A crRNA or crRNA combination and its application

Abstract

The present invention belongs to the field of biological detection technology, and specifically relates to a crRNA or crRNA combination and its application, especially in the detection of Pneumocystis. The crRNA or crRNA combination targets Pneumocystis (such as Pneumocystis jiroveci) and can be used for rapid detection of Pneumocystis. The use of crRNA or crRNA combination for the detection of Pneumocystis has the advantages of high accuracy, high sensitivity, good specificity, fast, convenient and low cost of molecular diagnosis, which is conducive to the promotion of primary medical institutions.

Description

Technical Field

[0001] The present invention belongs to the field of biological detection technology, and specifically relates to a crRNA or a crRNA combination and an application thereof, especially an application in detecting Pneumocystis. Background Art

[0002] Pneumocystis jiroveci pneumonia ( Pneumocystis jirovecii Pneumocystis pneumonia (PJP) is a fatal fungal lung infection caused by Pneumocystis jirovecii in immunocompromised populations. It is common in immunocompromised populations such as AIDS patients, organ transplant patients, tumor patients, and autoimmune disease patients, with a mortality rate of 27-50%. In recent years, due to the widespread use of prevention and antiretroviral therapy, the infection rate and mortality rate of PJP in HIV populations have dropped significantly, but the incidence and mortality rate are increased in organ transplant patients, tumor patients, autoimmune disease patients, and patients using CD20 antibodies and BTK drugs. Early and accurate diagnosis is the key to improving the clinical outcome of Pneumocystis jirovecii infection, which can effectively reduce mortality and save medical expenses.

[0003] The diagnosis of PJP relies on comprehensive judgment of clinical symptoms, imaging and pathogen detection. The patient's signs, symptoms and imaging characteristics are non-specific and can easily be mistaken for bacterial or viral infection. However, the current pathogen detection technology also has limitations that can easily lead to delayed diagnosis. At present, it is difficult to successfully culture Pneumocystis jirovecii in vitro. Finding the trophozoites of Pneumocystis jirovecii under microscopy is considered the "gold standard". Although it has good specificity, it requires high technical personnel, especially when the infection load is low, the trophozoites of Pneumocystis jirovecii can be easily missed under the microscope. 1-3-β-glucan is a serum marker for Pneumocystis jirovecii infection, but its specificity is low and there is no diagnostic threshold, which limits its application in clinical practice. Immunofluorescence staining has higher sensitivity and specificity than traditional staining, but it is far lower than molecular biological methods. At present, the molecular biological detection method of Pneumocystis jirovecii is mainly PCR, which has high accuracy, but requires specialized laboratories and expensive detection equipment, which is not conducive to popularization in primary medical institutions. Summary of the invention

[0004] In order to achieve rapid and accurate detection of Pneumocystis on site, improve the early diagnosis rate of the disease, reduce the workload of medical staff, and improve the treatment efficiency of patients. The present invention designs crRNA that specifically recognizes and targets Pneumocystis, and obtains crRNA that can work normally and has high sensitivity through screening, and further improves the detection sensitivity through the form of crRNA combination. At the same time, false negative results caused by poor binding of crRNA to the target can be prevented, and the detection time is short, and no expensive detection equipment and specialized laboratories are required. It is suitable for various types of medical institutions to perform early diagnosis of Pneumocystis pneumonia. Even more unexpectedly, the crRNA combination was applied to the detection of clinical samples with an accuracy rate of 100%. The specific scheme is as follows:

[0005] In a first aspect of the present invention, a CRISPR-derived RNA (crRNA) or a crRNA combination is provided, wherein the crRNA or the crRNA combination comprises one or more of SEQ ID NOs: 1-10, or comprises a nucleotide sequence having more than 80%, more than 85%, more than 90%, more than 95% or more identity with one or more of the nucleotide sequences in SEQ ID NOs: 1-10, or comprises a nucleotide sequence having the same or similar function as one or more of the nucleotide sequences in SEQ ID NOs: 1-10 after substitution, deletion and / or insertion of one or more nucleotides.

[0006] Preferably, the crRNA or crRNA combination includes one or more of SEQ ID NOs: 1-3 or 5-9, or includes a nucleotide sequence that is more than 80%, more than 85%, more than 90%, more than 95% or more than 99% identical to the nucleotide sequences of one or more of SEQ ID NOs: 1-3 or 5-9, or includes one or more of the nucleotide sequences of SEQ ID NOs: 1-3 or 5-9 that are substituted, deleted and / or inserted with one or more nucleotides and have the same or similar functions as one or more of SEQ ID NOs: 1-3 or 5-9.

