhizosphere soil samples with continuous cropping obstacles and frequent occurrence of ginseng rust rot. The plate confrontation method experiment shows that the strain can inhibit the ginseng rust rot pathogen Ilyonectria robusta by 55.54%. The optimal growth temperature of the ginseng rust rot pathogen Ilyonectria robusta is 20°C, and 15-25°C is the temperature suitable for its growth. The experimental results show that the paralicheniformis MZ28 has a good inhibitory effect on the ginseng rust rot pathogen Ilyonectria robusta at the temperature suitable for the growth of the ginseng rust rot pathogen Ilyonectria robusta. The rifampicin-resistant mutant strain was subcultured in a liquid culture medium (without rifampicin) for 10 generations, and it was found that the domesticated strain MZ28 can grow on a plate containing rifampicin and still maintain the antagonistic activity against the pathogen. At the same time, Bacillus paralicheniformis MZ28 has a certain colonization and survival ability in the rhizosphere soil of ginseng in the short term (30 days). The pot experiment further verified that the pot control effect of Bacillus paralicheniformis MZ28 on ginseng rust was 56.46%, so it has a good control effect on ginseng rust. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] The accompanying drawings in the specification, which constitute a part of the present invention, are used to provide a further understanding of the present invention. The exemplary embodiments of the present invention and their descriptions are used to explain the present invention and do not constitute improper limitations on the present invention.

[0034] Figure 1 This is the colony morphology of Bacillus paralicheniformis MZ28;

[0035] Figure 2 The antagonistic effect of Bacillus paralicheniformis MZ28 on Ilyonectria robusta, the pathogen of ginseng rust, wherein a is the result of the growth of Ilyonectria robusta, the pathogen of ginseng rust, on a PDA plate at 20°C for 5 days, and b is the verification of the antagonistic effect of Bacillus paralicheniformis MZ28 on Ilyonectria robusta, the pathogen of ginseng rust, when grown on a PDA plate at 20°C for 5 days;

[0036] Figure 3 is the Gram staining image of Bacillus paralicheniformis MZ28;

[0037] Figure 4 The result diagram of the phylogenetic tree construction for Bacillus paralicheniformis MZ28;

[0038] Figure 5 This is the growth curve of Bacillus paralicheniformis MZ28 at different low temperatures;

[0039] Figure 6 The spore numbers of Bacillus paralicheniformis MZ28 at different low temperatures;

[0040] Figure 7 is the inhibition rate of Bacillus paralicheniformis MZ28 on ginseng rust at different low temperatures;

[0041] Figure 8 This is the growth of Bacillus paralicheniformis MZ28 on a plate containing rifampicin before acclimation with rifampicin;

[0042] Fig. 9 This is the growth of Bacillus paralicheniformis MZ28 after acclimation to rifampicin in a plate containing rifampicin;

[0043] Fig.10 The antagonistic effect of Bacillus paralicheniformis MZ28 against ginseng rust before acclimation with rifampicin;

[0044] Fig.11 The antagonistic effect of Bacillus paralicheniformis MZ28 after acclimation with rifampicin on ginseng rust;

[0045] Fig.12 The number of live bacteria of Bacillus paralicheniformis MZ28 in the rhizosphere soil of ginseng (excluding rifampicin plate);

[0046] Fig.13 The number of live bacteria of Bacillus paralicheniformis MZ28 in the rhizosphere soil of ginseng (including rifampicin plate);

[0047] Fig.14The number of live bacteria of Bacillus paralicheniformis MZ28 in ginseng roots (excluding rifampicin plate);

[0048] Fig.15 The number of live bacteria of Bacillus paralicheniformis MZ28 in ginseng roots (including rifampicin plate);

[0049] Fig.16 This is a diagram showing the potted control effect of Bacillus paralicheniformis MZ28 on ginseng rust (a is the clear water control, b is the pathogen treatment, and c is the Bacillus paralicheniformis MZ28 + pathogen treatment). DETAILED DESCRIPTION

[0050] It should be noted that the following detailed descriptions are exemplary and are intended to provide further explanation of the present invention. Unless otherwise specified, all technical and scientific terms used in the present invention have the same meanings as those commonly understood by those skilled in the art to which the present invention belongs.

