A miRNA marker, kit and application for diagnosing myelodysplastic syndrome

Abstract

The present invention relates to a miRNA marker combination, a kit and an application that can be used for diagnosing myelodysplastic syndrome (MDS). The present invention obtains a miRNA that is significantly highly expressed in myelodysplastic syndrome by screening: hsa-mir-372-5p; and further verification results show that hsa-mir-372-5p can effectively distinguish MDS patients from healthy people and can be used as an effective biomarker for diagnosing MDS.

Description

Technical Field

[0001] The present invention belongs to the field of molecular biological diagnosis, and specifically refers to a miRNA marker combination, a kit and an application thereof that can be used for diagnosing myelodysplastic syndrome (MDS). Background Art

[0002] Myelodysplastic syndrome (MDS) is a group of clonal malignant diseases originating from hematopoietic stem cells, and its pathogenesis is not yet fully elucidated. The characteristics of MDS include: unexplained persistent peripheral blood (PB) cytopenia (one or more hematopoietic lineages), bone marrow (BM) hematopoietic cell morphological dysplasia, and recurrent genetic abnormalities. The diagnosis of MDS has always been a clinical difficulty, lacking effective diagnostic indicators (see: Tria FP 4th, Ang DC, Fan G. Myelodysplastic Syndrome: Diagnosis and Screening. Diagnostics (Basel). 2022Jun29; 12(7): 1581.).

[0003] miRNAs are a type of non-coding RNA of approximately 22 nucleotides. They play an important role in a variety of biological and pathological processes, such as cell proliferation, differentiation, apoptosis, and carcinogenesis. miRNAs are involved in all stages of tumor development. Studies have shown that abnormal expression of miRNAs plays an important regulatory role in the expression of known oncogenes or tumor suppressor genes during tumor development. More importantly, miRNAs are extremely abundant in the blood and are easy to detect. At the same time, compared with protein detection which is restricted by antibody technology, miRNA detection is simpler and more accurate. Therefore, it has received great attention in clinical practice. Currently, more and more miRNAs have been discovered and become diagnostic or therapeutic markers for a variety of diseases, which are used to assist in the diagnosis and prognosis of tumor patients or as therapeutic targets.

[0004] Recent studies have shown that abnormally expressed micro RNAs (miRNAs) exist in MDS patients, which may be related to the molecular mechanism of MDS pathogenesis and may affect the function of bone marrow mesenchymal stem cells (MDS-MSCs) in MDS patients. However, so far, there are few reports on miRNA biomarkers that can effectively diagnose MDS. Summary of the invention

[0005] In order to solve one of the above-mentioned technical problems existing in the prior art, the present invention provides a miRNA marker that can effectively diagnose myelodysplastic syndrome (MDS). The present invention screened and obtained a miRNA that is significantly highly expressed in myelodysplastic syndrome: hsa-mir-372-5p through serum samples of patients clinically diagnosed with myelodysplastic syndrome and serum samples of normal physical examination population collected in the early stage. For hsa-mir-372-5p, based on the expanded validation sample set, it was further verified whether it can effectively diagnose MDS, and the ROC curve was plotted, showing that the AUC value of hsa-mir-372-5p in distinguishing MDS patients from healthy people is 0.955. The results show that hsa-mir-372-5p can effectively diagnose MDS patients as a biomarker.

[0006] The sequence of hsa-mir-372-5p is shown in SEQ ID NO: 5, which is: 5'-CCTCAAATGTGGAGCACTATTCT-3'.

[0007] In one aspect, the present invention provides a reagent for detecting miRNA expression level and its use in preparing a product for diagnosing myelodysplastic syndrome, wherein the miRNA is hsa-mir-372-5p.

[0008] Preferably, the miRNA expression level is the expression level in a serum sample.

[0009] Preferably, the product is a detection kit.

[0010] Preferably, the reagent comprises a specific primer pair and a universal primer pair for detecting the expression level of hsa-mir-372-5p. The sequence of the primer for detecting hsa-mir-372-5p of the present invention can be obtained by conventional design methods in the art.