[0007] In a specific embodiment of the present invention, the crRNA combination includes any one of the following groups:

[0008] A) SEQ ID NO: 1 and SEQ ID NO: 2;

[0009] B) SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8 and SEQ ID NO: 9;

[0010] C) SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 and SEQ ID NO: 5;

[0011] D) SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8 and SEQ ID NO: 9.

[0012] Preferably, the crRNA comprises a backbone sequence and a specific recognition sequence.

[0013] Preferably, the backbone sequence includes SEQ ID NO: 13, or a nucleotide sequence having more than 80%, more than 85%, more than 90%, more than 95% or more identity with SEQ ID NO: 13, or a nucleotide sequence including SEQ ID NO: 13 after one or more nucleotide substitutions, deletions and / or insertions and having the same or similar functions as SEQ ID NO: 13.

[0014] In a specific embodiment of the present invention, the specific recognition sequence includes one or more of SEQ ID NOs: 1-10; preferably one or more of SEQ ID NOs: 1-3 or 5-9.

[0015] In a specific embodiment of the present invention, the nucleotide sequence of the crRNA comprises a backbone sequence and a specific recognition sequence in sequence from 5' to 3'.

[0016] The crRNA can bind to the Cas protein. Preferably, the Cas protein includes Cas12a.

[0017] Preferably, the nucleotide sequence of the crRNA or crRNA combination includes one or more of SEQ ID NOs: 14-23, or includes a nucleotide sequence that is more than 80%, more than 85%, more than 90%, more than 95% or more than 99% identical to one or more of the nucleotide sequences in SEQ ID NOs: 14-23, or includes one or more of the nucleotide sequences in SEQ ID NOs: 14-23 that have been substituted, deleted and / or inserted with one or more nucleotides and have the same or similar functions as one or more of the nucleotide sequences in SEQ ID NOs: 14-23.

[0018] Further preferably, the nucleotide sequence of the crRNA or crRNA combination includes one or more of SEQ ID NOs: 14-16, 18-22, or includes a nucleotide sequence that is more than 80%, more than 85%, more than 90%, more than 95% or more than 99% identical to one or more of the nucleotide sequences in SEQ ID NOs: 14-16, 18-22, or includes one or more of the nucleotide sequences in SEQ ID NOs: 14-16, 18-22 that are replaced, deleted and / or inserted with one or more nucleotides and have the same or similar functions as one or more of SEQ ID NOs: 14-16, 18-22.

[0019] In a specific embodiment of the present invention, the nucleotide sequence of the crRNA combination includes any one of the following groups:

[0020] 1) SEQ ID NO: 14 and SEQ ID NO: 15;

[0021] 2) SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21 and SEQ ID NO: 22;

[0022] 3) SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16 and SEQ ID NO: 18;

[0023] 4) SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21 and SEQ ID NO: 22.

[0024] The crRNA or crRNA combination specifically recognizes Pneumocystis ( Pneumocystis ).

[0025] The crRNA or crRNA combination is used to detect Pneumocystis genus ( Pneumocystis ).

[0026] Preferably, the Pneumocystis genus ( Pneumocystis ) including Pneumocystis jirovecii ( Pneumocystis jirovecii ).

[0027] The second aspect of the present invention provides a crRNA-Cas complex, comprising the crRNA or crRNA combination described in the first aspect, and a Cas protein.

[0028] Preferably, the Cas protein includes Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas5d, Cas5t, Cas5h, Cas5a, Cas6, Cas7, Cas8, Cas9, Cas10, Cas12a, Cas13a, Csy1, Csy2, Csy3, Csy4, Cse1, Cse2, Cse3, Cse4, Cse5e, Csc1, Csc2, Csa5, Csn1, Csn2, Csm1, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx1S, Csf1, Csf2, CsO, Csf4, Csd1, Csd2, Cst1, Cst2, Csh1, Csh2, Csal, Csa2, Csa3, Csa4, Csa5, C2c1, C2c3, CARF, DinG, homologs thereof or modified forms thereof.

[0029] In a specific embodiment of the present invention, the Cas protein is Cas12a.

[0030] The crRNA-Cas complex specifically recognizes Pneumocystis ( Pneumocystis ).

[0031] The crRNA-Cas complex is used to detect Pneumocystis genus ( Pneumocystis ).

[0032] Preferably, the Pneumocystis genus ( Pneumocystis ) including Pneumocystis jirovecii ( Pneumocystis jirovecii ).

