Grass carp type II reovirus antisense RNA and its recombinant vector, kit and application

Abstract

The present invention provides a grass carp type II reovirus antisense RNA and a recombinant vector, a kit and an application thereof, and belongs to aquatic animal biological breeding. The present invention provides a grass carp type II reovirus antisense RNA composition, and the nucleotide sequence is as shown in SEQ ID NO:1 to SEQ ID NO:4. The present invention can efficiently target the reovirus gene by designing the antisense RNA of the reovirus, and effectively inhibit the replication of the reovirus. The present invention also provides an anti-reovirus transfection kit, which uses an osmotic pressure liposome transfection system to complete the transfection operation before egg fertilization. The product provided by the present invention has high operability and can be mass-produced with grass carp seedlings resistant to type II reovirus.

Description

Technical Field

[0001] The invention belongs to aquatic animal biological breeding, and specifically relates to grass carp type II reovirus antisense RNA and a recombinant vector, a kit and application thereof. Background Art

[0002] Grass carp (Ctenopharyngodon idella) is the most important freshwater economic fish in my country, ranking first among freshwater aquaculture fish. However, grass carp hemorrhagic disease caused by grass carp reovirus (GCRV) seriously hinders the healthy development of aquaculture and causes significant economic losses to farmers.

[0003] Reovirus belongs to the genus Aquareovirus. It is a double-stranded RNA virus with a size of 70 to 80 nm. Its particles are icosahedral symmetric, with two layers of capsid on the outer layer and no capsule. Reovirus is divided into three genotypes: type I, type II and type III. At present, the more commonly used methods for grass carp to resist type II reovirus mainly include vaccine injection and oral vaccine. The vaccine injection method mainly injects vaccines into 2-year-old grass carp to give grass carp more than 13 months of immunity. Although the implementation of the injection immunization method is safe, reliable and effective for disease prevention, it is cumbersome and labor-intensive, and the injection cost of each fish is more than 0.1 yuan. The oral vaccine method is mainly aimed at small-sized fish species under 1 year old. It improves the ability of grass carp to resist type II reovirus by soaking or mixing feed. Although the operation is simple, the effect is limited and it requires repeated treatments, which is time-consuming.

[0004] RNA interference refers to the ability of synthetic antisense RNA sequences to complement mRNA, which can interfere with the translation and post-transport processing of mRNA of related genes, thereby achieving functional inhibition of target genes. Unfortunately, however, there are currently no reports of antisense RNA that can effectively inhibit reovirus infection. Summary of the invention

[0005] In view of this, the object of the present invention is to provide a grass carp type II reovirus antisense RNA, which can efficiently target the grass carp type II reovirus genome, has a good protective effect on grass carp type II reovirus infection, and enables aquatic animals to have a more effective ability to inhibit virus proliferation.

[0006] The invention provides a grass carp type II reovirus antisense RNA composition, comprising antisense RNA 1 with a nucleotide sequence as shown in SEQ ID NO: 1, antisense RNA 2 with a nucleotide sequence as shown in SEQ ID NO: 2, antisense RNA 3 with a nucleotide sequence as shown in SEQ ID NO: 3, and antisense RNA 4 with a nucleotide sequence as shown in SEQ ID NO: 4.

[0007] The invention provides a recombinant vector, which is a DNA sequence corresponding to different antisense RNAs in the grass carp type II reovirus antisense RNA composition contained in one or more skeleton vectors.

[0008] Preferably, the cloning site of the DNA sequence is XhoⅠ / XbaⅠ;

[0009] Preferably, the recombinant vector further comprises a T7 promoter sequence and a CMV promoter enhancer sequence.

[0010] The present invention provides a DNA composition, comprising a DNA fragment 1 with a nucleotide sequence as shown in SEQ ID NO:9, a DNA fragment 2 with a nucleotide sequence as shown in SEQ ID NO:10, a DNA fragment 3 with a nucleotide sequence as shown in SEQ ID NO:11, and a DNA fragment 4 with a nucleotide sequence as shown in SEQ ID NO:12.

