LRRK1 gene SNP (Single Nucleotide Polymorphism) molecular marker related to duck dressing percentage and application of LRRK1 gene SNP molecular marker

Abstract

The invention relates to an LRRK1 gene SNP (Single Nucleotide Polymorphism) molecular marker related to a duck slaughter rate and application thereof, and belongs to the technical field of molecular biology. Whole genome association analysis is utilized to discover that an SNP locus related to the growth traits of meat ducks exists on the NC040056.1 chromosome of the melanmen ducks for the first time, the locus obviously influences the 10-week-old dressing percentage of the melanmen ducks, and a TT genotype shows an excellent genotype. Therefore, a pair of upstream and downstream primers is provided for amplifying the flanking sequence of the molecular marker, the molecular marker is subjected to genetic typing through the flanking sequence, and molecular marker-assisted selection is implemented according to the typing result. A reliable way is provided for breeding or cultivating local sheldrake varieties with relatively high growth speed and relatively high dressing percentage, and the breeding process of meat ducks is accelerated.

Description

Technical Field

[0001] The invention relates to a LRRK1 gene SNP molecular marker associated with duck slaughter rate and application thereof, belonging to the technical field of molecular biology. Background Art

[0002] Loumen duck is famous for its excellent meat quality. It is a fast-growing variety among dual-purpose mallards. It is often used in the processing of delicacies such as Aozao noodles in southern Jiangsu, and its development and utilization prospects are great. As a dual-purpose mallard, meat performance is an important economic indicator of Loumen duck, and the slaughter rate directly determines the selling price of Loumen duck white strip meat. Therefore, how to quickly improve the slaughter rate of Loumen duck is the main research and application direction of poultry breeders. At present, the conventional breeding method is to calculate the breeding value through pedigree and phenotype, and select and match according to the size of the breeding value. This method has a certain effect in breeding practice, but when the breeding reaches a certain stage, the genetic progress will gradually decrease, and the breeding effect will gradually deteriorate. At present, with the development of molecular biology technology, individuals can be genotyped at the genome level, and molecular markers that significantly affect specific phenotypes can be mined in combination with phenotypes. These important molecular markers can be used in breeding, combined with pedigree and phenotypic values ​​for molecular marker-assisted selection to improve the selection effect. For specific varieties and specific traits, it is necessary to find molecular markers that have an important impact on the phenotype and can be quickly identified. Summary of the invention

[0003] The purpose of the present invention is to address the defects of the prior art, propose a SNP molecular marker related to duck slaughter rate and its application, and provide a reliable way for selecting or cultivating local shelduck varieties with slaughter rate.

[0004] The present invention first provides a LRRK1 gene SNP molecular marker related to duck slaughter rate, the nucleotide sequence of the molecular marker is shown in SEQ ID NO: 3 or SEQ ID NO: 4, the SNP site is located at the 3237972th site on the chromosome NC_040056.1 of Loumen duck, the base is T or C, and the genotype is TT, TC or CC. The mutation site significantly affects the slaughter rate of Loumen duck, wherein the slaughter rate of individuals with TT genotype is significantly higher than that of individuals with TC genotype and CC genotype.

[0005] The present invention determines the slaughter rate of the Loumen duck group at the market age (10 weeks old), collects blood from each individual, re-sequences the genome, and uses the GWAS method to find molecular markers significantly associated with the slaughter rate. The molecular markers and phenotypes are statistically analyzed, and the slaughter rate differences between different genotypes at this site are significant.

[0006] The present invention further provides an application of a LRRK1 gene SNP molecular marker associated with duck slaughter rate, wherein the detection method comprises the following steps: Step 1: extract the total DNA of the duck genome to be tested; Step 2: using the total genomic DNA of the duck to be tested as a template, and using the duck DNA-specific primers shown in SEQ ID NO: 1 and SEQ ID NO: 2 to perform PCR amplification to obtain an amplified product; Step 3: Sanger sequencing of the PCR product; Step 4: Determine the SNP molecular marker genotype based on the sequencing peak graph.

