Probe primer combination and kit for rapidly detecting five kinds of diarrheogenic Escherichia coli

Abstract

The invention discloses a probe primer combination and a kit for rapidly detecting five kinds of diarrheogenic Escherichia coli. The method comprises the following steps: respectively designing a group of specific primers and Taqman probes according to escV, stx1, stx2 and bfp genes of EPEC and STEC / EHEC, an ipaH gene of EIEC, lt, stp and sth genes of ETEC, and aggR, pic and astA genes of EAEC; the kit can be used for detecting various diarrheogenic Escherichia coli in a single tube at the same time, or can be used for detecting five kinds of diarrheogenic Escherichia coli in different reaction tubes within 30 minutes at the soonest, can meet higher sensitivity, and has definite clinical significance and potential application value.

Description

Technical Field

[0001] The present invention belongs to the technical field of nucleic acid detection, and relates to a probe and primer combination and a kit for rapidly detecting five types of diarrhea-causing Escherichia coli; specifically, it relates to a probe and primer combination and a kit for detecting nucleic acids of enteropathogenic Escherichia coli (EPEC), enteroinvasive Escherichia coli (EIEC), enterotoxigenic Escherichia coli (ETEC), Shiga toxin-producing Escherichia coli (STEC) / enterohemorrhagic Escherichia coli (EHEC), and enteroaggregative Escherichia coli (EAEC). Background Art

[0002] Escherichia coli (Escherchiacol) is a gram-negative, medium-sized rod with no obvious capsule, spores, and flagella that can move. However, there are also variants without flagella and no movement. Diarrhea-causing Escherichia coli (DEC) is a general term for a type of Escherichia coli that can cause diarrhea in humans. Common diarrhea-causing Escherichia coli include: enterotoxigenic Escherichia coli (ETEC), enterohemorrhagic Escherichia coli (EHEC), enteropathogenic Escherichia coli (EPEC), enteroinvasive Escherichia coli (EIEC), and enteroaggregative Escherichia coli (EAEC).

[0003] EPEC can cause adhesion and wiping damage to the host's intestinal mucosal epithelial cells, and does not produce Shiga toxin. It is the main pathogen of diarrhea in infants and young children, is highly contagious, and can be fatal in severe cases; EIEC can invade intestinal epithelial cells and cause dysentery-like diarrhea; ETEC can secrete heat-stable enterotoxins and / or heat-labile enterotoxins, which can cause diarrhea in infants and young children and travelers, generally presenting as mild watery diarrhea, or severe cholera-like symptoms, with low fever or no fever, and diarrhea is often self-limiting, generally healing in 2 to 3 days. STEC can secrete Shiga toxins, cause adhesion and wiping damage to the host's intestinal mucosal epithelial cells, and some of them cause human hemorrhagic colitis (HC) or bloody diarrhea in clinical practice, and can further develop into hemolytic uremic syndrome (HUS); EAEC does not invade intestinal epithelial cells, but can cause intestinal fluid accumulation, does not produce heat-stable enterotoxins or heat-labile enterotoxins, and does not produce Shiga toxins.

[0004] There are many methods for detecting five types of diarrhea-causing Escherichia coli, mainly including virus culture, serological testing and molecular biology testing. Among them, virus culture and serological testing are time-consuming, low in sensitivity, time-consuming and labor-intensive, have high culture requirements and are prone to false negatives. Real-time fluorescence PCR technology is mature, easy to operate, has a short detection time, high sensitivity and good specificity. It is widely used in the detection and typing of Escherichia coli in laboratories. It is also the confirmation method for food microbiology testing of diarrhea-causing Escherichia coli recommended by the National Health Commission. However, in the detection of diarrhea-causing Escherichia coli, two or more tubes of reaction solution or the gene chip method are usually used, and the entire PCR amplification time needs to be more than one hour, which makes it impossible to quickly detect and type multiple diarrhea-causing Escherichia coli in the same reaction tube or different reaction tubes. Summary of the invention