[0011] The present invention provides a transfection kit for resisting grass carp type II reovirus, comprising any one of the following components:

[0012] 1) the DNA composition and the transfection reagent;

[0013] 2) the recombinant vector, specific amplification primers and transfection reagent;

[0014] The specific amplification primers include a forward primer with a nucleotide sequence as shown in SEQ ID NO: 13 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO: 14.

[0015] Preferably, it also includes a grass carp type II reovirus infection detection reagent.

[0016] Preferably, the grass carp type II reovirus infection detection reagent includes grass carp type II reovirus VP7 gene qPCR primers;

[0017] The grass carp type II reovirus VP7 gene qPCR primers include a forward primer with a nucleotide sequence as shown in SEQ ID NO:15 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO:16.

[0018] The present invention provides application of the grass carp type II reovirus antisense RNA composition, the recombinant vector, the DNA composition or the transfection kit against grass carp type II reovirus in aquaculture.

[0019] Preferably, the application includes application in preparing products resistant to grass carp type II reovirus infection and / or application in breeding grass carp varieties resistant to type II reovirus.

[0020] The present invention provides a grass carp type II reovirus antisense RNA composition, comprising antisense RNA 1 with a nucleotide sequence as shown in SEQ ID NO: 1, antisense RNA 2 with a nucleotide sequence as shown in SEQ ID NO: 2, antisense RNA 3 with a nucleotide sequence as shown in SEQ ID NO: 3, and antisense RNA 4 with a nucleotide sequence as shown in SEQ ID NO: 4. The present invention designs four antisense RNAs using grass carp type II reovirus VP2 gene (KM880066.1), VP4 gene (GQ896337.1), and VP56 gene (MT548850.1) as target genes, respectively. Experimental verification has shown that the antisense RNA has efficient targeting, and is transfected into fish eggs in the form of DNA. The fry obtained by artificial insemination show strong resistance to grass carp type II reovirus. The results show that the antisense RNA composition provided by the present invention has a protection rate of more than 37% for grass carp against grass carp type II reovirus infection, and the grass carp type II reovirus infection dose that can be tolerated is relatively high, which indicates that the antisense RNA composition greatly improves the tolerance of aquatic animals to reovirus. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 This is a diagram of the insertion site and sequence information of the antisense RNA; the red horizontal line is marked as the T7 promoter, and the purple horizontal line is marked as the CMV promoter enhancer;

[0022] Figure 2 This is the electrophoresis diagram of the PCR amplification results of the recombinant vector. DETAILED DESCRIPTION

[0023] The invention provides a grass carp type II reovirus antisense RNA composition, comprising antisense RNA 1 with a nucleotide sequence as shown in SEQ ID NO: 1, antisense RNA 2 with a nucleotide sequence as shown in SEQ ID NO: 2, antisense RNA 3 with a nucleotide sequence as shown in SEQ ID NO: 3, and antisense RNA 4 with a nucleotide sequence as shown in SEQ ID NO: 4.

[0024] In the present invention, the antisense RNA composition is designed based on the grass carp type II reovirus gene as the target gene, the antisense RNA1 is designed with the grass carp type II reovirus VP2 gene (KM880066.1) as the template, the antisense RNA2 is designed with the grass carp type II reovirus VP4 gene (GQ896337.1) as the template, and the antisense RNA3 and antisense RNA4 are both designed with the grass carp type II reovirus VP56 gene (MT548850.1) as the template.

[0025] In the present invention, the nucleotide sequence of DNA fragment 1 corresponding to the antisense RNA 1 is shown in SEQ ID NO: 5. The nucleotide sequence of DNA fragment 2 corresponding to the antisense RNA 2 is shown in SEQ ID NO: 6. The nucleotide sequence of DNA fragment 3 corresponding to the antisense RNA 3 is shown in SEQ ID NO: 7. The nucleotide sequence of DNA fragment 4 corresponding to the antisense RNA 4 is shown in SEQ ID NO: 8.