[0011] Specifically, the sequence of the specific primer pair is selected from one or more of SEQ ID NO: 1 and SEQ ID N: 2; the sequence of the universal primer pair is selected from one or more of SEQ ID NO: 3 and SEQ ID N: 4.

[0012] On the other hand, the present invention also provides a miRNA detection kit for diagnosing MDS, wherein the miRNA is hsa-mir-372-5p, and the kit includes primers for detecting hsa-mir-372-5p; further, the kit also includes other PCR basic reagents. The primers for detecting hsa-mir-372-5p include a specific primer pair and a universal primer pair for detecting the expression level of hsa-mir-372-5p. Specifically, the sequence of the specific primer pair is selected from one or more of SEQ ID NO: 1 and SEQ ID N: 2; the sequence of the universal primer pair is selected from one or more of SEQ ID NO: 3 and SEQ ID N: 4'.

[0013] Preferably, the basic reagents include at least one of a positive quality control, a negative quality control, a poly-A tailing enzyme, a reverse transcriptase, dNTPs, a reverse transcription buffer, RNase-free water, a qPCR buffer, magnesium chloride, a DNA polymerase and a SYBR Green fluorescent dye.

[0014] In another aspect, the present invention also provides a use of a reagent for detecting hsa-mir-372-5p in preparing a kit for diagnosing myelodysplastic syndrome.

[0015] The beneficial effects of the present invention are as follows: the miRNA markers provided by the present invention enrich the indicators that can be used to diagnose myelodysplastic syndrome, and the prepared kit can quickly and accurately diagnose myelodysplastic syndrome, thereby improving the diagnostic efficiency. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 The expression differences of relevant miRNAs in MDS patients in Example 1 (Case represents MDS patient samples, Control represents healthy samples; * represents the degree of significant difference; ns represents no significant difference).

[0017] Figure 2 The differential expression of hsa-mir-372-5p in the validation set samples and the ROC curve diagram in Example 2 (Case represents MDS patient samples, Control represents healthy samples; * indicates the degree of significance of the difference). DETAILED DESCRIPTION

[0018] The present invention is further described in detail below by specific examples. Unless otherwise specified, the raw materials, reagents or devices used in the examples and comparative examples can be obtained from conventional commercial sources or can be obtained by prior art methods. Unless otherwise specified, the experiments or test methods are conventional methods in the art.

[0019] Example 1 Screening of differentially expressed miRNAs in MDS patients

[0020] The specific operation methods and operation procedures for sample collection and preparation are as follows: Serum samples collected from MDS patients and normal physical examination populations were used to select 10 MDS first-time patients and 10 normal physical examination samples through data collation, among which the MDS first-time patients had no history of medication or related surgery. The healthy population refers to the healthy population that has passed the physical examination at the physical examination center. Targeting the miRNAs (hsa-miR-372-5p, hsa-miR-181a-5p, hsa-miR-550a-5p, hsa-miR-495-5p, hsa-miR-155-5p) that have been reported to be highly expressed in other blood tumors as candidate target miRNAs, specific primers and universal primers were designed for one-step RT-PCR detection to detect their expression levels in the above samples.

[0021] The serum samples kept in the -80℃ refrigerator were taken out, placed in an ice bath at 0-4℃ until completely melted, centrifuged at 4℃, 10000g for 15 minutes, and 200μL of the supernatant was taken and placed in a new RNase-free EP tube. The samples were then placed in a fully automatic nucleic acid extractor to prepare total RNA with a concentration greater than 200ng / μL. The reaction system for one-step RT-PCR detection of target miRNA is shown in Table 1; the RT-PCR detection primers for target miRNA are shown in Table 2. The reaction program for one-step RT-PCR detection is: 45℃, 3min; 37℃, 5min, 1 cycle; 95℃, 30s; 37℃, 30s; 60℃30s, 1 cycle; 95℃, 30s; 72℃, 30s, 40cycles, 40 cycles. Three replicate wells were set for each sample to calculate the expression of the miRNA to be tested. The results showed that the expression levels of hsa-miR-372-5p and hsa-miR-181a-5p in MDS patients were significantly different, especially hsa-miR-372-5p, which was significantly increased in MDS patients ( Figure 1 ), which can be regarded as a potential diagnostic marker for MDS patients.

