Application of SNP markers related to body shape traits in goats

Abstract

The present invention relates to the field of molecular biology and genetic breeding, and discloses the application of a SNP marker related to goat body shape traits. The SNP marker is located at 40259869bp of goat chromosome 3, which is a T>A base mutation (rs665269479). Experiments show that the SNP marker developed by the present invention has a significant effect on the three body shape traits of goat body length, body height and chest circumference ( P <0.05), and allele T has a more excellent body shape trait, so RAVER2 The modified SNP molecular marker in the gene can be applied to the molecular marker breeding of goat body shape traits. The molecular marker provided by the present invention is not limited by the age and gender of the goat, and can be used to breed goat varieties with excellent body shape, and can even be accurately screened just after birth, greatly accelerating the breeding process of goat varieties with excellent body shape.

Description

Technical Field

[0001] The invention relates to the fields of molecular biology and genetic breeding, and in particular to the application of a SNP marker related to goat body shape traits. Background Art

[0002] The fusion protein Ribonucleoprotein PTB-binding 2 (RAVER2) is an important protein that plays a key role in a variety of cells and tissues. RAVER2 is a ribonucleoprotein that binds to polypyrimidine tract-binding protein (PTB) and is involved in RNA metabolism, including RNA splicing and stability regulation. RAVER2 has three RNA-specific motifs and is similar to RAVER1 protein in sequence homology and overall domain structure. RAVER2 can bind to RNA and interact with polypyrimidine tract-binding protein (PTB). Related studies have shown that RAVER2 Genes have unique spatiotemporal expression patterns during mouse embryonic development. RAVER2 The gene is expressed in embryos from E8.5 to E14.5, and is mainly concentrated in the neuroepithelium, brain, and dorsal root ganglia. Currently, researchers have used whole genome data to screen for selection signals related to meat quality and muscle development in Jining Grey Goats and Boer Goats, and performed transcriptome analysis on the longus pectoralis muscle. The results showed that 442 positively selected genes were found in Jining Grey Goats, of which 139 were differentially expressed genes. At the same time, GO and KEGG enrichment analysis of the two groups of genes showed that RAVER2 Multiple candidate genes and signaling pathways are related to muscle development. The IAnimal Database database shows that RAVER2 The gene was expressed most highly in goat viscera, followed by muscle. RAVER2 The polymorphic variation of the gene locus has a significant effect on the body size of goats.

[0003] goat( Capra hircus) is one of the most important livestock species in the world and was domesticated about 10,500 to 9,900 years ago. Goats provide a series of livestock products such as meat, wool, milk and leather for people's daily life, and play an important economic role in human production activities. China has a long history of goat domestication and rich goat breed resources. Goats are the most adaptable and geographically widespread livestock. Different breeds of goats are distributed in the cold Qinghai-Tibet Plateau, the cold and dry Northeast, the hot and humid South, the dry and hot deserts and karst mountains. In order to integrate into different environments and ecosystems, goats have been subject to long-term natural selection and artificial selection, and gradually formed breeds with different appearance characteristics, body shapes and different genetic characteristics according to different natural environments and human directional selection. Chinese local goat breeds have the characteristics of early sexual maturity, strong adaptability, tolerance to roughage, tender and delicious meat, but they have the characteristics of small birth weight, slow growth and development, small adult size and low meat production rate. It takes a long process to hybridize and improve local goat breeds with introduced breeds, which takes decades of introduction hybridization, progressive hybridization, cross-fixation and generational breeding.

[0004] With the improvement of people's living standards and the intensive development of breeding enterprises, the market demand for large-sized goat breeds is growing, which brings new challenges to the breeding industry. Breeders are working hard to breed goats with larger size and faster growth rate to meet consumers' demand for high-quality meat. The body size and muscle development of goats is a complex process that is jointly affected by genes, feeding management and environmental factors. Effectively improving body size and muscle development can not only improve meat quality and meet market demand, but also improve breeding efficiency and bring greater economic benefits. In recent years, the development of molecular marker-assisted selection (MAS) breeding has enabled DNA molecular marker technology to play an important role in the study of goat genetic diversity. In order to better develop and utilize the economic characteristics of excellent breeds, as well as to protect and rationally utilize breed resources, it is necessary to develop goat-specific molecular markers. These markers can be applied to the selection and breeding of large-sized goats and provide a theoretical basis for molecular breeding of large-sized goats. Summary of the invention

[0005] The purpose of the present invention is to provide an application of a SNP marker (rs665269479) associated with goat body shape traits.