[0026] The invention provides a recombinant vector, which is a DNA sequence corresponding to different antisense RNAs in the grass carp type II reovirus antisense RNA composition contained in one or more skeleton vectors.

[0027] In the present invention, the recombinant vector includes four backbone vectors in which DNA sequences corresponding to four different antisense RNAs in the reovirus antisense RNA composition are respectively inserted at the same cloning site. The cloning site of the DNA sequence is preferably XhoⅠ / XbaⅠ; the recombinant vector also preferably comprises a T7 promoter sequence and a CMV promoter enhancer sequence. The backbone vector of the recombinant vector is preferably pcDNA3.1. The present invention has no special restrictions on the construction method of the recombinant vector, and the construction method of the recombinant vector well known in the art can be used, such as homologous recombination or gene synthesis.

[0028]

[0029] In the present invention, the DNA fragment 1, DNA fragment 2, DNA fragment 3 and DNA fragment 4 are PCR products obtained by amplifying the recombinant vectors containing antisense RNA 1, antisense RNA 2, antisense RNA 3 and antisense RNA 4 respectively as templates using specific amplification primers. The specific amplification primers include a forward primer with a nucleotide sequence as shown in SEQ ID NO: 13 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO: 14.

[0030] The present invention provides a transfection kit for resisting grass carp type II reovirus, comprising any one of the following components:

[0031] 1) the DNA composition and the transfection reagent;

[0032] 2) The recombinant vector, specific amplification primers and transfection reagent.

[0033] In the present invention, the molar ratio of DNA fragment 1, DNA fragment 2, DNA fragment 3 and DNA fragment 4 in the DNA composition is preferably 0.8-1.2:0.8-1.2:0.8-1.2:0.8-1.2, more preferably 1:1:1:1. The molar ratio of the recombinant vector is preferably 0.8-1.2:0.8-1.2:0.8-1.2:0.8-1.2, more preferably 1:1:1:1. The specific amplification primer sequence is as described in the above scheme and will not be repeated here.

[0034] In the present invention, the transfection reagent is preferably Lipofectamine TM LTX reagent was purchased from Thermo Fisher Scientific, catalog number 15338500. The transfection reagent is used to transfect the DNA composition into eggs of aquatic animals.

[0035] In the present invention, the kit preferably also includes a grass carp type II reovirus infection detection reagent, saline and glucose. The saline and glucose are used to prepare a transfection solution. The salinity of the saline is 10‰ to 14‰, more preferably 12‰. Prepare the transfection system according to the following method: first, dissolve 30g to 70g of glucose (preferably 50g of glucose) in 1L of double distilled water to prepare a 30g / L to 70g / L glucose solution (preferably 50g / L glucose solution); TMLTX and glucose solution are mixed in a volume ratio of 1:2 to construct a mixed transfection reagent. The mixed transfection reagent is dissolved in 10‰ to 14‰ saline to obtain a transfection reagent. The volume ratio of the mixed transfection reagent and 10‰ to 14‰ saline is 0.1:(2-4), more preferably 0.1:2. The grass carp type II reovirus infection detection reagent preferably includes grass carp type II reovirus VP7 gene qPCR primers. The grass carp type II reovirus VP7 gene qPCR primers include a forward primer with a nucleotide sequence as shown in SEQ ID NO:15 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO:16. The grass carp type II reovirus infection detection reagent is used to detect the infection of grass carp type II reovirus in aquatic animals after transfection.

[0036] The present invention provides application of the grass carp type II reovirus antisense RNA composition, the recombinant vector, the DNA composition or the transfection kit against grass carp type II reovirus in aquaculture.

[0037] In the present invention, the application preferably includes application in preparing products resistant to grass carp type II reovirus infection and / or application in breeding grass carp varieties resistant to grass carp type II reovirus.