[0033] The third aspect of the present invention provides a primer pair, wherein the primer pair comprises:

[0034] An upstream primer comprises SEQ ID NO: 11 or a nucleotide sequence having 80% or more, 85% or more, 90% or more, 95% or more, or 99% or more identity with the nucleotide sequence of SEQ ID NO: 11, or a nucleotide sequence having one or more nucleotide substitutions, deletions, and / or insertions in the nucleotide sequence of SEQ ID NO: 11 and having the same or similar functions as SEQ ID NO: 11; and,

[0035] Downstream primer: comprising SEQ ID NO: 12, or comprising a nucleotide sequence having 80% or more, 85% or more, 90% or more, 95% or more, or 99% or more identity with the nucleotide sequence shown in SEQ ID NO: 12, or comprising a nucleotide sequence having one or more nucleotide substitutions, deletions, and / or insertions in the nucleotide sequence of SEQ ID NO: 12 and having the same or similar functions as SEQ ID NO: 12.

[0036] In a specific embodiment of the present invention, the upstream primer is shown as SEQ ID NO: 11, and the downstream primer is shown as SEQ ID NO: 12.

[0037] The primer pair specifically amplifies Pneumocystis genus ( Pneumocystis ) nucleic acid, preferably mitochondrial small subunit rRNA (mtSSU rRNA) or a fragment thereof.

[0038] The primer pair is used to amplify or detect Pneumocystis genus ( Pneumocystis ).

[0039] Preferably, the Pneumocystis genus ( Pneumocystis ) including Pneumocystis jirovecii ( Pneumocystis jirovecii ).

[0040] In a fourth aspect of the present invention, the crRNA or crRNA combination, crRNA-Cas complex and / or the primer pair described above are provided for detecting Pneumocystis genus ( Pneumocystis ) or in the preparation of a diagnosis of Pneumocystis carinii pneumonia ( Pneumocystis pneumonia) products.

[0041] Preferably, the Pneumocystis genus ( Pneumocystis ) including Pneumocystis jirovecii ( Pneumocystis jirovecii ).

[0042] Preferably, the detection of Pneumocystis includes detecting the presence, quantity or concentration of Pneumocystis (particularly Pneumocystis jirovecii).

[0043] Preferably, the diagnosis of Pneumocystis pneumonia ( Pneumocystis pneumonia) including detection of the presence, number or concentration of Pneumocystis (especially Pneumocystis jirovecii).

[0044] Preferably, the diagnosis of Pneumocystis pneumonia ( Pneumocystis pneumonia) also includes a comprehensive diagnosis based on clinical symptoms and imaging.

[0045] Preferably, the Pneumocystis pneumonia is Pneumocystis jirovecii pneumonia ( Pneumocystis jirovecii pneumonia).

[0046] Preferably, the product comprises a kit or a chip.

[0047] In a fifth aspect of the present invention, a kit or a chip is provided, wherein the kit or the chip comprises the above-mentioned crRNA or crRNA combination, and preferably further comprises a Cas protein.

[0048] Preferably, the Cas protein includes Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas5d, Cas5t, Cas5h, Cas5a, Cas6, Cas7, Cas8, Cas9, Cas10, Cas12a, Cas13a, Csy1, Csy2, Csy3, Csy4, Cse1, Cse2, Cse3, Cse4, Cse5e, Csc1, Csc2, Csa5, Csn1, Csn2, Csm1, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx1S, Csf1, Csf2, CsO, Csf4, Csd1, Csd2, Cst1, Cst2, Csh1, Csh2, Csal, Csa2, Csa3, Csa4, Csa5, C2c1, C2c3, CARF, DinG, homologs thereof or modified forms thereof.

[0049] In a specific embodiment of the present invention, the Cas protein is Cas12a.

[0050] Preferably, the kit or chip further comprises other materials required for CRISPR reaction, such as reaction buffer.

[0051] Preferably, the kit or chip further comprises a probe, and the probe comprises a fluorescent group and / or a quenching group.

[0052] Preferably, the fluorescent group includes one or more of AMC, FITC, VIC, FAM, HEX, TET, CY3, CY5 or ROX.

[0053] Preferably, the quenching group includes one or more of TAMRA, Dabcyl, BHQ1 or BHQ2.

[0054] In a specific embodiment of the present invention, the 5' end of the probe is connected to a fluorescent group, and the 3' end is connected to a quenching group. Preferably, the fluorescent group is FAM, and the quenching group is BHQ1.