[0006] In order to achieve the purpose of the present invention, in a first aspect, the present invention provides any of the following applications of a SNP marker (rs665269479) associated with goat body shape traits:

[0007] (1) Used for goat body type breeding;

[0008] (2) Used for early prediction of goat individuals with large body size traits;

[0009] (3) Used for identification of goat strains with large body traits;

[0010] (4) Used for genetic improvement of goat breeds;

[0011] (5) Used for RAVER2 Genotyping.

[0012] In the present invention, the SNP marker associated with the goat body shape trait contains a nucleotide sequence (N is T or A) in which the polymorphism at position 269 of the sequence shown in SEQ ID NO: 1 is T / A; the genotype of the site with the polymorphism is TT, corresponding to the large body shape trait, and the genotype of the site with the polymorphism is AA, corresponding to the small body shape trait.

[0013] Said RAVER2 The reference sequence number of the gene in NCBI is ENSCHIG00000005514.

[0014] In a second aspect, the present invention provides primers for amplifying the SNP marker, preferably including primers as shown in SEQ ID NO: 2-3.

[0015] In a third aspect, the present invention provides a reagent or a kit containing the primer.

[0016] In a fourth aspect, the present invention provides any of the following uses of the primer or a reagent or kit containing the primer:

[0017] (1) Used for goat body type breeding;

[0018] (2) Used for early prediction of goat individuals with large body size traits;

[0019] (3) Used for identification of goat strains with large body traits;

[0020] (4) Used for genetic improvement of goat breeds;

[0021] (5) Used for RAVER2 Genotyping.

[0022] In a fifth aspect, the present invention provides a method for breeding goats for body shape traits, comprising the following steps:

[0023] 1) Detect SNP markers related to goat body shape traits in reserve breeding goats;

[0024] 2) Select the individuals with genotype TT in step 1) as breeding sheep, and eliminate the breeding sheep with genotype TA or AA.

[0025] In a sixth aspect, the present invention provides a method for breeding a goat strain having a large body trait, comprising the following steps:

[0026] 1) Detect SNP markers related to goat body shape traits in reserve breeding goats;

[0027] 2) Selecting the individuals with genotype TT in step 1) as breeding sheep, and breeding the breeding male and female sheep;

[0028] 3) The goats born from mating in step 2) are tested for the SNP markers, individuals with genotype TT are retained, individuals with genotype TA or AA are eliminated, and then the individuals are bred to obtain a goat strain with large body size traits.

[0029] In a seventh aspect, the present invention provides a method for genetic improvement of goats, comprising the following steps:

[0030] 1) Detect SNP markers associated with goat body shape traits in reserve breeding goats;

[0031] 2) Retain individuals with genotype TT in step 1) and eliminate individuals with genotype TA or AA;

[0032] 3) Using the individuals with genotype TT in step 2) as breeding goats, continue to select breeding goat individuals with genotype TT in the offspring, and eliminate individuals with genotype TA or AA; thereby increasing the frequency of allele T in the offspring goat population generation by generation, thereby reducing the proportion of small size in the offspring breeding goats.

[0033] In an eighth aspect, the present invention provides a method for screening lambs for large body traits, comprising the following steps:

[0034] 1) Detect SNP markers related to goat body shape traits in the lambs to be screened;

[0035] 2) When the genotype of the SNP marker detected in step 1) is TT, the lamb to be screened has a large body genetic trait and is retained; when the genotype detected is TA or AA, the lamb to be screened has a small body trait and is eliminated.

[0036] By means of the above technical solution, the present invention has at least the following advantages and beneficial effects:

[0037] (I) The present invention screened and identified a molecular marker rs665269479 related to the body shape of goats. The body height of goats with different genotypes of the marker was significantly different. The average body height of the genotype TT of the rs665269479 molecular marker was 67.03 cm, the average body length was 74.99 cm, and the average chest circumference was 85.71 cm. The average body height of the genotype AA of the molecular marker was 53.14 cm, the average body length was 57.27 cm, and the average chest circumference was 65.95 cm. The T allele significantly improved the body shape of goats, thereby affecting their meat production performance. The TT genotype was the dominant genotype. Therefore, by applying the molecular marker, the body shape of goats can be improved, thereby accelerating the genetic improvement and breeding process of goats.