[0038] The grass carp type II reovirus antisense RNA and its recombinant vector, kit and application provided by the present invention are described in detail below in conjunction with the examples, but they should not be construed as limiting the scope of protection of the present invention.

[0039] Example 1

[0040] Selection and sequence design of antisense RNA for grass carp type Ⅱ reovirus

[0041] The target genes of the antisense RNA expression sequence include three grass carp type II reovirus genome sequences with clear functional annotations, namely grass carp type II reovirus VP2 gene (KM880066.1), VP4 gene (GQ896337.1) and VP56 gene (MT548850.1).

[0042] The antisense RNA sequence was designed as follows:

[0043] The GCRVⅡ type_VP2 / KM880066.1 gene encodes a structural protein with a length of 1273 amino acids and a molecular weight of 142.6KDa. It is the RNA-dependent RNA polymerase of the virus. The mRNA sequence includes 1 exon and a CAGAAAAA sequence. The sequence of the antisense RNA1 is as follows:

[0044] AUCAUUGUCAUUUAUGUCUUUCUCGCCUCUGAGAAAGGGUAUGAAAUCGCGUAGUGAUUGAGAGAGGCCUUGGUACACAUGGUCCAUCAUCAGAA (SEQ ID NO: 1);

[0045] The DNA sequence of antisense RNA1 is as follows:

[0046] ATCATTGTCATTTATGTCTTTCTCGCCTCTGAGAAAGGGTATGAAATCG CGTAGTGATTGAGAGAGGCCTTGGTACACATGGTCCATCATCAGAA (SEQ ID NO: 5).

[0047] GCRV type II_VP4 / GQ896337.1 is the main outer capsid protein of the virus, accounting for about half of the total weight of the virus protein, and plays an important role in the cell invasion and assembly of the virus. The sequence of antisense RNA2 is as follows: UAGAGUUGCUGGAGGACUGCUACGACAGAGAGUCAUGGACAAAUUA GCGCGAUACUGGCCUCCUCCGUCUUAGGUCGUGUACACCGACCCCCGCU UU (SEQ ID NO: 2);

[0048] The DNA sequence of antisense RNA2 is as follows: TAGAGTTGCTGGAGGACTGCTACGACAGA GAGTCATGGACAAATTAGCGCGATACTGGCCTCCTCCGTCTTAGGTCGTGT ACCGACCCCCGCTTT (SEQ ID NO: 6).

[0049] GCRV type II_VP56 / MT548850.1 is the main structural protein of the virus. The only protruding protein on its outer capsid may play a core role in the virus invasion stage. The sequence of antisense RNA3 is as follows: CUGCCAACUGCGGUACCUCACUGGAGCCAGCACGCACUUUACUUACAGC AAAUUACCGUCCAAUGCACAUUACGCAGACCAGCCCACUCAUACUCAUC A (SEQ ID NO: 3);

[0050] The DNA sequence of antisense RNA3 is as follows:

[0051] CTGCCAACTGCGGTACCTCACTGGAGCCAGCACGCACTTTACTTACAGC

[0052] AAATTACCGTCCAATGCACATTACGCAGACCAGCCCACTCATACTCATCA

[0053] (SEQ ID NO:7).

[0054] The sequence of GCRV type II_VP56 / MT548850.1 antisense RNA4 is as follows: GUAUCUUUGCUU CAUCUAAAGUUGUGGAGUAUGCGAGAAUUAGGGCGAUAACGUGCUCUG UAGUCAUGCGGCUGUCACGAGUGGCCAUCUUG (SEQ ID NO: 4);

[0055] The DNA sequence of antisense RNA4 is as follows:

[0056] GTATCTTTGCTTCATCTAAAGTTGTGGAGTATGCGAGAATTAGGGCGAT AACGTGCTCTGTAGTCATGCGGCTGTCACGAGTGGCCATCTTG (SEQ ID NO: 8).