[0007] In step 1, the final concentration of the reaction system is calculated as follows based on 25 μl: Duck DNA to be tested 50 ng 2 x Accurate Taq Master Mix 12.5μl Upstream primer 1 μl Downstream primer 1 μl Add sterile water to 25 μl.

[0008] The sequence of the upstream primer F is shown in SEQ ID NO: 1, and the sequence of the downstream primer R The sequence is shown in SEQ ID NO: 2; The reaction conditions of the PCR amplification are: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 sec, annealing at 55°C for 30 sec, extension at 72°C for 60 sec, for a total of 30 cycles; extension at 72°C for 2 min; and storage at 20°C.

[0009] In step 4, the judgment standard is the slaughter rate of individuals with TT genotype at the SNP site. The slaughter rate was significantly higher than that of individuals with TC genotype and CC genotype.

[0010] The above method can be applied to the breeding of Loumen duck varieties. The breeding of Loumen duck varieties is the breeding of Loumen duck core groups. The Loumen duck core group is a group of individuals in the Loumen duck variety that participate in the breeding and measure the performance phenotype values ​​related to the breeding goals and are ranked in the top 20%.

[0011] The present invention uses genome-wide association analysis to find for the first time that there is a SNP site (T / C) related to the growth traits of meat ducks on the chromosome NC_040056.1 of Loumen ducks, which significantly affects the slaughter rate of Loumen ducks at 10 weeks of age, and the TT genotype is an excellent genotype. Therefore, the present invention provides a pair of upstream and downstream primers (SEQ ID NO: 1 and SEQ ID NO: 2) for amplifying the flanking sequence of the molecular marker (SEQ ID NO: 3 or SEQ ID NO: 4), genotyping the molecular marker through the flanking sequence, and implementing molecular marker-assisted selection according to the typing results, which has the beneficial effects of being able to quickly identify the slaughter rate of ducks, providing a reliable way for selecting or cultivating local Mallard duck varieties with faster growth rate and higher slaughter rate, and accelerating the breeding process of meat ducks. BRIEF DESCRIPTION OF THE DRAWINGS

[0012] Figure 1 This is the Manhattan plot of genome association analysis. The horizontal axis is chromosome, showing that a site on chromosome NC_040056.1 is significantly correlated with slaughter rate.

[0013] Figure 2 These are the peak graphs for three genotypes: TT, TC and CC. DETAILED DESCRIPTION

[0014] Example This embodiment detects the LRRK1 gene SNP molecular marker associated with duck slaughter rate according to the following method. The detection method includes the following steps: Step 1: extract the total DNA of the duck genome to be tested; Step 2: using the total genomic DNA of the duck to be tested as a template, and using the duck DNA-specific primers shown in SEQ ID NO: 1 and SEQ ID NO: 2 to perform PCR amplification to obtain an amplified product; Step 3: Sanger sequencing of the PCR product; Step 4: Determine the SNP molecular marker genotype based on the sequencing peak graph.

[0015] In step 1, the final concentration of the reaction system is calculated based on 25 μl: Duck DNA to be tested 50 ng 2 x Accurate Taq Master Mix 12.5μl Upstream primer 1 μl Downstream primer 1 μl Add sterile water to 25 μl.