[0038] (ii) By detecting the genotype of the rs665269479 molecular marker to assist in the breeding of goats, selecting goats with the TT genotype can effectively improve the body size of goats and facilitate subsequent comprehensive breeding.

[0039] (III) The rs665269479 molecular marker is applied to the breeding of goats with body conformation traits. The selected goats can significantly improve their body conformation, thereby improving the production performance of breeding goats.

[0040] (iv) Applying the rs665269479 molecular marker to the breeding of goat strains with large body traits can produce goat strains with significantly increased body size, thereby increasing carcass weight and net meat weight, thereby improving the production performance of this strain of goats and accelerating the genetic improvement and breeding process of breeding goats.

[0041] (V) Applying the rs665269479 molecular marker to the genetic improvement of goats can greatly shorten the years of genetic breeding, improve the production performance of goats, and accelerate the genetic improvement and breeding process of breeding goats.

[0042] (VI) The rs665269479 molecular marker is used to screen lambs with large genetic traits. Goats with large traits can be selected and retained at the lamb stage, thereby selecting and breeding goats with large traits at the early stage of birth, greatly improving breeding efficiency and saving feeding costs. BRIEF DESCRIPTION OF THE DRAWINGS

[0043] Figure 1 The height and length phenotypes of the large-sized goats and small-sized goats in the preferred embodiment of the present invention are shown in the figure. express P <0.001, express P <0.0001.

[0044] Figure 2This is a Manhattan diagram of the SNP effect distribution of the whole genome of goat body shape traits in a preferred embodiment of the present invention: ST Manhattan plot of the selected signals. The middle one is the Manhattan plot of the selected signals selected by Pi-Ratio. The lower one is the Manhattan plot of the selected signals selected by XP-EHH. The selected position in the box indicates RAVER2 The genomic location of the gene rs665269479 molecular marker.

[0045] Figure 3 The above picture shows F ST The fine positioning map of the selected region of 150Kb was screened out, and the figure below is the linkage disequilibrium map of the selected region 10Kb before and after the SNP site.

[0046] Figure 4 The left side is a Venn diagram of genes screened by the three selection signal methods between the large body length group and the small body length group in a preferred embodiment of the present invention, wherein the three methods jointly identified 32 selected regions, including 29 significantly correlated genes (including RAVER2 Genes), on the right is the Venn diagram of genes significantly associated with body length, genes significantly associated with body height, and genes significantly associated with chest circumference. There are 2 genes (including RAVER2 gene) were significantly correlated with body length, height and chest circumference.

[0047] Figure 5 In the preferred embodiment of the present invention, the SNP site (rs665269479) has significant differences between the small body size group and the large body size group ( P <0.01). DETAILED DESCRIPTION

[0048] The present invention aims to provide a SNP molecular marker related to goat body shape and application thereof.

[0049] The present invention adopts the following technical solution:

[0050] The present invention provides a SNP molecular marker associated with goat body shape. The SNP molecular marker is located at a T>A base mutation at the 40259869bp position of chromosome 3 of the goat reference genome ARS1 version (i.e., the rs665269479 molecular marker).

[0051] Therefore, by applying this molecular marker, the production performance of goats can be greatly improved. Through continuous selection and breeding, the body size of goats can be improved, the meat production can be increased, and the genetic improvement and breeding process of local goat breeds can be accelerated.

[0052] In certain embodiments of the present invention, the upstream and downstream gene sequences of the SNP molecular marker site are as shown in SEQ ID NO:1, and the SNP molecular marker is located at the 269th site of the sequence shown in SEQ ID NO:1, where the T>A base mutation represented by N (i.e., the rs665269479 molecular marker) is located.

[0053] The present invention also provides the application of the SNP molecular marker (rs665269479 molecular marker) in goat body type trait selection and breeding, the SNP molecular marker is located at the T>A base mutation at the 40259869bp position of chromosome 3 of the goat reference genome ARS1 version or the upstream and downstream gene sequences of the SNP molecular marker site are shown in SEQ ID NO: 1, and the SNP molecular marker is located at the T>A base mutation represented by N at the 269th site of the sequence shown in SEQ ID NO: 1. Therefore, by applying the molecular marker to goat body type trait selection and breeding, the selected goats can greatly improve their body size, thereby improving their meat production performance, improving economic benefits, and accelerating the genetic improvement progress and breeding process of breeding goats.