[0055] Preferably, the kit or chip further comprises primers for amplification.

[0056] Preferably, the amplification includes one or more of RAA, PCR, recombinase polymerase amplification (RPA), LAMP, CPA, ERA or RCA.

[0057] In a specific embodiment of the present invention, the amplification includes the use of RPA. Preferably, the primers include SEQ ID NO: 11 and / or 12, or include a nucleotide sequence having more than 80%, more than 85%, more than 90%, more than 95% or more than 99% identity with the nucleotide sequence shown in SEQ ID NO: 11 and / or 12, or include a nucleotide sequence of SEQ ID NO: 11 and / or 12 after one or more nucleotides are substituted, deleted and / or inserted and has the same or similar function as SEQ ID NO: 11 and / or 12.

[0058] Preferably, the kit or chip further comprises reagents required for nucleic acid extraction, such as reagents required for genomic DNA extraction.

[0059] Preferably, the kit or chip further comprises other materials required for the amplification reaction, including but not limited to DNA polymerase, recombinase, single-stranded binding protein, dNTPs, enzyme stabilizer, Taq DNA polymerase, reaction buffer, bromophenol blue dye or water, one or a combination of two or more thereof.

[0060] In a specific embodiment of the present invention, the kit or chip includes reagents for RPA reaction (preferably the above-mentioned primer pair), Crispr / Cas12a detection reagents (preferably the above-mentioned crRNA or crRNA combination) and / or reagents required for nucleic acid extraction.

[0061] The reagents for the RPA reaction include, but are not limited to, DNA polymerase, recombinase, single-stranded binding protein, dNTPs, enzyme stabilizer, Taq DNA polymerase reaction buffer, bromophenol blue dye or one or a combination of two or more in water.

[0062] The reagents required for the Crispr / Cas12a detection system include but are not limited to Cas12a, reaction buffer, and probes, such as single-stranded DNA fluorescent probes (5'FAM / 3'BHQ1).

[0063] In a specific embodiment of the present invention, the kit or chip comprises the above-mentioned primer pair, crRNA or crRNA combination.

[0064] In a specific embodiment of the present invention, the kit or chip includes the above-mentioned primer pair, crRNA or crRNA combination and probe.

[0065] In a specific embodiment of the present invention, the kit or chip comprises the above-mentioned primer pair, crRNA or crRNA combination and Cas protein.

[0066] In a specific embodiment of the present invention, the kit or chip includes the above-mentioned primer pair, crRNA or crRNA combination, probe and Cas protein.

[0067] In a sixth aspect of the present invention, a method for detecting nucleic acid or Pneumocystis spp. ( Pneumocystis ), the detection method comprising using the above-mentioned crRNA or crRNA combination, or the above-mentioned crRNA-Cas complex, or the above-mentioned primer pair, or the above-mentioned kit or chip.

[0068] Preferably, the Pneumocystis genus ( Pneumocystis ) including Pneumocystis jirovecii ( Pneumocystis jirovecii ).

[0069] Preferably, the detection of Pneumocystis spp. Pneumocystis ) includes detecting the presence, quantity or concentration of Pneumocystis (especially Pneumocystis jirovecii).

[0070] Preferably, the detection method comprises:

[0071] a) Obtaining samples;

[0072] b) amplifying the nucleic acid in the sample to obtain an amplified product, preferably by RPA, and further preferably, the primers used for amplification include the primer pair described in the second aspect above;

[0073] c) adding the above-mentioned crRNA or crRNA combination, and Cas protein (such as Cas12a protein) to the amplified product for reaction, preferably further comprising adding the probe as described above.

[0074] Preferably, the sample can be from a subject (sputum, alveolar lavage fluid (such as bronchoalveolar lavage fluid) or tissue (such as lung tissue) or any surface of an object contacted by a patient infected with Pneumocystis jiroveci.

[0075] Preferably, the nucleic acid is DNA or RNA.

[0076] Preferably, the reaction temperature of the amplification is 25-50°C (eg, 25, 30, 35, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50°C).

[0077] Preferably, the reaction time of the amplification is at least 5 min, preferably 5-30 min (eg 5, 10, 15, 20, 25 or 30 min).

[0078] Preferably, the step c) is a CRISPR reaction.

[0079] Preferably, the reaction temperature of step c) is 25-50°C (eg, 25, 30, 35, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50°C).

[0080] Preferably, the reaction time of step c) is at least 5 min, preferably 5-60 min (eg 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55 or 60 min).