[0016] The sequence of the upstream primer F is shown in SEQ ID NO: 1, and the sequence of the downstream primer R is shown in SEQ ID NO: 2; the reaction conditions for PCR amplification are 94°C pre-denaturation for 5 min; 94°C denaturation for 30 sec, 55°C annealing for 30 sec, 72°C extension for 60 sec, a total of 30 cycles; 72°C extension for 2 min; 20°C storage. Specifically: The body weight and carcass weight of 500 Loumen ducks at 10 weeks of age were measured, and the slaughter rate was calculated. After blood was collected from the wing vein, genomic DNA was extracted. The whole genome was sequenced using the HiSeq X-Ten sequencing platform of Illumina, and the sequencing depth of each individual was 10×. After the data were quality controlled, BWA and GATK software were used for sequence alignment and genotype extraction. Combined with the 10-week-old slaughter rate and genotyping data, rMVP software was used to perform GWAS analysis of mixed linear models. The results are shown in the figure. Figure 1 As shown in the results, the 3237972th site (T to C mutation) of chromosome 11 (NC_040056.1) was significantly associated with the slaughter rate of Loumen ducks at 10 weeks of age, among which the slaughter rate of TT genotype was 88.96%±1.54%, the slaughter rate of TC genotype was 85.42%±4.92%, and the slaughter rate of CC genotype was 84.39%±2.73%. The slaughter rate of TT genotype was significantly higher than that of TC genotype and CC genotype (P<0.05). The number of individuals with GG genotype, GC genotype and CC genotype were 331, 148 and 21, respectively, which was in line with the Hardy-Weinberg equilibrium law (P value was 0.4716).

[0017] Primer design for identification of nucleotide polymorphism of NC_040056.1:3237972 According to the whole genome sequencing results, primers for identifying the nucleotide polymorphism of the NC_040048.1: 100163925 site on the duck genome were designed as follows: Upstream primer: ATGCTGGCCCTGCTAAACAT (SEQ ID NO: 1) Downstream primer: ATGGGGAGAGCTTTTGCCTC (SEQ ID NO: 2) The amplified product bands are: ATGCTGGCCCTGCTAAACATACTGTGGGTTTGCCGACCTGGACTGCTCCTCGCGTGACACAGAACACTGTTTGGCTTCAGAGCTCTCTGTAATTTTGTCTCACTTGCTTTGAAAATGCTGAATTATCCAAGCATAGTCTTCAAAAAAAAATTTATTTCCTTGATTAGTGTCAGCTCCTGTAAAAGAATCACGATTCCCTCTGGATTGGATAGGCCAAAGCCCCCCTGCACTGAGAAAGCAACACCACAACCAGGCAGAGCTGCACCAGTTATACCCACCGAGCTTTACTGCTTGTACCAACCATGCCAAATTTTAGCCTGTCTAGACTACGGTGGGAGCAAATCTGAAAGATGTTTTATGCTTTGGGGCACTTACAACTCATAGACTTGGCTGTCAGGATTTTTTAATCCACTACTACCACCTCTTTGTTTAGGAAAGGAGGAGTAAGAGCTCAAAATCTCGAGAAATGCCCTCTACCTGCCATCCCTCGCCTGACGAGGACAAGGAGGTGACCCACTTCACATAAGAGTGCCCCTGGGTGCTACGGACCCACCAGACTTCGTTAGGTGCTGGTGAGGCAAAAGCTCTCCCCAT(SEQ IDNO:3) (SEQ ID NO:4) Note: The 425th base is a mutant base.

[0018] Genotyping verification of Loumen duck population Experimental materials: Groups other than those used for genome resequencing at Kunshan Loumen Duck Conservation Farm (a total of 600 ducks) The first step is to obtain the genotype of each individual 1. Determine the slaughter rate of 600 ducks at 10 weeks of age; 2. Blood sample collection: Use EDTA2K vacuum blood collection tube to collect blood from each duck's wing vein and store it at -20℃ for later use; 3. Whole blood genomic DNA extraction; 4. Genotype determination: Take the genomic DNA of each duck to be tested as a template and use the primers designed in Example 2 for PCR amplification. The obtained product is sequenced by Sanger sequencing to obtain the following sequence: Figure 2 The peak graphs of the three genotypes, TT, TC and CC, are used to determine the genotype of each individual.