[0057] Example 2

[0058] Construction of a recombinant vector containing CyHV-2 virus antisense RNA

[0059] The four antisense RNA sequences designed in Example 1 were sent to Yixin Biotechnology (Shanghai) Co., Ltd. for gene synthesis. The recombinant expression vector was constructed using the pcDNA3.1 plasmid as the backbone vector, and the four antisense RNA sequences were cloned between the sites of XhoⅠ and XbaⅠ. The expression vector contained the T7 promoter and the CMV promoter enhancer. Figure 1 .

[0060] Example 3

[0061] PCR amplification of recombinant vector

[0062] Design a pair of specific primers to perform PCR amplification on the constructed expression vector (PolyAF1: GGAGGTCGCTGAGTAGTGCGCG, SEQ ID NO: 13; reverse primer polyAR1: CTGCGCGTAACCACCACACCCG, SEQ ID NO: 14). The reaction system is 20 μL, as shown in Table 1:

[0063] Table 1 PCR amplification antisense program

[0064] Ex-Taq enzyme 10μL Template (plasmid) 1μL Primer F1 / R1 1μL RNA-free water 8μL total 20μL

[0065] The amplification procedure was: 95°C pre-denaturation for 3 min, 30 cycles (95°C denaturation for 30 s, 50°C annealing for 30 s, 72°C extension for 2 min); 72°C extension for 5 min. The 4 groups of PCR products were mixed evenly at a ratio of 1:1:1:1 and then the PCR amplification effect was detected by gel electrophoresis ( Figure 2 ). Finally, the mixed PCR products were stored at 4°C for later use.

[0066] The PCR product fragment size of the recombinant vector after amplification with specific primers should be around 1100 bp. From the agarose gel electrophoresis diagram, it can be seen that there are obvious bands between 1000 bp and 2000 bp, indicating that the amplification effect is effective.

[0067] Example 4

[0068] Construction of grass carp strains resistant to grass carp reovirus type Ⅱ

[0069] 1. Preparation of transfection reagent

[0070] Prepare 14‰ saline by adding 14g sodium chloride per 1000mL deionized water. TM LTX reagent (Thermo Fisher Scientific, catalog number 15338500) and 50g / L glucose solution were dissolved in 14‰ saline at a volume ratio of 1:2. Each 100μL transfection reagent system was dissolved in 2mL 14‰ saline. The pH of the transfection reagent was adjusted to 6.4-6.8 with phosphate buffer to maintain weak acidity. After the transfection reagent was prepared, it was stored in a refrigerator at 4℃ for later use.

[0071] 2. Transfection of PCR Amplification Products

[0072] Add 20μL of different combinations of PCR product mixtures to each 1mL transfection reagent, Experiment 1: antisense RNA sequence 1 and antisense RNA sequence 2 (1:1); Experiment 2: antisense RNA sequence 1, antisense RNA sequence 2 and antisense RNA sequence 3 (1:1:1); Experiment 3: antisense RNA sequence 2 and antisense RNA sequence 3 (1:1); Experiment 4: antisense RNA sequence 1, antisense RNA sequence 2, antisense RNA sequence 3 and antisense RNA sequence 4 (1:1:1:1), and place in -20℃ freezer for later use. Take out half an hour in advance to equilibrate to room temperature before use. Select sexually mature female grass carp and gently squeeze the abdomen to collect eggs. Add 2mL~4mL of transfection solvent containing PCR amplification products for every 10,000 grass carp eggs. Preferentially use a 4L plastic basin, squeeze in about 100,000 grass carp eggs, and add 20~30mL of transfection solvent containing PCR amplification products. Gently shake for 4-6min to complete the egg transfection operation of PCR amplification products. At the same time, an experimental group 5 without adding reagents was prepared as a control group.