[0005] In view of the problems existing in the above-mentioned prior art, the present invention proposes a primer-probe combination and a kit for detecting five intestinal diarrhea-causing Escherichia coli and typing based on multiple fluorescence PCR technology, which can realize the simultaneous detection of multiple diarrhea-causing Escherichia coli in a single tube, or can quickly realize the typing detection of five diarrhea-causing Escherichia coli in different reaction tubes within 30 minutes at the fastest, and can meet high sensitivity, with clear clinical significance and potential application value. Specifically, a probe and primer combination for rapid detection of enteropathogenic Escherichia coli (EPEC), enteroinvasive Escherichia coli (EIEC), enterotoxigenic Escherichia coli (ETEC), Shiga toxin-producing Escherichia coli (STEC) / enterohemorrhagic Escherichia coli (EHEC), and enteroaggregative Escherichia coli (EAEC) based on multiple fluorescence PCR technology and hydrolysis probe technology is provided, which can simultaneously and rapidly detect EPEC, EIEC, ETEC, STEC / EHEC, and EAEC in a single or three reaction systems in the same experiment.

[0006] According to the escV, stx1, stx2, bfp genes of EPEC and STEC / EHEC, the ipaH gene of EIEC, the lt, stp, sth genes of ETEC, and the aggR, pic, astA genes of EAEC, a group of specific primers and Taqman probes are designed respectively, and EPEC, EIEC, ETEC, STEC / EHEC, and EAEC are quickly distinguished according to the real-time amplification curve. At the same time, the present invention sets an internal standard, which is the uidA gene shared by EPEC, EIEC, ETEC, STEC / EHEC, and EAEC, which can effectively avoid false negatives in the test results, and monitor the collection, transportation, and extraction processes of the test samples. In order to realize the rapid typing detection of five diarrhea-causing Escherichia coli within about 30 minutes, in addition to the above-mentioned primer probe pairs, a Taq-DNA enzyme capable of rapid amplification and extension is preferably used.

[0007] In order to achieve the above object, the technical solution adopted by the present invention is as follows: The present invention provides a primer-probe combination for detecting enteric diarrheagenic Escherichia coli and typing based on multiplex fluorescence PCR technology, wherein primers and Taqman probe groups are designed according to escV, stx1, stx2, and bfp genes of EPEC and STEC / EHEC, ipaH gene of EIEC, lt, stp, and sth genes of ETEC, and aggR, pic, and astA genes of EAEC, respectively, and the combination includes: Primer pairs for detection of escV gene: SEQ ID No.1: GGAAAACAAATGAGTATTGATGGT SEQ ID No.2: AAACTGGCTTCCTTTTGCA; Primer pairs for detecting stx1 gene: SEQ ID No.3: GCGTTCTTATGTAATGACTGCT SEQ ID No.4: CACGAACAGAGTCTTGTCCAT; Primer pairs for detecting stx2 gene: SEQ ID No.5: GTCGTCACTCACTGGTTTCAT SEQ ID No.6: GGATGCATCTCTGGTCATTGTA; Primer pairs for detecting the bfp gene: SEQ ID No.7: GGTCTGTCTTTGATTGAATCT SEQ ID No.8: CGTTGCGCTCATTACTTC; Primer pairs for detecting the ipaH gene: SEQ ID No.9:TCTTTCGCTGTTTGCTGCTG SEQ ID No.10: CTGATGGACCAGGAGGGTT; Primer pairs for detecting lt gene: SEQ ID No.11: AATTTCCACAACCTTGTGGT SEQ ID No.12: TTACAGATTAGCAGGTTTCCC; Primer pairs for detecting stp gene: SEQ ID No.13: GTGATGTTGTAAAAAACAACAGTG SEQ ID No.14: GCACAGGCAGGATTACAAC; Primer pairs for detecting sth gene: SEQ ID No.15: CGCTCAGGATGCTAAACC SEQ ID No.16: GCAGGATTACAACACAATTCAC; Primer pairs for detecting aggR gene: SEQ ID No.17:ATCGCAATCAGATTAAGCA SEQ ID No.18: CGGACAACTGCAAGCA; Primer pairs for detecting pic gene: SEQ ID No.19: CCGCTTCTATATTCTGAAATCT SEQ ID No.20: TCTGAACTGCTTTGTTTTGT; Primer pair for detecting astA gene: SEQ ID No.21:ACAGCCTGCGCTTCGT SEQ ID No.22: TCCGTGGGAGCCTGATAA; as well as, Probe for detecting escV gene SEQ ID No. 25: AGCGAAGAACTTTTGCCTCAAGC; Probe for detecting stx1 gene SEQ ID No. 26: AGGCAGGACACTACTCAACCTT; Probe for detecting stx2 gene SEQ ID No. 27: ATCTGGCGTTAATGGAGTTCAGT; Probe for detecting bfp gene SEQ ID No. 28: CGCTTGCTGCCACCGTTA; Probe for detecting ipaH gene SEQ ID No. 29: TGTCGCGCTCACATGGAACAA; Probe for detecting lt gene SEQ ID No. 30: GGAGAGAAGAACCCTGGATTCATC; Probe for detecting stp gene SEQ ID No. 31: TCACAGCAGTAAAATGTGTTGTTCA; Probe for detecting sth gene SEQ ID No. 32: TGCTACTATTCATGCTTTCAGGAC; Probe for detecting aggR gene SEQ ID No. 33: ACATTAAGACGCCTAAAGGATGCC; Probe for detecting pic gene SEQ ID No. 34: CGGCTCAGTGGGAATTTGTT; The probe used to detect astA gene is SEQ ID No. 35: TGGAAGGACTACAAAGCCGTCAC.