[0019] Step 2: SNP site and phenotype association analysis verification 1. Grouping with different typing information: The genotype of the mutation site was checked according to the sequence information, and the genotype was divided into TT genotype group, TC genotype group and CC genotype group, with 401, 180 and 19 in each group, respectively. The genotype distribution conformed to the Hardy-Weinberg equilibrium law (P value was 0.890).

[0020] 2. The slaughter rates of TT, TC and CC genotype groups at 10 weeks of age were 89.73%±2.37%, 84.28%±3.55% and 85.11%±2.88%, respectively. A variance analysis of the 10-week-old slaughter rates of different genotype groups showed that genotype differences were significantly correlated with the slaughter rates, among which the slaughter rate of the TT genotype group was significantly higher than that of the TC and GC genotype groups, indicating that the TT genotype is an excellent genotype for the slaughter rate trait, and the homozygous TT genotype at this locus can significantly improve the slaughter rate of Loumen ducks at 10 weeks of age.

[0021] In addition to the above implementations, the present invention may also have other implementations. Any technical solution formed by equivalent replacement or equivalent transformation falls within the protection scope required by the present invention.

Claims

1. A SNP molecular marker of LRRK1 gene associated with duck slaughter rate, characterized in that: The nucleotide sequence of the molecular marker is shown in SEQ ID NO: 3 or SEQ ID NO:

4. The SNP molecular marker is located at position 3237972 on chromosome NC_040056.1 of the Loumen duck reference genome, the base is T or C, and the genotype is TT, TC or CC.

2. The use of the LRRK1 gene SNP molecular marker associated with duck slaughter rate according to claim 1, characterized in that: Used for molecular detection of slaughter rate of Loumen duck breed at 10 weeks of age, the nucleotide sequence of duck DNA specific primer pair required for molecular marker detection is shown as SEQ ID NO: 1 and SEQ ID NO: 2, and the nucleotide sequence of the molecular marker is shown as SEQ ID NO: 3 or SEQ ID NO:

4.

3. The use of the LRRK1 gene SNP molecular marker associated with duck slaughter rate according to claim 2, characterized in that: The detection method comprises the following steps, Step 1: extract the total DNA of the duck genome to be tested; Step 2: using the total genomic DNA of the duck to be tested as a template, and using the duck DNA-specific primers shown in SEQ ID NO: 1 and SEQ ID NO: 2 to perform PCR amplification to obtain an amplified product; Step 3: Sanger sequencing of the PCR product; Step 4: Determine the SNP molecular marker genotype based on the sequencing peak graph.

4. The use of the LRRK1 gene SNP molecular marker associated with duck slaughter rate according to claim 3, characterized in that: In step 1, the final concentration of the reaction system is calculated as follows based on 25 μl: Duck DNA to be tested 50 ng 2 x Accurate Taq Master Mix 12.5μl Upstream primer 1 μl Downstream primer 1 μl Add sterile water to 25 μl; The sequence of the upstream primer F is shown in SEQ ID NO: 1, and the sequence of the downstream primer R is shown in SEQ ID NO: 2; The reaction conditions of the PCR amplification are: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 sec, annealing at 55°C for 30 sec, extension at 72°C for 60 sec, for a total of 30 cycles; extension at 72°C for 2 min; and storage at 20°C.

5. The use of the LRRK1 gene SNP molecular marker associated with duck slaughter rate according to claim 3, characterized in that: In the step 4, the judgment criterion is that the slaughter rate of individuals with TT genotype at the SNP site is significantly higher than the slaughter rate of individuals with TC genotype and CC genotype.

6. The use of the LRRK1 gene SNP molecular marker associated with duck slaughter rate according to claim 2, characterized in that: The breeding of Loumen duck breed is the breeding of the core group of Loumen duck.

7. The use of the LRRK1 gene SNP molecular marker associated with duck slaughter rate according to claim 6, characterized in that: The Loumen duck core group is a group composed of the top 20% of individuals in the Loumen duck breed that participated in the breeding and measurement of performance phenotypic values ​​related to the breeding objectives.

Images