[0054] In certain embodiments of the present invention, the application comprises the following steps:

[0055] 1) The following SNP molecular marker (rs665269479 molecular marker) was detected in the breeding goats: the SNP molecular marker was located at the T>A base mutation at the 40259869bp position of chromosome 3 of the goat genome ARS1 version, or the gene sequence upstream and downstream of the SNP molecular marker site was as shown in SEQ ID NO:1, and the SNP molecular marker was located at the T>A base mutation represented by N at the 269th position of the sequence shown in SEQ ID NO:1;

[0056] The present invention also provides the application of the SNP molecular marker (rs665269479 molecular marker) in breeding large-bodied goat strains, wherein the SNP molecular marker is located at the T>A base mutation at the 40259869bp position of chromosome 3 of the ARS1 version of the goat genome, or the gene sequence upstream and downstream of the SNP molecular marker site is as shown in SEQ ID NO:1, and the SNP molecular marker is located at the T>A base mutation represented by N at the 269th site of the sequence shown in SEQID NO:1 (M is T or A). Thus, by applying the above molecular marker to breeding large-bodied goat strains, a goat strain with a large body can be obtained, thereby improving the slaughter rate of the goats of the strain, etc., improving the production performance of the goats of the strain, and accelerating the genetic improvement progress and breeding process of the goats.

[0057] In some embodiments of the present invention, the application comprises the following steps:

[0058] 1) The following SNP molecular marker (rs665269479 molecular marker) was detected in the breeding goats: the SNP molecular marker was located at the T>A base mutation at the 40259869bp position of chromosome 3 of the goat reference genome ARS1 version, or the gene sequence upstream and downstream of the SNP molecular marker site was as shown in SEQ ID NO:1, and the SNP molecular marker was located at the T>A base mutation represented by N at the 269th position of the sequence shown in SEQ ID NO:1;

[0059] 2) selecting the individuals with the TT genotype detected in step 1) as seed goats, and breeding the male and female seed goats;

[0060] 3) The goats born from the mating in step 2) are tested for SNP molecular markers as in step 1), the TT genotype individuals are retained, the TA or AA genotype individuals are eliminated, and the breeding is performed to cultivate a large goat strain with a large body size during the fattening period.

[0061] The present invention also provides a method for genetic improvement of goats, wherein the method comprises the following steps:

[0062] 1) Detect the following SNP molecular marker (rs665269479 molecular marker) in goats: the SNP molecular marker is located at the T>A base mutation at the 40259869bp position of chromosome 3 of the goat reference genome ARS1 version, or the gene sequence upstream and downstream of the SNP molecular marker site is as shown in SEQ ID NO:1, and the SNP molecular marker is located at the T>A base mutation represented by N at the 269th position of the sequence shown in SEQ ID NO:1;

[0063] 2) Select and retain the breeding goat individuals with the molecular marker genotype of TT in step 1), and eliminate the individuals with TA or AA genotype;

[0064] 3) The individuals selected in step 2) are used as breeding goats for breeding, and the breeding goat individuals with the molecular marker genotype of TT in step 1) are continued to be selected in the offspring, and the individuals with the genotype of TA or AA are eliminated; so as to increase the frequency of the allele T in the offspring goat population generation by generation, thereby reducing the proportion of small-sized goats in the offspring breeding goats.

[0065] Therefore, by applying the above-mentioned molecular markers to the genetic improvement of goats, the genetic breeding period can be greatly shortened and the meat production rate of goats can be improved.

[0066] The present invention also provides the use of the SNP molecular marker (rs665269479 molecular marker) in screening lambs with large body genetic traits. Thus, by applying the molecular marker to screening lambs with large body genetic traits, goats with large body can be screened out at the lamb stage and selected, thereby selecting and breeding goats with large body traits at the lamb stage, which can greatly improve breeding efficiency, reduce feeding costs, and improve economic benefits.