[0051] It should be noted that the terms used herein are only for describing specific embodiments and are not intended to limit exemplary embodiments according to the present invention. As used herein, unless the context clearly indicates otherwise, the singular form is also intended to include the plural form. In addition, it should be understood that when the terms "comprising" and / or "including" are used in this specification, it indicates the presence of features, steps, operations, devices, components and / or combinations thereof.

[0052] In order to enable those skilled in the art to more clearly understand the technical solution of the present invention, the technical solution of the present invention will be described in detail below in conjunction with specific embodiments.

[0053] Example 1

[0054] 1.1 Screening of Bacillus paralicheniformis MZ28

[0055] At the standardized ginseng cultivation base in Baishan City, Jilin Province, rhizosphere soil samples were collected from areas with continuous cropping obstacles and frequent ginseng rust, placed in plastic ziplock bags, stored in a 4°C incubator, and brought back to the laboratory for strain isolation. The soil was air-dried and passed through a 20-mesh sieve. 10 g of the sample was weighed and placed in a 250 mL conical flask containing glass beads and 90 mL of sterile water, shaken thoroughly for 10 to 30 minutes, mixed and allowed to stand for 5 minutes. Take 1 mL of the supernatant under sterile conditions, add 9 mL of sterile water, and press 10 -3 , 10 -4 , 10 -5 Dilutions were prepared in a gradient. 100 μL of each concentration of dilution was taken and spread on a Gao's No. 1 plate using the plate dilution method. Each treatment was repeated 3 times and cultured in a constant temperature incubator (30°C constant temperature culture for 24 hours). The purified actinomycetes were stored at -80°C.

[0056] Plate confrontation method: Inoculate an 8mm diameter cake of Ilyonectria robusta, the rust pathogen, in the center of the PDA plate, and inoculate the initially screened strain 2cm away from the edge of the pathogen. Culture the plate at 20℃ for 5 days and observe whether an inhibition zone appears.

[0057] Inhibition rate (%) = [(AB) / (A-8)] × 100%

[0058] (A: growth diameter of Ilyonectria robusta, the pathogen of ginseng rust, in the control group; B: growth diameter of Ilyonectria robusta, the pathogen of ginseng rust, in the treatment containing fermentation supernatant; number 8 represents the diameter of the bacterial cake of Ilyonectria robusta, in mm).

[0059] The obtained Bacillus paralicheniformis MZ28 was screened and inoculated on LB solid medium. Figure 1 As shown, the morphological characteristics presented are: the colonies of strain MZ28 are white, with a raised and rough surface, irregular colony edges, and a clumpy texture.

[0060] Antagonistic effect of Bacillus paralicheniformis MZ28 on Ilyonectria robusta, the pathogen of ginseng rust Figure 2 As shown, the inhibition rate of the compound against Ilyonectria robusta, the pathogen of ginseng rust, was 55.54%.

[0061] 1.2 Physiological and biochemical experiments and molecular biological identification of Bacillus paralicheniformis MZ28

[0062] The strain MZ28 was initially judged to be Bacillus; the Gram staining results were as follows Figure 3 As shown, it is a Gram-positive bacterium.

[0063] Physiological and biochemical experiments on Bacillus paralicheniformis MZ28 were carried out according to the Manual of Bacterial Identification. The specific results are shown in Table 1.

[0064] Table 1 Physiological and biochemical experiments of Bacillus paralicheniformis MZ28

[0065]

[0066] Note: In the table, “+” means that the strain can utilize the substance, “-” means that the strain cannot utilize the substance, and “++” means that the strain has a stronger ability to utilize the substance.

[0067] As shown in Table 1, strain MZ28 can utilize rhamnose, sucrose, glucose, mannitol, sorbitol and ONPG, and has catalase activity and the ability to reduce nitrate, all of which are positive; it cannot utilize D-cellobiose, maltose, fructose, tryptophan, trehalose, methyl red, and the vp test and gelatin liquefaction are all negative.

[0068] The strain MZ28 was identified by molecular biology using 16S rDNA gene sequencing. The 16S rDNA sequence determination of the strain MZ28 was commissioned to Shanghai Shenggong Company, and the phylogenetic tree was constructed using MEGA 5.0 software. The results are as follows Figure 4 The results show that strain MZ28 is most closely related to Bacillus paralicheniformis. The 16S rDNA sequence of Bacillus paralicheniformis MZ28 is shown in SEQ ID NO.1.