[0081] Preferably, the detection method further comprises fluorescence signal detection. If the fluorescence signal is detected, it is proved that Pneumocystis is contained in the sample.

[0082] Depending on the needs of the specific implementation, the detection method may or may not be used for the purpose of diagnosing a disease.

[0083] In the seventh aspect of the present invention, a method for diagnosing Pneumocystis pneumonia is provided, the method comprising using the above-mentioned crRNA or crRNA combination, or the method comprising using the above-mentioned crRNA-Cas complex, or the method comprising using the above-mentioned primer pair, or the method comprising using the above-mentioned kit or chip.

[0084] Preferably, the diagnosis of Pneumocystis pneumonia includes detecting the presence, quantity or concentration of Pneumocystis (particularly Pneumocystis jirovecii).

[0085] Preferably, the Pneumocystis pneumonia is Pneumocystis jirovecii pneumonia.

[0086] Preferably, the method comprises:

[0087] a) Obtaining samples;

[0088] b) amplifying the nucleic acid in the sample to obtain an amplified product, preferably by RPA, and further preferably, the primers used for amplification include the primer pair described in the second aspect above;

[0089] c) adding the above-mentioned crRNA (or crRNA combination) and Cas protein (such as Cas12a protein) to the amplified product for reaction, preferably further comprising adding the probe as described above.

[0090] Preferably, the sample comprises sputum, alveolar lavage fluid (such as bronchoalveolar lavage fluid) or tissue (such as lung tissue) of the subject, or any surface of an object contacted by a patient infected with Pneumocystis jiroveci.

[0091] Preferably, the nucleic acid is DNA or RNA.

[0092] Preferably, the reaction temperature of the amplification is 25-50°C (eg, 25, 30, 35, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50°C).

[0093] Preferably, the reaction time of the amplification is at least 5 min, preferably 5-30 min (eg 5, 10, 15, 20, 25 or 30 min).

[0094] Preferably, the step c) is a CRISPR reaction.

[0095] Preferably, the reaction temperature of step c) is 25-50°C (eg, 25, 30, 35, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50°C).

[0096] Preferably, the reaction time of step c) is at least 5 min, preferably 5-60 min (eg 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55 or 60 min).

[0097] Preferably, the method further comprises fluorescence signal detection. If the fluorescence signal is detected, it is proved that the sample contains Pneumocystis jiroveci and can be diagnosed as Pneumocystis pneumonia.

[0098] Preferably, the diagnosis of Pneumocystis pneumonia also includes a comprehensive diagnosis combining clinical symptoms and imaging.

[0099] Beneficial effects of this application:

[0100] In the prior art, the etiological diagnosis of Pneumocystis jiroveci is analyzed using mitochondrial large subunit rRNA (mtLSUrRNA), while the present application chooses to design crRNA based on mitochondrial small subunit rRNA (mtSSU rRNA). The crRNA5-crRNA14 obtained after screening have high sensitivity and specificity. Furthermore, when the screened multiple crRNAs are used in combination (especially when crRNA5 and crRNA6 are used in combination), the sensitivity can reach 0.8pM or even lower. It is also found that the use of only two crRNAs not only does not cause mutual interference between crRNAs, but also prevents false negative test results caused by off-target effects.

[0101] The terms “comprising” or “including” described in the present invention are open-ended terms. When used to describe a protein or nucleic acid sequence, the protein or nucleic acid may be composed of the sequence, or may have additional amino acids or nucleotides at one or both ends of the protein or nucleic acid, but still have the same or similar activity as the original sequence.

[0102] The "subject" described in the present invention can be a human or a non-human mammal, and the non-human mammal can be a wild animal, a zoo animal, an economic animal, a pet, an experimental animal, etc. Preferably, the non-human mammal includes but is not limited to pigs, cattle, sheep, horses, donkeys, foxes, raccoon dogs, minks, camels, dogs, cats, rabbits, mice (such as rats, mice, guinea pigs, hamsters, gerbils, chinchillas, squirrels) or monkeys, etc.

[0103] The "and / or" described in the present invention includes all combinations of items connected by the term, and each combination should be deemed to have been listed separately herein. For example, "A and / or B" includes "A", "A and B" and "B". For another example, "A, B and / or C" includes "A", "B", "C", "A and B", "A and C", "B and C" and "A and B and C".

