Application of tomato SlSDN1 gene in regulating plant antiviral resistance and RNAi transgenic plant breeding method

Abstract

The present invention discloses an application of a tomato SlSDN1 gene in regulating plant antiviral resistance and a method for cultivating RNAi transgenic plants, wherein the virus is a tomato brown wrinkled fruit virus; and the transcript sequence of the SlSDN1 gene is shown in SEQ ID NO: 1. The present invention introduces an RNAi vector carrying a core fragment of the SlSDN1 gene into a target plant through an Agrobacterium transformation method, thereby obtaining a transgenic tomato with a tomato SlSDN1 gene knocked down. The offspring of the transgenic tomato has a normal growth state, and the phenotype does not change significantly compared with the wild type, and can significantly inhibit the infection of the tomato brown wrinkled fruit virus, and has a good antiviral effect.

Description

Technical Field

[0001] The invention relates to the technical field of genetic engineering, and in particular to the application of a tomato S1SDN1 gene in regulating plant resistance to viruses and a method for cultivating transgenic plants. Background Art

[0002] Tomato is one of the most important vegetable crops grown in my country and even in the world, with good nutritional value and economic benefits. Tomatoes are often harmed by various viral diseases throughout the growth cycle, resulting in serious yield losses and quality decline. Tomato viral diseases are difficult to prevent and control after onset and cause serious damage, which has become an important factor restricting tomato production. Tomato brown rugose fruit virus (ToBRFV) is a new species of the genus Tobacco mosaic virus. In nature, it mainly harms Solanaceae crops such as tomatoes and peppers. Infected tomato plants will not only cause leaf deformity, narrowing, and mosaic, but also cause the fruit to shrink, turn brown, and have yellow spots, greatly affecting the yield and quality of tomatoes.

[0003] At present, there are no commercial tomato varieties resistant to ToBRFV. Discovering and modifying the host factors required for infection of tomato brown wrinkled fruit virus can provide new strategies and new targets for the prevention and control of viral diseases, and accelerate the molecular breeding process for resistance to tomato brown wrinkled fruit virus.

[0004] RNA interference (RNAi) is an important defense response of plants against viral infection. Double-stranded RNA (dsRNA) from different sources can trigger RNAi and produce small interfering RNA (siRNA). RNAi technology has become an important technical means in the field of functional genomics research due to its specific and stable characteristics, and is widely used in plant antiviral applications. RNAi-induced antiviral immunity can resist infection from almost all RNA or DNA viruses. The application of RNAi in plant antiviral is mainly to induce RNA silencing by expressing dsRNA or hpRNA, thereby achieving effective resistance to viruses in plants. Summary of the invention

[0005] The first objective of the present invention is to provide an application of a tomato SlSDN1 gene in regulating plant resistance to viruses.

[0006] The second objective of the present invention is to provide a method for cultivating SlSDN1 knockdown transgenic plants resistant to tomato brown wrinkled fruit virus.

[0007] The present invention discovered that the tomato SlSDN1 gene is a susceptibility gene of the tomato brown wrinkled fruit virus. By using the Agrobacterium transformation method, an RNAi vector carrying the core fragment of the tomato SlSDN1 gene is introduced into the target plant, and the obtained SlSDN1 knockdown transgenic plant can significantly reduce the infection of the tomato brown wrinkled fruit virus and effectively control its damage.

[0008] To achieve the above purpose, the technical solution adopted by the present invention is as follows:

[0009] Application of tomato SlSDN1 gene in regulating plant resistance to viruses, wherein the virus is tomato brown wrinkled fruit virus, and the transcript sequence of the tomato SlSDN1 gene is shown in SEQ ID NO: 1. Knocking down the tomato SlSDN1 gene can resist infection by tomato brown wrinkled fruit virus.

[0010] Specifically: by constructing an RNAi vector of the tomato SlSDN1 gene, using sterile cultured tomato leaves as callus tissue, using Agrobacterium-mediated T-DNA for genetic transformation, and introducing the RNAi vector into the target plant, the obtained SlSDN1 knockdown transgenic plants can significantly reduce the infection of tomato brown wrinkled fruit virus.

[0011] The present invention also provides an RNAi expression vector containing a core fragment of a tomato SlSDN1 gene.

[0012] The transcript sequence of the core fragment of the SlSDN1 gene is shown in SEQ ID NO: 2. Specifically, the pRNAi-LIC-L1 vector is used as a backbone vector, and an expression frame sequentially connected to the CaMV35S promoter, the forward sequence of the core fragment of the tomato SlSDN1 gene, the PDK intron, the reverse sequence of the core fragment of the tomato SlSDN1 gene, and the NOS terminator is inserted at the multiple cloning restriction site.