[0008] As an embodiment of the present invention, it also includes: Primer pairs for detecting uidA gene: SEQ ID No.23: AGCCAGACAGAGTGTGATATCT SEQ ID No.24: AACGGTTTGTGGTTAATCA; The probe used to detect the uidA gene is SEQ ID No. 36: TCGGCATCCGGTCAGT.

[0009] As an embodiment of the present invention, the two ends of the specific probe respectively carry a fluorescent group and a quenching group, wherein the fluorescent group is selected from any one or more of FAM, HEX, VIC, JOE, TET, TAMRA, ROX, QUASAR705, ATTO425, AF405, CY3.5, CY5 or CY7; the quenching group is selected from any one or more of BHQ0, BHQ1, BHQ2, BHQ3, DABCYL and MGB.

[0010] The invention also provides a kit comprising the primer-probe combination.

[0011] As an embodiment of the present invention, the kit includes a detection solution and a nucleic acid amplification reaction solution; The detection solution includes TE buffer and / or RNase-free water and the primer-probe combination; The nucleic acid amplification reaction solution includes PCR buffer, MgCl2, dNTPs, DNA polymerase and UNG enzyme.

[0012] As an embodiment of the present invention, in the detection solution, the concentration of the primer probe (SEQ ID No.29 is 0.1-0.6 μM; the concentration of SEQ ID No.25, SEQ ID No.33, and SEQ ID No.36 is 0.1-0.4 μM; the concentration of SEQ ID No.30 is 0.1-0.4 μM; the concentration of SEQ ID No.1, SEQ ID No.2, SEQ ID No.3, SEQ ID No.4, SEQ ID No.5, SEQ ID No.6, SEQ ID No.7, SEQ ID No.8, SEQ ID No.9, SEQ ID No.10, SEQ ID No.11, SEQ ID No.12, SEQ ID No.13, SEQ ID No.14, SEQ ID No.26, and SEQ ID No.28 is 0.1-0.6 μM; the concentration of SEQ ID No.15, SEQ ID No.16, SEQ ID No.17, SEQ ID No.18, SEQ ID No.23, SEQ ID No.24, SEQ ID The concentrations of SEQ ID No. 27 and SEQ ID No. 31 are 0.1-0.6 μM; the concentrations of SEQ ID No. 19, SEQ ID No. 20, SEQ ID No. 21, SEQ ID No. 22, and SEQ ID No. 35 are 0.1-0.6 μM).

[0013] As an embodiment of the present invention, the nucleic acid amplification reaction solution includes PCR buffer, 1-6 mM MgCl2, 0.1-0.4 mM dNTPs (dATP: dTTP: dCTP: dGTP: dUTP=1:1:1:1:1), DNA polymerase, and UNG enzyme.