[0104] The term "diagnosis" as used herein refers to finding out whether a patient suffers from a disease or illness. BRIEF DESCRIPTION OF THE DRAWINGS

[0105] Figure 1 : This application crRNA screening;

[0106] Figure 2 :Detection sensitivity test of crRNA in this application;

[0107] Figure 3 : crRNA combination sensitivity test;

[0108] Figure 4 :RPA-Crispr / cas12a detection results of Pneumocystis jiroveci;

[0109] Figure 5 : RPA detection time optimization results;

[0110] Figure 6 :Sensitivity test of the RPA-Crispr / cas12a detection method based on crRNAs of this application;

[0111] Figure 7 :Specificity test of the RPA-Crispr / cas12a detection method based on crRNAs of this application. DETAILED DESCRIPTION

[0112] The present invention is further described below in conjunction with the accompanying drawings and specific examples. These examples are only used to illustrate the present invention and are not intended to limit the scope of the present invention. The experimental methods in the following examples that do not specify specific conditions are usually performed according to conventional conditions in the art or according to conditions recommended by the manufacturer. Unless otherwise specified, all conventional methods are used. Unless otherwise defined, the professional and scientific terms used in the text have the same meanings as those familiar to those skilled in the art.

[0113] Single-stranded DNA fluorescent probe: purchased from Guangzhou Bolais Biotechnology Co., Ltd.

[0114] Example 1 Establishment of Pneumocystis jiroveci detection system

[0115] 1. Design and screening of crRNA

[0116] The amplification target of Pneumocystis jirovecii used in the present invention is the mitochondrial small subunit rRNA (mtSSU rRNA) of Pneumocystis jirovecii. The conservative sequence of mtSSU rRNA of Pneumocystis jirovecii was used to design 10 crRNAs (Table 1). The amplification product of the clinical sample of the patient with Pneumocystis jirovecii pneumonia was used as the template for testing crRNAs. The reaction system was 20 μL: 2 μL of 10× buffer, 100 nM crRNA, 500 nM single-stranded DNA fluorescent probe, 100 nM Cas12a, 1 μL template, and supplemented to 20 μL with ddH2O. Reaction conditions: 45°C for 1 hour, and the fluorescence value was read every 1 minute. The test results show that crRNA5 to crRNA14 can bind to the target region of Pneumocystis jirovecii, activate the exonuclease activity of Cas12a enzyme, cut off the single-stranded DNA fluorescent probe, and release a large amount of fluorescent groups, so it is used as a candidate crRNA (see Figure 1). Further, the sensitivity of crRNAs was tested by diluting the template to 200 pM, 100 pM, 50 pM, 25 pM, 12.5 pM, 6.25 pM, 6.125 pM, 3.125 pM, 1.6 pM, 0.8 pM and 0.2 pM, and crRNAs with better sensitivity were screened out (see Figure 2 ), Figure 2 It shows that crRNA5-7 and crRNA9-13 have better sensitivity, and by using crRNA in combination, it was found that the crRNA5+crRNA6 combination, crRNA10+crRNA11+ crRNA12+crRNA13 combination, crRNA5+crRNA6+crRNA7+crRNA9 combination, and crRNA5+crRNA6+ crRNA7+crRNA9+ crRNA10+crRNA11+ crRNA12+crRNA13 combination have better detection sensitivity, which can reach 0.8pM or even lower, which can fully meet clinical needs. However, although the combination of multiple crRNAs can achieve higher detection sensitivity, the use of more than three crRNAs will cause mutual interference between crRNAs (or affect the binding of crRNA to the target sequence), while the use of only two crRNAs will not cause mutual interference between crRNAs, but also prevent false negative test results caused by off-target ( Figure 3 ).

[0117] The crRNA comprises two parts: a backbone sequence and a specific recognition sequence, wherein the nucleotide sequence of the backbone sequence is shown in SEQ ID NO: 13; and the specific recognition sequence is shown in any one of SEQ ID NO: 1-10.

[0118] SEQ ID NO: 1: AAGUGGUGAACAGGUGAGUAAA

[0119] SEQ ID NO: 2: UGAAUAGAUGAGUCUAAGUGG

[0120] SEQ ID NO: 3: AGAGCCAAUGUGGUUAUUCAU

[0121] SEQ ID NO: 4: AUUAGAUAACGUCAAUAAUCCU

[0122] SEQ ID NO: 5: UGUGUGAAGGAAUUAGUAUUC

[0123] SEQ ID NO: 6: CAGCAUAAACUACAAGGGUAU

[0124] SEQ ID NO: 7: AGUCUUGCGACAGUACUUCUC

[0125] SEQ ID NO: 8: AUUCGAUAACCCACGAUAAAU

[0126] SEQ ID NO: 9:ACAACACGAACUAAAGACAGC

[0127] SEQ ID NO: 10: CGUUCGUUAGCGGAAUAAACC

[0128] SEQ ID NO: 13: UAAUUUCUACUAAGUGUAGAU

[0129] Table 1: crRNAs designed for detection of Pneumocystis jiroveci

[0130]