[0013] A method for cultivating a SlSDN1 knockdown transgenic plant resistant to tomato brown wrinkled fruit virus: using aseptically cultured tomato leaves as callus tissue, introducing an RNAi vector carrying a core fragment of the SlSDN1 gene into a target plant through an Agrobacterium transformation method, and obtaining a tomato SlSDN1 gene knockdown transgenic plant.

[0014] The specific steps include:

[0015] (1) obtaining wild-type tomato plants, extracting RNA from leaves of the wild-type tomato plants using the Trizol method, removing genomic DNA from the RNA sample, and reversely transcribing to obtain cDNA;

[0016] (2) using primer pairs RNAi-35S-SlSDN1-F-1 and RNAi-35S-SlSDN1-R-1, as shown in SEQ ID NO: 3-4, PCR amplification was performed with cDNA as a template, and the amplified product was recovered by gel excision to obtain the target fragment containing the forward sequence of the core fragment of the SlSDN1 gene;

[0017] (3) Linearize the pRNAi-LIC-L1 vector with restriction endonuclease SmaI and recover the resulting DNA by gel excision;

[0018] (4) Using the In-Fusion method, the linearized pRNAi-LIC-L1 vector was connected with the target fragment containing the forward sequence of the SlSDN1 gene core fragment to obtain the recombinant plasmid RNAi-35S-SlSDN1-1;

[0019] (5) using the primer pair RNAi-35S-SlSDN1-F-2 and RNAi-35S-SlSDN1-R-2 as shown in step (1) and cDNA as a template for PCR amplification, and then cutting the gel to recover the amplified product to obtain the target fragment containing the reverse sequence of the core fragment of the SlSDN1 gene;

[0020] (6) Double digestion of the recombinant plasmid RNAi-35S-SlSDN1-1 with restriction endonucleases MluI and SalI, followed by gel excision and recovery;

[0021] (7) connecting the linearized RNAi-35S-SlSDN1-1 with the target fragment containing the reverse sequence of the SlSDN1 gene core fragment by the In-Fusion method to obtain the recombinant plasmid RNAi-35S-SlSDN1, i.e., the RNAi expression vector carrying the SlSDN1 gene core fragment;

[0022] (8) Mix 1 μL of the recombinant plasmid and 50 μL of competent Agrobacterium and transfer them into an electroporation cup. Use an electroporation device at 2500 V for transformation. After recovery, apply the mixture onto a resistant culture medium to screen for Agrobacterium that has been transformed with the recombinant plasmid.

[0023] (9) Infecting tomato leaves with Agrobacterium carrying the recombinant plasmid, obtaining callus tissue through differentiation culture, and then obtaining seedlings through rooting culture, which are then transferred for further culture;

[0024] (10) After the seedlings have grown stably, leaf samples are taken, and DNA is extracted using the CTAB method and RNA is extracted using the Trizol method. PCR amplification is performed using the primer pair dsSlSDN1-F and dsSlSDN1-R, as shown in SEQ ID NOs: 7-8, with the extracted DNA as a template to determine whether the exogenous RNAi-35S-SlSDN1 sequence has been transferred into the plant. At the same time, primer pair

[0025] qPCR-dsSlSDN1-F and qPCR-dsSlSDN1-R, as shown in SEQ ID NOs: 9-10, detected the level of SlSDN1 mRNA in transgenic tomatoes, screened positive strains with good knockdown effects for seed preservation, and obtained T1 generation positive seeds for experiments.

[0026] Compared with the prior art, the outstanding effects of the present invention are:

[0027] The present invention successfully cloned the tomato SlSDN1 gene and found that this gene is the susceptibility factor of ToBRFV in tomatoes. Through the method of Agrobacterium transformation, the RNAi vector carrying the core fragment of the SlSDN1 gene was introduced into the target plant. The obtained SlSDN1 knockdown transgenic plants can significantly reduce the disease caused by the tomato brown wrinkled fruit virus, which is of great significance.

[0028] The application of the tomato SlSDN1 gene in regulating plant antiviral resistance and the RNAi transgenic plant breeding method according to the present invention will be further described below in conjunction with the accompanying drawings and specific examples. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 Schematic diagram of the construction of RNAi vector for SlSDN1 gene.