[0067] In certain embodiments of the present invention, the application comprises the following steps:

[0068] 1) Detect the following SNP molecular marker (rs665269479 molecular marker) in the lamb to be screened: the SNP molecular marker is located at the T>A base mutation at the 40259869bp position of chromosome 3 of the international goat genome ARS1 version, or the gene sequence upstream and downstream of the SNP molecular marker site is as shown in SEQ ID NO:1, and the SNP molecular marker is located at the T>A base mutation represented by N at the 269th position of the sequence shown in SEQ ID NO:1;

[0069] 2) When the genotype of the molecular marker detected in step 1) is TT, the lamb to be screened has a large body trait and is retained; when the genotype is TA or AA, the lamb to be screened has a small body genetic trait and is eliminated.

[0070] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the present invention. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art, and the raw materials used are all commercially available products.

[0071] Example 1 Process steps for obtaining molecular markers

[0072] 1. Based on the national germplasm resource bank, collect ear tissue samples or blood samples from large-sized and small-sized goat breeds ( Figure 1 ), extract total DNA, perform quality control on the DNA, and send it to a sequencing company for high-depth whole-genome resequencing (BGI, T7 platform), with an average sequencing depth of about 10×. Collect phenotypic data such as body shape and performance determination of the corresponding goat breeds.

[0073] 2. Sort out the fastq files downloaded from the sequencing company. Eliminate reads that do not meet the standards and have poor quality. After quality control and filtering of the raw data, obtain high-quality sequencing data. Use the MEM algorithm of BWA (Version 0.7.15) software to align the Clean Data to the latest goat reference genome (ARS1) to obtain the initial bam file, and use SAMtools (Version 1.9) software to sort the bam file and remove PCR duplicates.

[0074] 3. First, the HaplotypeCaller module of GATK (Version 4.1.4.0) software was used to detect variants in all individuals and generate gvcf files. The CombineGVCFs function of GATK software was used to merge the gvcf files of all individuals, and finally genotyping was performed using GenotypeGVCFs. Only autosomes were used for subsequent analysis, and the generated vcf files were initially filtered using the SelectVariants function. SNP filtering conditions: QD60.0, MQ3.0, ReadPosRankSum<-8.0, MQRankSum<-12.5. GATK4 was used to detect variants in 98 samples, and hard filtering was performed (QD<-2.0||ReadPosRankSum<-8.0||FS>60.0||MD<40.0||SOR>3.0|| MQRankSum<-12.5||QUAL<30). After quality control, 76 domestic and foreign goat breed individuals and 16,744,201 SNPs were used for subsequent genome-wide selection signal analysis.

[0075] Example 2 Process steps for molecular marker verification

[0076] 1. The research population consisted of 76 domestic goat breeds, and the samples were from the National Livestock and Poultry Germplasm Resources Bank.

[0077] 2. By using VCFtools (Version 0.1.16) software, the F of the large body group and the small body group was calculated. ST, with a window length of 50 kb and a step length of 20 kb. VCFtools (Version 0.1.16) software was used to calculate the Pi-Ratio (window-pi 10000) of the large and small groups. Selscan (Version 2.0.2) software was used to calculate the XP-EHH of the large and small groups. The top 1% windows with the strongest signal values ​​were selected as significant regions. The analysis results were visualized using ggplot2 (Version 3.4.4) software in R (Version 4.3.2) ( Figure 2 Fine mapping and linkage disequilibrium analysis were performed using LDBlockShow (Version 1.40) software ( Figure 3 ), the visualization results show that in chromosome 3, within the 40.25MB-40.27MB region, this gene region is selected in both the large and small body groups, and this SNP site (rs665269479) is not linked to other SNP sites ( Figure 3 ). The three methods screened out 500, 613 and 593 selected regions respectively. The intersection of the three screening methods resulted in a total of 32 fewer selected regions ( Figure 4 ). The selection signals of goat groups related to body height, body length and chest circumference were analyzed. Among them, the body height group included 87 goats of different body heights, the body length group included 86 goats, and the chest circumference group included 88 goats. ST The three groups were co-localized to RAVER2 Gene( Figure 4 Right side), among which the signal of body length group is the most significant.

[0078] 3. Use Plink (Version 1.90) software to calculate the rs665269479 molecular marker site (located at RAVER2 The genotype of the locus in the 4th intron of the gene) was significantly different between the large and small groups. The Fisher test and chi-square test showed that the difference between the large and small groups was extremely significant ( P <0.01) ( Figure 5 ).