[0069] The 16S rDNA sequence of Bacillus paralicheniformis MZ28 is as follows:

[0070] CTACGCTGCAGTCGAGCGGACAGATGGGAGCTTGCTCCCTGATGTTA

[0071] GCGGCGGACGGGTGAGTAACACGTGGGTAACCTGCCTGTAAGACTGGGA

[0072] TAACTCCGGGAAACCGGGGCTAATACCGGATGCTTGATTGAACCGCATGG

[0073] TTCAATTATAAAAGGTGGCTTTTAGCTACCACTTACAGATGGACCCGCGG

[0074] CGCATTAGCTAGTTGGTGAGGTAACGGCTCACCAAGGCAACGATGCGTAG

[0075] CCGACCTGAGAGGGTGATCGGCCACACTGGGACTGAGACACGGCCCAGA

[0076] CTCCTACGGGAGGCAGCAGTAGGGAATCTTCCGCAATGGACGAAAGTCTG

[0077] ACGGAGCAACGCCGCGTGAGTGATGAAGGTTTTCGGATCGTAAAACTCTG

[0078] TTGTTAGGGAAGAACAAGTACCGTTCGAATAGGGCGGTACCTTGACGGTA

[0079] CCTAACCAAAAAGCCACGGCTAACTACGTGCCAGCAGCCGCGGTAATACG

[0080] TAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGCG

[0081] GTTTCTTAAGTCTGATGTGAAAGCCCCCGGCTCAACCGGGGAGGGTCATT

[0082] GGAAACTGGGGAACTTGAGTGCAGAAGAGGAGAGTGGAATTCCACGTGT

[0083] AGCGGTGAAATGCGTAGAGATGTGGAGGAACACCAGTGGCGAAGGCGAC

[0084] TCTCTGGTCTGTAACTGACGCTGAGGCGCGAAAGCGTGGGGAGCGAACAG

[0085] GATTAGATACCCTGGTAGTCCACGCCGTAAACGATGAGTGCTAAGTGTTA

[0086] GAGGGTTTCCGCCCTTTAGTGCTGCAGCAAACGCATTAAGCACTCCGCCT

[0087] GGGGAGTACGGTCGCAAGACTGAAACTCAAAGGAATTGACGGGGGCCCG

[0088] CACAAGCGGTGGAGCATGTGGTTTAATTCGAAGCAACGCGAAGAACCTTA

[0089] CCAGGTCTTGACATCCTCTGACAACCCTAGAGATAGGGCTTCCCCTTCGG

[0090] GGGCAGAGTGACAGGTGGTGCATGGTTGTCGTCAGCTCGTGTCGTGAGAT

[0091] GTTGGGTTAAGTCCCGCAACGAGCGCAACCCTTGATCTTAGTTGCCAGCA

[0092] TTCAGTTGGGCACTCTAAGGTGACTGCCGGTGACAAACCGGAGGAAGGTG

[0093] GGGATGACGTCAAATCATCATGCCCCTTATGACCTGGGCTACACACGTGC

[0094] TACAATGGGCAGAACAAAGGGCAGCGAAGCCGCGAGGCTAAGCCAATCC

[0095] CACAAATCTGTTCTCAGTTCGGATCGCAGTCTGCAACTCGACTGCGTGAA

[0096] GCTGGAATCGCTAGTAATCGCGGATCAGCATGCCGCGGTGAATACGTTCC

[0097] CGGGCCTTGTACACACCGCCCGTCACACCACGAGAGTTTGTAACACCCGA

[0098] AGTCGGTGAGGTAACCTTTGGAGCCAGCCGCCGAAGGGGACA

[0099] Example 2 Growth characteristics of Bacillus paralicheniformis MZ28 at different low temperatures and inhibition rate of ginseng rust pathogen Ilyonectria robusta

[0100] The optimal growth temperature of Ilyonectria robusta, the pathogen of ginseng rust, is 20℃, and the temperature suitable for its growth is 15-25℃, which is a low-temperature fungus. Therefore, the inhibitory activity of biocontrol strains against Ilyonectria robusta, the pathogen of ginseng rust, and the growth characteristics of the biocontrol strains themselves at low temperatures (15℃, 20℃ and 25℃) were explored to get closer to the practical application of preventing and controlling ginseng rust.