[0073] 3. Artificial insemination and hatching

[0074] Select male grass carp with well-developed gonads, gently squeeze the abdomen, add 0.2-0.5 mL of semen for every 10,000 grass carp eggs, continue shaking for 30 seconds, add water and shake for another 30 seconds to complete the entire fertilization process. Pour the fertilized eggs into the hatching bucket for incubation. Place 10,000-20,000 fertilized eggs per 1L of water, control the water temperature at 23℃-26℃, and the water flow rate at 0.8-1.5L / min. The hatching bucket is conical, with an outlet on the upper side. The water inlet pipe is located at the upper end of the hatching bucket, and a pipe is used to connect the water outlet at the bottom of the hatching bucket to ensure that the fertilized eggs are fully rolled with the water flow and the dissolved oxygen is sufficient. The hatched fry can be collected after 120 hours.

[0075] 4. Detection of the ability of grass carp to resist grass carp type II reovirus

[0076] Collect newly hatched fry at a rate of 5,000 fry / m 3 The density of the water body is placed on 5 2m 3 Cultivate in cement pools of water bodies. When the fish grow to 3-4 cm, place them in 5 1-acre earthen ponds for breeding, with a density of 3,500 fish / acre, and breed for 180 days. 30 fish were randomly selected from each experimental group, and 0.1 mL of grass carp type II reovirus tissue fluid was injected intraperitoneally for every 50 g of fish body weight for artificial infection test. Continue for 10 days and observe the disease status of grass carp. Calculate the mortality rate of grass carp after infection according to the following formula I.

[0077] Mortality rate (%) = number of dead grass carp / number of grass carp at the beginning of the experiment × 100 Formula I

[0078] Table 2 Results of grass carp mortality in each group

[0079] Experimental Group 1 Experimental Group 2 Experimental Group 3 Experimental Group 4 Control group Mortality rate after infection (%) <![CDATA[70 b ]]> <![CDATA[63.3 b ]]> <![CDATA[66.7 b ]]> <![CDATA[53.3 c ]]> <![CDATA[93.3 a ]]>

[0080] Note: Different lowercase letters indicate significant differences (P<0.05).

[0081] The results showed that transfection with different antisense RNA combinations had a significant effect on the mortality of grass carp infected with grass carp type II reovirus (P<0.05). The antisense RNA combination of experimental group 4 can significantly improve the survival rate of grass carp after grass carp type II reovirus infection. Therefore, in subsequent experiments, the combination of antisense RNA sequence 1, antisense RNA sequence 2, antisense RNA sequence 3 and antisense RNA sequence 4 in experiment 4 is preferred to prepare grass carp experimental fish resistant to grass carp type II reovirus.

[0082] Application Example 1

[0083] In a fish farm in Wuxi, Jiangsu, six 0.3m 2 plastic breeding barrels, of which 3 were used to breed grass carp for the anti-grass carp type II reovirus experiment, with 20 fish in each barrel, and the fish size was about 50g; the other 3 were used to breed grass carp that had not been treated with anti-grass carp type II reovirus (control group), with 20 fish in each barrel, and the fish size was about 50g. After 7 days of temporary breeding, 0.1mL of grass carp type II reovirus tissue fluid was injected intraperitoneally for every 50g of fish body weight for artificial infection test. The disease status of grass carp was observed for 10 days. The mortality rate and protection rate of grass carp after infection were calculated according to the following formula II and formula III respectively.

[0084] Mortality rate (%) = number of dead grass carp / number of grass carp at the beginning of the experiment × 100 Formula II

[0085] Protection rate (%) = (mortality rate of control group - mortality rate of experimental group) / mortality rate of control group × 100 Formula III Table 3 Mortality rate of grass carp infected with grass carp type II reovirus in experimental group and control group

[0086]

[0087] Note: “*” indicates significant difference.

[0088] The grass carp in the experimental group had a good protection rate in the artificial infection test of type II reovirus. The test results showed that the mortality rate of the control group was 95%; the mortality rate of the experimental group was 41.67%. There was a significant difference between the two groups, and the effective protection rate of the experimental group reached 56%.