[0079] Example 3 Application of rs665269479 molecular marker in breeding of lean meat percentage trait in fattening goats

[0080] The rs665269479 molecular marker is detected in the breeding goats; the individuals with the TT genotype obtained by the detection are selected as the breeding goats, and the TA or AA genotype breeding goats are eliminated. Goats with tall body traits can be selected as breeding goats, so as to realize the selection of body traits for breeding goats.

[0081] Example 4 Application of rs665269479 molecular marker in breeding goat strains with lean meat percentage trait in fattening goats

[0082] The rs665269479 molecular marker is detected in the breeding goats; the individuals with the TT genotype obtained by the detection are selected as the breeding goats, and the male and female breeding goats are bred; the rs665269479 molecular marker is detected in the goats born from the breeding, the TT genotype individuals are retained, and the TA or AA genotype individuals are eliminated for breeding, so as to cultivate a high-body and high-production performance goat strain.

[0083] Example 5 A method for genetic improvement of goats

[0084] Detect the rs665269479 molecular marker in breeding goats; select breeding goat individuals with a genotype of TT and eliminate individuals with a genotype of TA or AA; use the screened individuals as breeding goats for breeding, and continue to select breeding goat individuals with a genotype of TT for the rs665269479 molecular marker and eliminate individuals with a genotype of TA or AA in the offspring; thereby increasing the frequency of the allele T in the offspring goat population generation by generation, thereby increasing the lean meat rate of the offspring breeding goats during the fattening period.

[0085] Example 6 Application of rs665269479 molecular marker in screening fattening goat lambs for lean meat percentage traits

[0086] The rs665269479 molecular marker is detected in the lambs to be screened; when the genotype of the detected molecular marker is TT, the lambs to be screened have the genetic trait of large body size and are retained; when the genotype is TA or AA, the lambs to be screened have the genetic trait of low lean meat rate during fattening period and are eliminated.

[0087] The breeding goats used in Examples 3 to 6 are goat breeds native to China.

[0088] Examples 3 to 6 used the following primers to amplify the rs665269479 molecular marker, and the primer sequences were (SEQ ID NO: 2-3):

[0089] Forward primer: 5′-TGGACTTACTCTTTCTCTCCCAT-3′

[0090] Reverse primer: 5′- TGAAGGCTGACTACCATTCATAA -3′

[0091] PCR amplification methods include:

[0092] 1) Extract genomic DNA from the goat to be tested;

[0093] 2) Using genomic DNA as a template, PCR amplification was performed using the primers shown in SEQ ID NO: 2-3;

[0094] 3) Analyze the PCR amplification products.

[0095] The amplification system used in the PCR reaction was as follows in 50 μl: 1 μl of 100 ng / μl template DNA, 1 μl of 10 pmol / μl forward primer and reverse primer, 1 μl of 10 mmol / L dNTP Mixture, 1 μl of 1.25 U / 25 μl TaKaRa Ex Taq DNA polymerase, 25 μl of 2× PCR reaction buffer, and the remainder was double distilled water.

[0096] The PCR reaction program is as follows: PCR reaction conditions are as follows: 95°C pre-denaturation for 5 min; 95°C denaturation for 30 s, 55°C or 60°C annealing for 30 s, 72°C extension for 1-2 min, for a total of 30-35 cycles; 72°C insulation for 2 min.

[0097] Although the present invention has been described in detail above with general descriptions and specific embodiments, it is obvious to those skilled in the art that some modifications or improvements can be made based on the present invention. Therefore, these modifications or improvements made without departing from the spirit of the present invention all fall within the scope of protection claimed by the present invention.

Claims

1. Any of the following applications of SNP markers related to goat body conformation traits: (1) Used for goat body type breeding; (2) Used for early prediction of goat individuals with large body size traits; (3) Used for identification of goat strains with large body traits; (4) Used for genetic improvement of goat breeds; (5) Used for RAVER2 Genotyping; RAVER2 The reference sequence number of the gene at NCBI is ENSCHIG00000005514; in, The SNP marker associated with the goat body shape trait contains a nucleotide sequence with a polymorphism of T / A at position 269 of the sequence shown in SEQ ID NO: 1; the genotype of the site with the polymorphism is TT, corresponding to the large body shape trait, and the genotype of the site with the polymorphism is AA, corresponding to the small body shape trait.