[0014] As an embodiment of the present invention, the UNG enzyme in the nucleic acid amplification reaction solution is selected from the AIN-Robust DNA qPCR Mix (UNG) enzyme system. The present invention can achieve single-tube or rapid detection by combining specific primer probes with the amplification system.

[0015] As an embodiment of the present invention, the kit also includes a positive control and a blank control, the positive control is an artificially synthesized escV, stx1, stx2, bfp, ipaH, lt, stp, sth, aggR, pic, astA and uidA gene sequence fragment, and the blank control is RNase-free water.

[0016] As an embodiment of the present invention, the positive control is an escV gene sequence fragment shown in SEQ ID No.37, an stx1 gene sequence fragment shown in SEQ ID No.38, an stx2 gene sequence fragment shown in SEQ ID No.39, a bfp gene sequence fragment shown in SEQ ID No.40, an ipaH gene sequence fragment shown in SEQ ID No.41, a lt gene sequence fragment shown in SEQ ID No.42, a stp gene sequence fragment shown in SEQ ID No.43, an sth gene sequence fragment shown in SEQ ID No.44, an aggR gene sequence fragment shown in SEQ ID No.45, a pic gene sequence fragment shown in SEQ ID No.46, an astA gene sequence fragment shown in SEQ ID No.47, and a uidA gene sequence fragment shown in SEQ ID No.48.

[0017] As an embodiment of the present invention, in the kit, the probes are respectively labeled in a single tube of detection solution, wherein: Group A: SEQ ID No. 25, Group B: SEQ ID No.26 and SEQ ID No.27, Group C: SEQ ID No. 28, Group D: SEQ ID No. 29, Group E: SEQ ID No.30~SEQ ID No.32, Group F: SEQ ID No.33~SEQ ID No.35, Group G: SEQ ID No. 36; Each set of probes is labeled with a different fluorescent group.

[0018] As one embodiment of the present invention, the SEQ ID No.25 probe is labeled with a FAM fluorescent group, the SEQ ID No.26 and SEQ ID No.27 probes are labeled with a VIC or HEX fluorescent group, the SEQ ID No.28 probe is labeled with a ROX fluorescent group, the SEQ ID No.29 probe is labeled with a QUASAR 705 fluorescent group, the SEQ ID No.30 to SEQ ID No.32 probes are labeled with an ATTO 425 fluorescent group, the SEQ ID No.33 to SEQ ID No.35 probes are labeled with a CY7 fluorescent group, and the SEQ ID No.36 probe is labeled with a CY5 fluorescent group.

[0019] As an embodiment of the present invention, in the kit, the probes are separately labeled in three tubes of detection solution, wherein: Tube A: primers of SEQ ID No.1 to SEQ ID No.8, probes of SEQ ID No.25 to SEQ ID No.28; Tube B: primers SEQ ID No.9 to SEQ ID No.16, probes SEQ ID No.29 to SEQ ID No.32; Tube C: primers of SEQ ID No.17 to SEQ ID No.24, probes of SEQ ID No.33 to SEQ ID No.36; The probes in each tube were labeled with FAM, VIC, ROX and CY5 fluorescent groups respectively.

[0020] The present invention also provides an application of the kit in rapid typing and identification of EPEC, EIEC, ETEC, STEC / EHEC and EAEC.

[0021] The present invention also provides a method for rapidly detecting five types of diarrhea-causing Escherichia coli, which specifically comprises the following steps: (1) Extraction of template DNA: Sample nucleic acid was extracted using the nucleic acid extraction or purification reagent of Jiangsu ShuoShi Biotechnology Co., Ltd., and the sample nucleic acid DNA volume was prepared to 60 μL.