[0089] Application Example 2

[0090] In a fish farm in Suzhou, Jiangsu, two 3-mu breeding ponds were selected. One of the ponds was used to stock 3,000 grass carps with anti-grass carp type II reovirus test as the experimental group, with a fish size of about 120g; the other pond was used to stock 3,000 grass carps that were not treated with anti-grass carp type II reovirus as the control group, with a size of about 120g. The experimental group and the control group were fed with fully matured freshwater fish compound feed (28% protein, 6% fat) produced by Ningbo Tianbang Feed Technology Co., Ltd. respectively. The fish were fed once at 7:00 in the morning and 17:00 in the afternoon, and the feeding amount was 6% of the fish body weight. The breeding cycle was 30 days. After the breeding experiment, 60 fish were randomly selected from each pond and divided into 3 parallels, with 20 fish in each parallel. According to the intraperitoneal injection of 0.2mL grass carp type II reovirus tissue fluid per 100g fish body weight, an artificial infection test was carried out. The disease status of grass carp was observed for 10 days.

[0091] Table 4 Mortality of grass carp infected with grass carp type II reovirus in the experimental and control groups after 30 days of pond culture

[0092]

[0093] Note: “*” indicates significant difference.

[0094] The grass carp in the experimental group had a very good protection rate in the artificial infection experiment of grass carp type II reovirus. The test results showed that the mortality rate of the control group was 81.67%; the mortality rate of the experimental group was 43.33%. There was a significant difference between the two groups, and the effective protection rate of the experimental group reached 47%.

[0095] Application Example 3

[0096] In a fish farm in Dafeng, Jiangsu, six 2-mu breeding ponds were selected. Three of the ponds were stocked with 2,000 grass carp fingerlings resistant to grass carp type II reovirus as the experimental group, with a body size of about 50g; the other three ponds were not treated with grass carp type II reovirus as the control group, and each pond was also stocked with 2,000 grass carp fingerlings, with a body size of about 50g. The experimental group and the control group were fed with fully matured freshwater fish compound feed (protein 28%, fat 6%) produced by Ningbo Tianbang Feed Technology Co., Ltd. respectively. The feed was fed once at 7:00 in the morning and 17:00 in the afternoon, and the feeding amount was 5% of the fish body weight. The breeding cycle was 100 days. After the breeding experiment, 20 grass carps were randomly selected from each pond and divided into 3 parallel groups, including 60 fish in the control group and 60 fish in the experimental group. According to the intraperitoneal injection of 0.2mL grass carp type II reovirus tissue fluid per 100g fish body weight, an artificial infection test was carried out. The disease status of grass carp was observed for 10 days.

[0097] Table 5 Mortality of grass carp infected with grass carp type Ⅱ reovirus in the experimental group and the control group after 100 days of pond culture

[0098]

[0099] Note: “*” indicates significant difference.

[0100] The grass carp in the experimental group had a good protection rate in the artificial infection experiment with grass carp type II reovirus. The test results showed that the mortality rate of the control group was 85.00%; the mortality rate of the experimental group was 53.33%. There was a significant difference between the two groups, and the effective protection rate of the experimental group reached 37%.

[0101] At the same time, the present invention also carries out a grass carp type II reovirus infection status detection experiment, and the specific steps are as follows:

[0102] RT-PCR primers (F: 5'-CCATGACACTCACGCACACG-3', SEQ ID NO: 15; R: 5'-GGCAAGCGAAGGTCAGGTTG-3', SEQ ID NO: 16) were designed with grass carp type II reovirus VP7 gene (GeneBank No.: KM880071.1) as the target gene. The primers were synthesized by Yixin Biotechnology (Shanghai) Co., Ltd.