[0022] Table 1 Reaction system for one-step RT-PCR detection of target miRNA

[0023] Total RNA 0.5-1.0 μg 5X M-MLV Buffer* 2μL 10X PCR Buffer** 2μL Primer RP1 (2 μM) 0.2μL Primer RP2 (2 μM) 0.2μL Primer P1 (10 μM) 0.2μL Primer P2 (10 μM) 0.2μL 20X SYBR Green I 0.4μL Reverse Transcriptase M-MLV 20U RNase inhibitor 4U <![CDATA[ddH2O]]> Up to 20 μL

[0024] *5X M-MLV Buffer (250mM Tris-HCl, pH 8.3, 375mM KCl, 15mM MgCl2, 50mM Dithiothreitol)

[0025] **10X PCR Buffer (100mM Tris-HCl, pH 8.3, 500mM KCl, 15mM MgCl2)

[0026] Table 2: RT-PCR detection primers

[0027] Primers SEQ ID NO(5'>3') length P1 (universal primer) 3(GGACGGTAGCAAGCAAAGAGTGTG) 24 P2 (universal primer) 4(GGGATTCTGGAAGATGATGATGAC) 24 hsa-miR-372-5p RP1 1(GGACGGTAGCAAGCAAAGAGTGTGAGAATAGTGCT) 35 hsa-miR-372-5p RP2 2(GGGATTCTGGAAGATGATGATGACCCTCAAATGTG) 35 hsa-miR-181a-5p RP1 6(GGACGGTAGCAAGCAAAGAGTGTGACTCACCGACA) 35 hsa-miR-181a-5p RP2 7(GGGATTCTGGAAGATGATGATGACAACATTCAACG) 35 hsa-miR-550a-5p RP1 8(GGACGGTAGCAAGCAAAGAGTTGTGGGGCTCTTACT) 35 hsa-miR-550a-5p RP2 9(GGGATTCTGGAAGATGATGATGACAGTGCCTGAGG) 35 hsa-miR-495-5p RP1 10(GGACGGTAGCAAGCAAAGAGTGTGCGAAAATAACA) 35 hsa-miR-495-5p RP2 11(GGGATTCTGGAAGATGATGATGACGAAGTTGCCCA) 35 hsa-miR-155-5p RP1 12(GGACGGTAGCAAGCAAAGAGTGTGAACCCCTATCA) 35 hsa-miR-155-5p RP2 13(GGGATTCTGGAAGATGATGATGACTTAATGCTAAT) 35

[0028] Example 2: Verification of the diagnostic effectiveness of hsa-miR-372-5p for MDS

[0029] Based on another batch of collected clinical samples, serum samples of 73 MDS patients who were first diagnosed and 50 normal physical examination individuals were used. Referring to the detection method of Example 1, the expression level of hsa-miR-372-5p in the above MDS patients and normal physical examination samples was detected, and the ROC curve was drawn. The results showed that its AUC value was 0.955 ( Figure 2 ). Surface hsa-miR-372-5p can be used as an effective diagnostic indicator for myelodysplastic syndrome; it can quickly and accurately diagnose myelodysplastic syndrome and improve diagnostic efficiency.

[0030] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be equivalent replacement methods and are included in the protection scope of the present invention.

Claims

1. Use of a reagent for detecting miRNA expression level in the preparation of a product for diagnosing myelodysplastic syndrome, characterized in that: The miRNA is hsa-mir-372-5p.

2. The application according to claim 1, characterized in that: The reagent comprises a specific primer pair and a universal primer pair for detecting the expression level of hsa-mir-372-5p, wherein the sequence of the specific primer pair is: 5'-GGACGGTAGCAAGCAAAGAGTGTGAGAATAGTGCT-3' and 5'-GGGATTCTGGAAGATGATGATGACCCTCAAATGTG-3'; the sequence of the universal primer pair is: 5'-GGACGGTAGCAAGCAAAGAGTGTG-3' and 5'-GGGATTCTGGAAGATGATGATGAC-3'.

3. The application according to claim 2, characterized in that: The miRNA expression level is the expression level in serum samples.

4. The use according to claim 1, characterized in that: The product is a detection kit.

Images