[0022] (2) Prepare the reagent reaction system of 25 μL. The composition of the reaction system is shown in Table 1: Table 1 Reaction system

[0023] The detection solution includes TE buffer or RNase-free water, primer probes (the concentration of SEQ ID No.29 is 0.1-0.6 μM; the concentration of SEQ ID No.25, SEQ ID No.33, and SEQ ID No.36 is 0.1-0.4 μM; the concentration of SEQ ID No.30 is 0.1-0.4 μM; the concentration of SEQ ID No.1, SEQ ID No.2, SEQ ID No.3, SEQ ID No.4, SEQ ID No.5, SEQ ID No.6, SEQ ID No.7, SEQ ID No.8, SEQ ID No.9, SEQ ID No.10, SEQ ID No.11, SEQ ID No.12, SEQ ID No.13, SEQ ID No.14, SEQ ID No.26, and SEQ ID No.28 is 0.1-0.6 μM; the concentration of SEQ ID No.15, SEQ ID No.16, SEQ ID No.17, SEQ ID No.18, SEQ ID No.23, SEQ ID No.24, SEQ ID The concentrations of SEQ ID No.27 and SEQ ID No.31 are 0.1-0.6 μM; the concentrations of SEQ ID No.19, SEQ ID No.20, SEQ ID No.21, SEQ ID No.22, and SEQ ID No.35 are 0.1-0.6 μM).

[0024] The probes of the 12 virulence genes can be separately labeled in a single tube of detection solution (SEQ ID No.25 is labeled with a fluorescent group, SEQ ID No.26 and SEQ ID No.27 are labeled with the same fluorescent group, SEQ ID No.28 is labeled with a fluorescent group, SEQ ID No.29 is labeled with a fluorescent group, SEQ ID No.30 to SEQ ID No.32 are labeled with the same fluorescent group, SEQID No.33 to SEQ ID No.35 are labeled with the same fluorescent group, and SEQ ID No.36 is labeled with a fluorescent group), or they can be separately labeled in three tubes of detection solution.

[0025] The nucleic acid amplification reaction solution includes PCR buffer, 1-6 mM MgCl2, 0.1-0.4 mM dNTPs (dATP: dTTP: dCTP: dGTP: dUTP=1:1:1:1:1), DNA polymerase, and UNG enzyme.

[0026] Furthermore, it also includes a positive control and a blank control. The positive control is artificially synthesized gene sequence fragments of escV, stx1, stx2, bfp, ipaH, lt, stp, sth, aggR, pic, astA and uidA, and the blank control is RNase-free water.

[0027] (3)Set the fluorescence PCR amplification program Perform PCR amplification in the SLAN-96H or QuantStudio TM 5 fluorescence quantitative PCR instrument in fast mode: 37°C for 2 min; 95°C for 30 s; 95°C for 1 - 10 s, 58 - 60°C for 10 - 20 s, for a total of 40 - 45 cycles; (4)Result interpretation: Positive and negative determination: If the amplification curve is S-shaped and the Ct value ≤ 35, it is determined as positive; if the Ct value > 38, it is determined as negative or not detected; if 35 < Ct ≤ 38, it needs to be retested. If the Ct value is still in this range and the curve is a standard S shape with an obvious exponential growth phase, it is determined as positive, otherwise it is determined as negative.

[0028] When the blank control is detected negative and the positive control is detected positive, if the test sample is detected positive, the result is determined as positive for the pathogen nucleic acid; when the blank control is detected negative and the positive control is detected positive, if the test sample is detected negative, the result is determined as negative for the pathogen nucleic acid.

[0029] Determination of five types of diarrheagenic Escherichia coli: If the uidA gene is positive, the escV gene is positive, or the bfp gene is simultaneously positive, and the stx1 and stx2 genes are negative, it is determined as positive for EPEC; if the uidA gene is positive, and one or more of the stx1 gene and stx2 gene are positive, or the escV gene is simultaneously positive and the bfp gene is negative, it is determined as STEC / EHEC; if the uidA gene is positive and the ipaH gene is positive, it is determined as positive for EIEC; if the uidA gene is positive, and one or more of the lt gene, stp gene, and sth gene are positive, it can be determined as ETEC; if the uidA gene is positive, and one or more of the aggR gene, pic gene, and astA gene are positive, it can be determined as EAEC.