[0103] Six grass carps in the experimental group and the control group that were dying after artificial injection infection were taken, and 40-80 mg of spleen, hepatopancreas, muscle and head kidney tissues were taken and placed in 800 μL TRIzol (Invitrogen) for homogenization. Total RNA was extracted and detected according to the instructions, reverse transcribed into cDNA, and stored at -20°C. VP7 quantitative primers were designed and synthesized using Primerpremier 6 software. The annealing temperature of each primer was 60°C, and 18S rRNA was used as an internal reference gene. The reverse transcription product was used as a template and the corresponding primers were used for qRT-PCR. The reaction system was 15 μL, specifically containing 7.5 μL of 2×SYBR Green BioEasy MasterMix, 2 μL of cDNA, 5.1 μL of sterile ultrapure water, and 0.2 μL of upstream and downstream primers. The reaction program was 95°C pre-denaturation for 1 min, 94°C denaturation for 15 s, 60°C annealing for 15 s, and 72°C extension for 20 s, for a total of 40 cycles.

[0104] Table 6 Quantitative detection results of viral genes in various tissues of grass carp after infection with grass carp type II reovirus

[0105]

[0106] Note: Different lowercase letters indicate significant differences.

[0107] After grass carp type II infection, the gene expression levels in the head and kidney of the treated and control groups were high, but the expression level of the virus gene in the control group was 2.76 times that of the experimental group; the virus expression levels in the spleen and muscle were low, and the expression levels of the virus gene in the control group were 3 times and 1.54 times that of the experimental group, respectively. Based on the above results, the experimental fish in the anti-reovirus treatment group may have a more effective ability to inhibit virus proliferation.

[0108] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A grass carp type II reovirus antisense RNA composition, characterized in that: It includes antisense RNA 1 with a nucleotide sequence as shown in SEQ ID NO: 1, antisense RNA 2 with a nucleotide sequence as shown in SEQ ID NO: 2, antisense RNA 3 with a nucleotide sequence as shown in SEQ ID NO: 3, and antisense RNA 4 with a nucleotide sequence as shown in SEQ ID NO:

4.

2. A recombinant vector, characterized in that: One or more backbone vectors contain DNA sequences corresponding to different antisense RNAs in the grass carp type II reovirus antisense RNA composition according to claim 1.

3. The recombinant vector according to claim 2, characterized in that: The cloning site of the DNA sequence is XOt Ⅰ / XB Ⅰ.

4. The recombinant vector according to claim 2, characterized in that: The recombinant vector also comprises a T7 promoter sequence and a CMV promoter enhancer sequence.

5. A DNA composition, characterized in that It includes a DNA fragment 1 with a nucleotide sequence as shown in SEQ ID NO:9, a DNA fragment 2 with a nucleotide sequence as shown in SEQ ID NO:10, a DNA fragment 3 with a nucleotide sequence as shown in SEQ ID NO:11, and a DNA fragment 4 with a nucleotide sequence as shown in SEQ ID NO:

12.

6. A transfection kit for resisting grass carp type II reovirus, characterized in that: Any combination of the following components: 1) The DNA composition and transfection reagent according to claim 5; 2) The recombinant vector, specific amplification primer and transfection reagent according to any one of claims 2 to 4; The specific amplification primers include a forward primer with a nucleotide sequence as shown in SEQ ID NO: 13 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO:

14.

7. The transfection kit for resisting grass carp type II reovirus according to claim 6, characterized in that: Also included is a grass carp type II reovirus infection detection reagent.

8. The transfection kit for resisting grass carp type II reovirus according to claim 7, characterized in that: The grass carp type II reovirus infection detection reagent includes grass carp type II reovirus VP7 gene qPCR primers; The grass carp type II reovirus VP7 gene qPCR primers include a forward primer with a nucleotide sequence as shown in SEQ ID NO:15 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO:

16.

9. Use of the grass carp type II reovirus antisense RNA composition of claim 1, the recombinant vector of any one of claims 2 to 4, the DNA composition of claim 5, or the anti-grass carp type II reovirus transfection kit of any one of claims 6 to 8 in aquaculture, The application includes application in preparing products resistant to grass carp type II reovirus infection and / or application in breeding grass carp varieties resistant to type II reovirus.

Images