[0030] Figure 2 Identification of SlSDN1 knockdown transgenic tomatoes. (A) PCR detection of successfully cultured RNAi-35S-SlSDN1 transgenic tomato DNA, the target band is about 350bp; (B) qRT-PCR analysis of the level of SlSDN1 mRNA from different strains of RNAi-35S-SlSDN1 transgenic tomatoes; (C) Phenotypic comparison of T1 generation RNAi-35S-SlSDN1 transgenic tomatoes and wild-type tomatoes, SlWT is a wild-type tomato, RNAi-35S-SlSDN1 1# and RNAi-35S-SlSDN1 3# are two different strains of RNAi-35S-SlSDN1 transgenic tomatoes.

[0031] Figure 3Analysis of the resistance of RNAi-35S-SlSDN1 transgenic tomatoes to tomato brown wrinkled fruit virus. (A) Phenotypes of systemic leaves of wild-type tomatoes and two RNAi-35S-SlSDN1 transgenic tomatoes 14 days after inoculation with ToBRFV; (B) qRT-PCR analysis of viral mRNA levels in wild-type tomatoes and two RNAi-35S-SlSDN1 transgenic tomatoes 14 days after inoculation with ToBRFV, **** represents significant differences (p < 0.0001); (C) Western blot analysis of viral accumulation in wild-type tomatoes and two RNAi-35S-SlSDN1 transgenic tomatoes 14 days after inoculation with ToBRFV; (D) Phenotypes of systemic leaves of wild-type tomatoes and two RNAi-35S-SlSDN1 transgenic tomatoes 28 days after inoculation with ToBRFV; (E) qRT-PCR analysis of viral mRNA levels in wild-type tomatoes and two RNAi-35S-SlSDN1 transgenic tomatoes 28 days after inoculation with ToBRFV, **** represents significant differences (p < 0.0001); (F) Western blot analysis of viral accumulation in wild-type tomatoes and two RNAi-35S-SlSDN1 transgenic tomatoes 14 days after inoculation with ToBRFV Blot analysis was performed on the accumulation of virus in wild-type tomatoes and two RNAi-35S-SlSDN1 transgenic tomatoes 28 days after inoculation with ToBRFV. DETAILED DESCRIPTION

[0032] A method for cultivating SlSDN1 transgenic plants resistant to tomato brown wrinkled fruit virus: an RNAi vector carrying a core fragment of the SlSDN1 gene is introduced into a target plant by Agrobacterium transformation to obtain a SlSDN1 knockdown transgenic plant.

[0033] The specific steps include:

[0034] (1) Obtain wild-type tomato plants, extract RNA from the leaves of the wild-type tomato plants using the Trizol method, remove genomic DNA from the RNA sample, and reverse transcribe to obtain cDNA.

[0035] (2) Using primer pairs RNAi-35S-SlSDN1-F-1 and RNAi-35S-SlSDN1-R-1, as shown in SEQ ID NO: 3-4, PCR amplification was performed with cDNA as a template, and the amplified product was recovered from the gel to obtain the target fragment containing the forward sequence of the core fragment of the SlSDN1 gene; the primer sequences used were:

[0036] RNAi-35S-SlSDN1-F-1: gagctcgacgacaagacccgggcgattgtgaaatggtcctttg

[0037] RNAi-35S-SlSDN1-R-1: atattatttccttaccccggggatgtgtcaatcactcttgca

[0038] (3) Linearize the pRNAi-LIC-L1 vector with restriction endonuclease SmaI and recover the fragment by gel excision.

[0039] (4) The linearized pRNAi-LIC-L1 vector was connected with the target fragment containing the forward sequence of the SlSDN1 gene core fragment by the In-Fusion method to obtain the recombinant plasmid RNAi-35S-SlSDN1-1.

[0040] (5) According to the method of step (1), the primer pair RNAi-35S-SlSDN1-F-2 and RNAi-35S-SlSDN1-R-2, as shown in SEQ ID NO: 5-6, was used to perform PCR amplification with cDNA as a template, and the amplified product was recovered from the gel to obtain the target fragment containing the reverse sequence of the core fragment of the SlSDN1 gene; the primer sequences used were:

[0041] RNAi-35S-SlSDN1-F-2:tttggattgattacagacgcgtgatgtgtcaatcactcttgca

[0042] RNAi-35S-SlSDN1-R-2:ctagagcacacgacccgtcgaccgattgtgaaatggtcctttg

[0043] (6) The recombinant plasmid RNAi-35S-SlSDN1-1 was double-digested with restriction endonucleases MluI and SalI, and the resulting plasmid was recovered by gel excision.