2. Any of the following applications of primers for amplifying SNP markers associated with goat body conformation traits: (1) Used for goat body type breeding; (2) Used for early prediction of goat individuals with large body size traits; (3) Used for identification of goat strains with large body traits; (4) Used for genetic improvement of goat breeds; (5) Used for RAVER2 Genotyping; RAVER2 The reference sequence number of the gene at NCBI is ENSCHIG00000005514; in, The SNP marker associated with the goat body shape trait contains a nucleotide sequence with a polymorphism of T / A at position 269 of the sequence shown in SEQ ID NO: 1; the genotype of the site with the polymorphism is TT, corresponding to the large body shape trait, and the genotype of the site with the polymorphism is AA, corresponding to the small body shape trait.

3. Any of the following uses of a reagent or kit containing primers for amplifying SNP markers associated with body conformation traits in goats: (1) Used for goat body type breeding; (2) Used for early prediction of goat individuals with large body size traits; (3) Used for identification of goat strains with large body traits; (4) Used for genetic improvement of goat breeds; (5) Used for RAVER2 Genotyping; RAVER2 The reference sequence number of the gene at NCBI is ENSCHIG00000005514; in, The SNP marker associated with the goat body shape trait contains a nucleotide sequence with a polymorphism of T / A at position 269 of the sequence shown in SEQ ID NO: 1; the genotype of the site with the polymorphism is TT, corresponding to the large body shape trait, and the genotype of the site with the polymorphism is AA, corresponding to the small body shape trait.

4. The use according to claim 2 or 3, It is characterized in that The primers are shown in SEQ ID NO: 2-3.

5. Goat body type traits breeding method, It is characterized in that The steps include: 1) Detect SNP markers related to goat body shape traits in reserve breeding goats; 2) Select the individuals with genotype TT in step 1) as breeding sheep, and eliminate the breeding sheep with genotype TA or AA; Among them, the SNP marker related to the goat body shape trait contains a nucleotide sequence with a polymorphism of T / A at the 269th position of the sequence shown in SEQ ID NO: 1; the genotype of the site with the polymorphism is TT, corresponding to the large body shape trait, and the genotype of the site with the polymorphism is AA, corresponding to the small body shape trait.

6. A method for breeding a goat strain with large body traits, It is characterized in that The steps include: 1) Detect SNP markers related to goat body shape traits in reserve breeding goats; 2) Selecting the individuals with genotype TT in step 1) as breeding sheep, and breeding the breeding male and female sheep; 3) detecting the SNP markers on the goats born from mating in step 2), retaining individuals with genotype TT, eliminating individuals with genotype TA or AA, and then breeding to obtain goat strains with large body traits; Among them, the SNP marker related to the goat body shape trait contains a nucleotide sequence with a polymorphism of T / A at the 269th position of the sequence shown in SEQ ID NO: 1; the genotype of the site with the polymorphism is TT, corresponding to the large body shape trait, and the genotype of the site with the polymorphism is AA, corresponding to the small body shape trait.

7. Methods for genetic improvement of goats, It is characterized in that The steps include: 1) Detect SNP markers associated with goat body shape traits in reserve breeding goats; 2) Retain individuals with genotype TT in step 1) and eliminate individuals with genotype TA or AA; 3) Using the individuals with genotype TT in step 2) as breeding goats, breeding goats with genotype TT are selected in the offspring, and individuals with genotype TA or AA are eliminated; the frequency of allele T in the offspring goat population is increased generation by generation, thereby reducing the proportion of small size of offspring goats; Among them, the SNP marker related to the goat body shape trait contains a nucleotide sequence with a polymorphism of T / A at the 269th position of the sequence shown in SEQ ID NO: 1; the genotype of the site with the polymorphism is TT, corresponding to the large body shape trait, and the genotype of the site with the polymorphism is AA, corresponding to the small body shape trait.

8. Methods for selecting lambs for large body traits, It is characterized in that The steps include: 1) Detect SNP markers related to goat body shape traits in the lambs to be screened; 2) When the genotype of the SNP marker detected in step 1) is TT, the lamb to be screened has a large body genetic trait and is retained; when the genotype detected is TA or AA, the lamb to be screened has a small body trait and is eliminated; Among them, the SNP marker related to the goat body shape trait contains a nucleotide sequence with a polymorphism of T / A at the 269th position of the sequence shown in SEQ ID NO: 1; the genotype of the site with the polymorphism is TT, corresponding to the large body shape trait, and the genotype of the site with the polymorphism is AA, corresponding to the small body shape trait.

Images