[0131] 2. Design of RPA primers and application of RPA-CRISPR / Cas12a technology to establish a detection method for Pneumocystis jiroveci

[0132] According to the location of the selected crRNA5 and crRNA6 and the mtSSU rRNA sequence of Pneumocystis jiroveci (GeneBank accession No: JX499143), the RPA amplification primer pair (PJ-RPA-7F and PJ-RPA-7R, see Table 2) was designed. The primer pair and the crRNA combination (crRNA5+crRNA6) designed in this application were used to test a clinical sample, with the plasmid as a positive quality control and dH2O as a negative quality control. The reaction system is as follows: the RPA reaction system includes RPAmaster mix, 400nM PJ-RPA-7F and 400nM PJ-RPA-7R, DNA template (5-50 ng), 2.5mM magnesium acetate, and the reaction conditions are 42°C for 0-30 minutes; the CRISPR reaction system includes 2μL 10×buffer, 100nM Cas12a, 50nMcrRNA5, 50nM crRNA6, 500nM single-stranded DNA fluorescent probe (5'FAM / 3'BHQ1), 1μL template (i.e., RPA product diluted 1:100), supplemented with ddH2O to 20μL, reaction conditions: 45°C for 30 minutes, and the fluorescence value is read once every minute. The results show that the detection system can detect the fluorescence signal (see Figure 4 ). Furthermore, by testing the RPA reaction time, it was found that when the RPA reaction time exceeded 15 minutes, a detection signal that could be fully distinguished could be obtained (see Figure 5 ).

[0133] Table 2. Primer and crRNA combinations for RPA-Crispr / cas12a detection of Pneumocystis jiroveci

[0134]

[0135] The 163 bp sequences amplified by PJ-RPA-F7 and PJ-RPA-R7 are as follows:

[0136] Aagtggtgaacaggtgagtaaagatagaaatctacctattcataaggttagataccttttaaaagaacaattgtttgtgaatagatgagtctaagtgggggaggtagttgtgaggtgaagatcctcccaagcctaagaaccctagttatatttgaaagaatga (SEQ ID NO: 24)

[0137] 3. Sensitivity and specificity testing

[0138] RPA reaction system (25μL), including RPA master mix, 400nM PJ-RPA-7F and 400nM PJ-RPA-7R, DNA template (5-50 ng), 2.5mM magnesium acetate, reaction conditions: 42℃ 15 minutes; CRISPER / Cas12a reaction system (20μL), including 2μL 10×buffer, 100nΜ Cas12a, 50nΜ crRNA5, 50nΜ crRNA6, 500nM single-stranded DNA fluorescent probe (5'FAM / 3'BHQ1), 1μL template (i.e., RPA product 1:100 dilution), supplemented with ddH2O to 20μL. Reaction conditions: 45℃ 30 minutes, fluorescence value read once every minute.

[0139] According to the above detection process, the analytical sensitivity of the crRNA combination was tested. The results showed that the minimum detection limit (LOD) of the detection system can reach 1 copy / reaction (see Figure 6 ). By detecting Mycobacterium tuberculosis ( Mycobacterium tuberculosis ), Klebsiella pneumoniae ( Klebsiella pneumoniae ), Pseudomonas aeruginosa ( Pseudomonas aeruginosa ), influenza virus ( Influenza virus ), cytomegalovirus ( cytomegalovirus ), Epstein-Barr virus ( Epstein barrvirus ), Escherichia coli ( Escherichia coli )、Group A Streptococcus ( Group AStreptococcus ), Neisseria spp. Neisseria ), hemolytic Staphylococcus ( Hemolytic staphylococcus )、Candida albicans( Candida albicans ), Candida glabrata ( Candida glabrata ), Enterobacter cloacae ( Enterobacter cloacae ) and Candida tropicalis ( Candida tropicalis ) DNA test specificity, the results showed no reaction, while the positive control (i.e., Pneumocystis jirovecii) showed good specificity (see Figure 7 ).