[0044] (7) connecting the linearized RNAi-35S-SlSDN1-1 with the target fragment containing the reverse sequence of the SlSDN1 gene core fragment by the In-Fusion method to obtain the recombinant plasmid RNAi-35S-SlSDN1, i.e., the RNAi expression vector carrying the SlSDN1 gene core fragment;

[0045] like Figure 1 As shown, the RNAi expression vector uses the pRNAi-LIC-L1 vector as a backbone vector, and inserts an expression frame sequentially connecting the CaMV35S promoter, the forward sequence of the tomato SlSDN1 gene core fragment, the PDK intron, the reverse sequence of the tomato SlSDN1 gene core fragment and the NOS terminator at the multiple cloning restriction site.

[0046] (8) Mix 1 μL of the recombinant plasmid and 50 μL of competent Agrobacterium and transfer them into an electroporation cup. Use an electric shock device at 2500 V for transformation. After recovery, spread them on a resistant culture medium to screen for Agrobacterium that has been transformed with the recombinant plasmid.

[0047] (9) The Agrobacterium carrying the recombinant plasmid is used to infect tomato leaves, and callus tissue is obtained through differentiation culture. Then, seedlings are obtained through rooting culture and transferred for further culture.

[0048] (10) After the seedlings have grown stably, leaf samples are taken, and DNA is extracted using the CTAB method and RNA is extracted using the Trizol method. PCR amplification is performed using the primer pair dsSlSDN1-F and dsSlSDN1-R, as shown in SEQ ID NOs: 7-8, with the extracted DNA as a template to determine whether the exogenous RNAi-35S-SlSDN1 sequence has been transferred into the plant. At the same time, primer pair

[0049] qPCR-dsSlSDN1-F and qPCR-dsSlSDN1-R, as shown in SEQ ID NO: 9-10, detect the level of transgenic tomato SlSDN1 mRNA, screen positive strains with good knockdown effects for seed preservation, and obtain T1 generation positive seeds for experiments. The primer sequences used are:

[0050] dsSlSDN1-F:gctggagatttagaaggagtt

[0051] dsSlSDN1-R:tcttcttcgtcttacacatc

[0052] qPCR-dsSlSDN1-F:ccttcgaaagataggctctcca

[0053] qPCR-dsSlSDN1-R: cgcctcctcacaaaccaatg

[0054] (11) Two transgenic positive strains with good SlSDN1 knockdown effects were obtained through screening: RNAi-35S-SlSDN1 1# and RNAi-35S-SlSDN 3# ( Figure 2 A and 2B), knockdown of the tomato SlSDN1 gene had no effect on the normal growth of tomatoes ( Figure 2 C).

[0055] (12) Using wild-type tomatoes as controls, ToBRFV was inoculated on T1 knockdown transgenic positive tomatoes and wild-type tomatoes that had grown 2-3 true leaves, and the development of virus symptoms was observed. 14 days after virus inoculation, typical virus symptoms such as deformity, dark green protrusions, and narrow leaves had already formed on the systemic leaves of wild-type tomatoes, while only mild and unobvious symptoms were observed on the systemic leaves of the two SlSDN1 knockdown transgenic tomatoes ( Figure 3 A). qRT-PCR and Western blot also demonstrated that the viral accumulation in the two SlSDN1 knockdown transgenic tomatoes was significantly lower than that in the control group ( Figure 3 B and 3C). 28 days after virus inoculation, the systemic leaves of wild-type tomatoes were seriously diseased, and obvious disease symptoms were also observed in the systemic leaves of the two SlSDN1 knockdown transgenic tomatoes, but the severity was significantly lower than that of the control group ( Figure 3 D), qRT-PCR and Western blot also confirmed the same conclusion ( Figure 3 E and 3F).

[0056] The experimental results show that the SlSDN1 knockdown transgenic tomatoes obtained by Agrobacterium genetic transformation can significantly reduce the infection of tomato brown wrinkled fruit virus and inhibit the disease caused by tomato brown wrinkled fruit virus.

[0057] The embodiments described above are merely descriptions of preferred implementation modes of the present invention and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. A tomato SlSDN1 The application of genes in regulating plant resistance to viruses is characterized by: The virus is tomato brown wrinkled fruit virus, the tomato SlSDN1 The nucleotide sequence of the transcript of the core fragment of the gene is shown in SEQ ID NO: 2; the tomato carrying SlSDN1 The RNAi vector of the gene core fragment was introduced into the target plant to obtain SlSDN1 Knockdown transgenic plant; wherein the plant is tomato.