[0101] (1) Growth curve of biocontrol strains under low temperature

[0102] The strain MZ28 was cultured at three temperatures: 15°C, 20°C, and 25°C, and the growth of the biocontrol strains at different temperatures was detected. A 250 mL triangular flask was selected for the experiment, with a liquid volume of 50 mL and an inoculation volume of 2%. After inoculation, the fermentation liquid was taken out every 6 hours to measure the OD 600Each temperature was set to 3 replicates.

[0103] (2) Sporulation of biocontrol strains under low temperature

[0104] The strain MZ28 was cultured at three temperatures, 15°C, 20°C and 25°C, to detect the spore formation of the biocontrol strain at different temperatures. A 250mL triangular flask was selected for the experiment, with a liquid volume of 50mL and an inoculation volume of 2%. After inoculation, the fermentation liquid was taken out every 12 hours to determine the number of spores. Method for determining the number of spores: Take 1mL of the fermentation liquid and place it in a water bath at 80°C for 15 minutes. After rapid cooling, the number of colonies was determined by the dilution coating method, which is the number of spores.

[0105] (3) Antibacterial activity of biocontrol strains at low temperatures

[0106] Three temperature gradients of 15℃, 20℃ and 25℃ were set to detect the inhibitory activity of strain MZ28 against pathogens at low temperature. The plate confrontation method was used, with 3 replicates for each treatment.

[0107] result:

[0108] (1) The growth curve results of strain MZ28 are shown in Figure 5 As shown in the figure, it can be seen that the strain grows well at 25℃ and basically reaches the maximum growth at 54h. At 20℃, the growth of the strain is inhibited and reaches the maximum at 96h. 600 The growth of the strain was significantly inhibited at 15°C, and the OD 600 No significant changes were observed in the OD at 120 h. 600 The value was 1.198. In general, strain MZ28 was seriously affected by low temperature, especially at 15℃, its growth was significantly inhibited.

[0109] (2) Detect the spore production of strain MZ28 at different temperatures. Figure 6 As shown in the figure, the spore number of strain MZ28 at different temperatures increased with the increase of temperature. At 96h, the spore number of strain MZ28 at 15℃, 20℃ and 25℃ was 1.34×10 9 cfu / mL, 2.97×10 9 cfu / mL and 4.06×10 9 cfu / mL, it can be seen that at 15℃, the spore number of strain MZ28 showed a significant downward trend.

[0110] (3) Detect the inhibition rate of strain MZ28 against pathogens at different temperatures. Figure 7As shown in the figure, it can be seen that at 15°C, the inhibition rate of strain MZ28 on pathogens is the lowest. This is because the growth of pathogens at 15°C is significantly affected by low temperature. Compared with 20°C and 25°C, their growth is inhibited, and the inhibitory activity of the biocontrol strain is also affected. Overall, strain MZ28 has a good inhibitory effect on pathogens at the adaptive growth temperature.

[0111] Example 3 Colonization and survival ability of Bacillus paralicheniformis MZ28 in ginseng rhizosphere soil and ginseng roots

[0112] (1) Labeling of biocontrol strains

[0113] Rifampicin (Rif) is a commonly used antibiotic that can inhibit the growth of most microorganisms in the soil, and the labeled strains can grow on plates containing Rif; therefore, the anti-rifampicin method is used to conduct colonization experiments on biocontrol strains, which is simple to operate and easy to use.

[0114] The domesticated biocontrol strains were resistant to rifampicin. The seed solution of the test strain was transferred into a liquid culture medium containing 20 μg / mL of rifampicin. After culturing for 2 days, the strains were transferred into a liquid culture medium containing 40 μg / mL of rifampicin, and the rifampicin concentration was gradually increased in a gradient of 20 μg / mL until a mutant strain was screened out that grew stably on a culture medium containing 300 μg / mL of rifampicin, had little difference in colony morphology, and had unchanged antagonism to pathogenic fungi.