[0140] Example 2: Detection of clinical samples

[0141] 1. Selection of positive clinical samples: 39 fresh sputum samples (25 cases) and bronchoalveolar lavage fluid samples (14 cases) infected with Pneumocystis jiroveci were selected from confirmed patients;

[0142] Selection of negative clinical samples: fresh sputum (36 cases) / bronchoalveolar lavage fluid samples (8 cases) from 44 patients who were suspected of Pneumocystis jirovecii infection but were confirmed not to be infected by Pneumocystis jirovecii by etiology.

[0143] 2. Detection steps

[0144] 1) Extraction of total DNA from clinical samples of patients: DNA was extracted from fresh sputum or bronchoalveolar lavage fluid (BALF, referred to as alveolar lavage fluid) of the above patients. Sputum was pretreated with 1N NaOH (1:1 (v / v)) and alveolar lavage fluid was pretreated with 1N NaOH (2:1 (v / v)). Place at 60°C for 1 hour to ensure complete liquefaction, and then centrifuge at 8000 rpm for 5 minutes. Wash twice with saline, extract DNA using a genomic DNA extraction kit (DP305), and store at -80°C for further testing.

[0145] 2) RPA reaction system (25 μL), including RPA master mix, 400 nM PJ-RPA-7F and 400 nM PJ-RPA-7R, DNA template (5-50 ng), 2.5 mM magnesium acetate, reaction conditions: 42 °C for 15 min.

[0146] 3) CRISPER / Cas12a reaction system (20μL), including 2μL 10× buffer, 100nΜ Cas12a, 50nΜ crRNA5, 50nΜ crRNA6, 500nM single-stranded DNA fluorescent probe (5'FAM / 3'BHQ1), 1μL template (i.e. RPA reaction product), supplemented with ddH2O to 20μL. Reaction conditions: 45℃ for 30 minutes, and read the fluorescence value once every minute.

[0147] 3. Results

[0148] 83 clinical samples were tested, and the clinical diagnosis results were used as the gold standard to evaluate the detection ability of the newly established detection system in this application. The results showed that 39 positive clinical samples were tested positive using the detection method of this application, and 44 negative clinical samples were tested negative using the detection method of this application, and the consistency rate with the clinical diagnosis results was 100% (see Table 3). The clinical diagnosis criteria include clinical manifestations and imaging features of Pneumocystis jirovecii pneumonia, and the etiological diagnosis was analyzed using the mitochondrial large subunit rRNA (mtLSU rRNA) of Pneumocystis jirovecii.

[0149] Table 3. Clinical sample test results

[0150]

[0151] The preferred embodiments of the present invention are described in detail above. However, the present invention is not limited to the specific details in the above embodiments. Within the technical concept of the present invention, a variety of simple modifications can be made to the technical solution of the present invention, and these simple modifications all belong to the protection scope of the present invention.

Claims

1. A method for detecting Pneumocystis jiroveci ( Pneumocystis jirovecii ) or diagnosis of Pneumocystis jiroveci pneumonia ( Pneumocystis jirovecii pneumonia) crRNA combination and RPA amplification primer pair, characterized in that, The crRNA combination is SEQ ID NO: 14 and SEQ ID NO: 15; The RPA amplification primer pair is SEQ ID NO: 11 and SEQ ID NO:

12.

2. The crRNA combination and RPA amplification primer pair according to claim 1 are useful in detecting Pneumocystis jiroveci ( Pneumocystis jirovecii ) or in the preparation of a diagnosis of Pneumocystis jiroveci pneumonia ( Pneumocystis jirovecii pneumonia) products; in, Its use in the detection of Pneumocystis jirovecii is not for diagnostic purposes of disease.

3. A kit or a chip, characterized in that: The kit or chip comprises the crRNA combination and RPA amplification primer pair according to claim 1, and a Cas protein, wherein the Cas protein includes Cas12a.

4. The kit or chip according to claim 3, characterized in that: The kit or chip further comprises a probe; the probe comprises a fluorescent group and / or a quenching group.

5. A method for detecting nucleic acid, characterized in that: The detection method comprises using the crRNA combination and RPA amplification primer pair described in claim 1, or the kit or chip described in any one of claims 3-4; The detection method described is not for the purpose of diagnosing disease.

6. The detection method according to claim 5, characterized in that: The detection method comprises: a) Obtaining samples; b) amplifying the nucleic acid in the sample to obtain an amplification product; c) adding the crRNA combination and the RPA amplification primer pair described in claim 1, and the Cas protein to the amplified product for reaction, wherein the Cas protein includes Cas12a.

Images