2. The tomato according to claim 1 SlSDN1 The application of genes in regulating plant resistance to viruses is characterized by: The tomato SlSDN1 The nucleotide sequence of the gene transcript is shown in SEQ ID NO:

1.

3. An RNAi expression vector, characterized in that: Contains tomato SlSDN1 The core fragment of the gene, the tomato SlSDN1 The nucleotide sequence of the transcript of the core fragment of the gene is shown in SEQ ID NO:

2.

4. The RNAi expression vector according to claim 3, characterized in that: The pRNAi-LIC-L1 vector was used as the backbone vector, and the CaMV35S promoter, tomato SlSDN1 Forward sequence of the gene core fragment, PDK intron, tomato SlSDN1 The expression cassette contains the reverse sequence of the gene core fragment and the NOS terminator.

5. A method for resisting tomato brown fruit virus SlSDN1 A method for cultivating knockdown transgenic plants, characterized in that: Using aseptically cultured tomato leaves as callus, the bacteria carrying SlSDN1 The RNAi vector of the gene core fragment was introduced into the target plant to obtain SlSDN1 Knockdown transgenic plants; SlSDN1 The nucleotide sequence of the transcript of the core fragment of the gene is shown in SEQ ID NO: 2; wherein the plant is tomato.

6. The method of claim 5 for resisting tomato brown wrinkled fruit virus SlSDN1 A method for cultivating knockdown transgenic plants, characterized in that: The steps include: (1) Obtain wild-type tomato plants, extract RNA from the leaves of the wild-type tomato plants using the Trizol method, remove genomic DNA from the RNA sample, and reverse transcribe to obtain cDNA; (2) using the primer pair RNAi-35S-SlSDN1-F-1 and RNAi-35S-SlSDN1-R-1 as the nucleotide sequence shown in SEQ ID NO:3-4, PCR amplification was performed with cDNA as a template, and the amplified product was recovered by gel excision to obtain a fragment containing SlSDN1 The target fragment of the forward sequence of the gene core fragment; (3) Use restriction endonucleases Sma I linearized pRNAi-LIC-L1 vector and recovered it by gel excision; (4) Use the In-Fusion method to connect the linearized pRNAi-LIC-L1 vector with the SlSDN1 The target fragment of the forward sequence of the gene core fragment was obtained to obtain the recombinant plasmid RNAi-35S-SlSDN1-1; (5) According to the method of step (1), PCR amplification is performed using the primer pairs RNAi-35S-SlSDN1-F-2 and RNAi-35S-SlSDN1-R-2 with the nucleotide sequences as shown in SEQ ID NO: 5-6, and cDNA is used as a template. The amplified product is recovered by gel excision to obtain a fragment containing SlSDN1 The target fragment of the reverse sequence of the gene core fragment; (6) Use restriction endonucleases Mlu I and Sal I double-enzyme digestion of the recombinant plasmid RNAi-35S-S1SDN1-1, followed by gel excision and recovery; (7) Use the In-Fusion method to connect the linearized RNAi-35S-SlSDN1-1 with SlSDN1 The target fragment of the reverse sequence of the gene core fragment was obtained to obtain the recombinant plasmid RNAi-35S-SlSDN1, which carries SlSDN1 RNAi expression vector of the gene core fragment; (8) Mix 1 μL of the recombinant plasmid and 50 μL of competent Agrobacterium and transfer them into an electroporation cup. Use an electroporation device at 2500 V for transformation. After recovery, spread them on a resistant culture medium to screen for Agrobacterium that has been transformed with the recombinant plasmid. (9) Infect tomato leaves with Agrobacterium carrying the recombinant plasmid, obtain callus tissue through differentiation culture, and then obtain seedlings through rooting culture, which are then transferred for further culture; (10) After the seedlings have grown stably, leaf samples are taken, and DNA is extracted using the CTAB method and RNA is extracted using the Trizol method. PCR amplification is performed using the primer pairs dsSlSDN1-F and dsSlSDN1-R whose nucleotide sequences are shown in SEQ ID NOs:7-8, with the extracted DNA as a template, to determine whether the exogenous RNAi-35S-SlSDN1 sequence has been transferred into the plant. At the same time, the primer pairs qPCR-dsSlSDN1-F and qPCR-dsSlSDN1-R whose nucleotide sequences are shown in SEQ ID NOs:9-10 are used to detect transgenic tomatoes. SlSDN1 mRNA level, screen the positive strains with good knockdown effect and keep them as seeds to obtain T1 generation positive seeds.

Images