[0115] (2) Activity detection of mutant strains

[0116] Determination of antagonistic activity of mutant strains: Using Ilyonectria robusta, the pathogen of ginseng rust, as the test bacteria, the activity of mutant strains was detected by plate confrontation method and agar diffusion culture method. Observe whether there are antibacterial zones and antibacterial circles, and compare the antibacterial activity with that of wild-type strains; detect whether the biocontrol strains have lost their antagonistic activity.

[0117] Stability test of mutant strains: The rifampicin-resistant mutant strain was subcultured in liquid culture medium (without rifampicin) for 10 generations, and the antagonistic activity and resistance to antibiotics of the mutant strains cultured in each generation were tested to observe the genetic stability of the mutant strains.

[0118] (3) Biocontrol strain colonization and survival ability potted treatment

[0119] Treatment 1 (immersion group - ginseng root): The experimental setting was that the treatment group was strain MZ28 bacterial suspension, and the control group was sterile culture solution; the bacterial suspension was adjusted to a concentration of 10 7cfu / mL, pour into tissue culture bottles, add diluted sterile culture medium to the control group; then put the washed ginseng seedlings in it and leave it at room temperature for 24 hours to allow the strain to colonize in the ginseng tissue; after the colonization is completed, take out the ginseng seedlings, rinse the surface bacteria with clean water, and then plant them.

[0120] Treatment 2 (irrigation group-ginseng rhizosphere soil): The experimental setting was that the treatment group was strain MZ28 bacterial suspension, and the control group was sterile culture solution; the bacterial suspension was adjusted to a concentration of 1×10 7 cfu / mL, for later use; after planting ginseng seedlings, slowly add a concentration of 1×10 7 cfu / mL of biocontrol bacteria suspension 15mL, add diluted sterile culture solution as a control, water the soil and then cover it with soil; culture at a constant temperature and keep the soil moist.

[0121] (5) Determination of colonization and survival ability of biocontrol strains

[0122] The colonization of biocontrol strains in ginseng rhizosphere soil and ginseng roots was detected by dilution and coating method; Treatment 1 (immersion group): Ginseng seedlings were taken out at 0d, 7d, 14d, and 30d, and the surface soil was washed off with clean water. 1g of rhizomes were weighed, and then rinsed three times with sterile water. The sterile water after the last rinse was used to coat to verify whether there were other strains except endophytes; then the ginseng seedlings were placed in a sterilized mortar, ground thoroughly, and placed in 9mL of sterile water, and diluted and coated on plates without rifampicin antibiotics and plates containing rifampicin antibiotics. Treatment 2 (irrigation group): Ginseng seedlings were taken out at 0d, 7d, 14d, and 30d, and 1g of rhizosphere soil was weighed and placed in 9mL of sterile water, and diluted and coated on plates without rifampicin antibiotics and plates containing rifampicin antibiotics. Each treatment was repeated three times. The colonization and survival ability of biocontrol strains was judged by the number of viable bacteria and strain morphology of the coating results.

[0123] result:

[0124] The stability results of strain MZ28 after acclimation with rifampicin are shown in Figure 8 and 9 , the strain MZ28 acclimated with rifampicin can grow on the plate containing rifampicin; Fig.10 and 11 It can be seen that the strain MZ28 still maintains antagonistic activity against pathogens after being acclimated with rifampicin.

[0125] The changes in the number of viable bacteria of strain MZ28 in the rhizosphere soil of ginseng were detected, such as Fig.12 , 13 As shown in Figure 2, at 30 days, the viable counts of strain MZ28 on plates without Rif and with Rif were 1.00×10 5 cfu / g, 9.00×103 cfu / g, the number of viable bacteria of strain MZ28 increased to a certain extent at 21d and 30d, indicating that strain MZ28 had a certain colonization and survival ability in the rhizosphere soil of ginseng in the short term (30d).

[0126] The changes in the number of viable bacteria of strain MZ28 in ginseng roots were detected, such as Fig.14 and 15 As shown in Figure 2, at 30 days, the viable counts of strain MZ28 on the blank plate and the plate containing rif were 4.00×10 3 cfu / g, 1.00×10 3 cfu / g; compared with 0d, the downward trend was slow, and strain MZ28 maintained a certain bacterial quantity in ginseng roots.

[0127] Example 4 Culture medium optimization of Bacillus paralicheniformis MZ28.

[0128] The single factor experimental method and response surface design were used to optimize the carbon source, nitrogen source and inorganic salt of the bean sprout juice basal medium for strain MZ28, and the optimal culture medium formula of strain MZ28 under laboratory conditions was determined. The optimal formula of strain MZ28 was 41.4 g / L corn flour, 16.54 g / L bean sprout powder and 4.75 g / L potassium dihydrogen phosphate, at which the number of viable bacteria reached the maximum.

[0129] Example 5

[0130] Potted experiment on the control of ginseng rust disease by Bacillus paralicheniformis MZ28.

[0131] The treatment groups were (1) Bacillus paralicheniformis MZ28 suspension (adjusted to 1×10 6 cfu / mL) + 15 mL of mycelial spore suspension of Ilyonectria robusta, the pathogen of ginseng rust; (2) 15 mL of mycelial spore suspension of Ilyonectria robusta, the pathogen of ginseng rust + 15 mL of equally diluted sterile culture medium (3) CK treatment: pour 30 mL of diluted sterile culture medium.

[0132] Dig up the plants 45 days after inoculation, observe and record the disease severity of ginseng, and calculate the disease index.

[0133] The severity of ginseng rust disease was divided into 6 levels according to the method of Liu Bingren et al. (with slight modifications), see Table 2.

[0134] Table 2 Disease grade of ginseng rust

[0135]

[0136] The disease index and prevention efficacy were calculated according to the following formulas:

[0137] Disease index = [∑(number of diseased plants × representative value) / (total number of plants × highest diseased representative value)] × 100%

[0138] Preventive effect (%) = (control disease index - treatment disease index) / control disease index × 100%

[0139] The control effect of strain MZ28 on ginseng rust in potted plants is shown in Fig.16 As shown in Table 3, the potted control effect of strain MZ28 on ginseng rust rot was 56.46%, and strain MZ28 had a good control effect on ginseng rust rot.

[0140] Table 3 The potted control effect of strain MZ28 on ginseng rust

[0141]

[0142] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. For those skilled in the art, the present invention may have various modifications and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. A Bacillus paralicheniformis ( Bacillus paralicheniformis )MZ28, deposited in the General Microbiology Center of China Microorganism Culture Collection Administration on August 2, 2024, with the deposit number CGMCC No. 31526.

2. The fermentation method of Bacillus paralicheniformis MZ28 according to claim 1, characterized in that: include: Bacillus paralicheniformis MZ28 is inoculated into a culture medium and fermented to obtain a fermentation liquid of Bacillus paralicheniformis MZ28.

3. The fermentation method of Bacillus paralicheniformis MZ28 according to claim 2, characterized in that: The fermentation temperature is 15~25℃.

4. The fermentation method of Bacillus paralicheniformis MZ28 according to claim 3, characterized in that: The fermentation temperature was 25°C.

5. The fermentation method of Bacillus paralicheniformis MZ28 according to claim 2, characterized in that: The formula of the culture medium includes: 41.4 g / L corn flour, 16.54 g / L soybean meal and 4.75 g / L potassium dihydrogen phosphate.

6. A microbial preparation, characterized in that: The microbial preparation comprises the Bacillus paralicheniformis MZ28 according to claim 1.

7. A biocontrol agent, characterized in that: The biocontrol agent comprises the Bacillus paralicheniformis MZ28 according to claim 1.

8. Use of the Bacillus paralicheniformis MZ28 according to claim 1 and / or the microbial preparation according to claim 6 and / or the biocontrol agent according to claim 7 in preventing and controlling ginseng rust.

9. Use of the Bacillus paralicheniformis MZ28 according to claim 1 and / or the microbial preparation according to claim 6 and / or the biocontrol agent according to claim 7 in any of the following: (C1) catalyzes the decomposition of hydrogen peroxide; (C2) Reduction of nitrates.

10. A method for preventing and treating ginseng rust, characterized in that: include: The Bacillus paralicheniformis MZ28 of claim 1 and / or the microbial preparation of claim 6 and / or the biocontrol agent of claim 7 are applied to the rhizosphere soil of ginseng plants.

Images