[0030] Compared with the prior art, the present invention has the following beneficial effects: 1. By designing primer and probe compositions for multiple types of diarrheagenic Escherichia coli, using multiplex fluorescence PCR technology and hydrolysis probe technology, simultaneously labeling multiple different fluorescent groups, and using the Hongshi SLAN-96H fluorescence PCR amplification system, the present invention can achieve qualitative typing detection of five types of diarrheagenic Escherichia coli at the nucleic acid level in a single-tube reaction solution.

[0031] 2. It is preferred to use a fast-extending DNA amplification enzyme system by setting a fast amplification program: 37°C 2min; 95°C 30s; 95°C 1-10s, 58-60°C 10-20s, for a total of 40 cycles; the typing test of five diarrheagenic Escherichia coli can be completed quickly in about 30 minutes at the fastest.

[0032] 3. Perform one or more targets of diarrhea-causing Escherichia coli simultaneously to prevent missed detection and avoid the occurrence of false positives. In addition, in the prior art, only the aggR target gene is used in the design and result interpretation of the typing detection of enteroaggregative Escherichia coli (EAEC), which may cause missed detection of pic or astA genes. The present invention sets the Escherichia coli uidA gene as an internal standard, and monitors the collection, transportation and extraction of the sample to be tested through the internal standard to avoid false negatives in the test results.

[0033] 4. Based on the specific amplification of 12 targets of five diarrhea-causing Escherichia coli, it can be detected in a single tube or simultaneously in three reaction systems. Each reaction system detects four channels, which can effectively and quickly identify five diarrhea-causing Escherichia coli, while meeting the requirements of high sensitivity, strong specificity and low cost. BRIEF DESCRIPTION OF THE DRAWINGS

[0034] Other features, objects and advantages of the present invention will become more apparent from the detailed description of non-limiting embodiments made with reference to the following drawings: Figure 1 It is a pathogen-specific result for detecting five types of diarrhea-causing Escherichia coli; Figure 2 It is the typing test result of enteropathogenic Escherichia coli (EPEC); Figure 3 It is the typing test result of enteroinvasive Escherichia coli (EIEC); Figure 4 It is the typing test result of enterotoxigenic Escherichia coli (ETEC); Figure 5 It is the typing test result of enterohemorrhagic Escherichia coli (EHEC); Figure 6 It is the typing test result of enteroaggregative Escherichia coli (EAEC); Figure 7 It is the result of the sensitivity test of enteroaggregative Escherichia coli (EAEC). DETAILED DESCRIPTION

[0035] The present invention is described in detail below in conjunction with embodiments. The following embodiments will help those skilled in the art to further understand the present invention, but are not intended to limit the present invention in any form. It should be noted that, for those of ordinary skill in the art, some adjustments and improvements can also be made without departing from the concept of the present invention. These all belong to the protection scope of the present invention.

[0036] Example 1: Single-tube detection of five types of diarrhea-causing Escherichia coli 1) Design of specific primers and probes for single-tube detection The escv, stx1, stx2, bfp, ipaH, lt, stp, sth, aggR, pic, astA genes and the uidA internal standard gene for specific amplification of EPEC, EIEC, ETEC, STEC / EHEC, and EAEC were downloaded through NCBI search, and specific amplification primers and Taqman probes for the above-mentioned diarrheagenic Escherichia coli were designed using PrimerPremier 5.0 or Primer 3 software, which were synthesized by Shanghai Shuoying Biotechnology Co., Ltd. The escv probe numbered SEQ ID No.25 is labeled with a FAM fluorescent group, the stx1 numbered SEQ ID No.26 and the stx2 numbered SEQ ID No.27 are labeled with a VIC or HEX fluorescent group, the bfp probe numbered SEQ ID No.28 is labeled with a ROX fluorescent group, the ipaH probe numbered SEQ ID No.29 is labeled with a QUASAR 705 fluorescent group, the lt, stp, and sth probes numbered SEQ ID No.30 to SEQ ID No.32 are labeled with an ATTO425 fluorescent group, the aggR, pic, and astA probes numbered SEQ ID No.33 to SEQ ID No.35 are labeled with a CY7 fluorescent group, and the uidA probe numbered SEQ ID No.36 is labeled with a CY5 fluorescent group. The primer and probe sequences used for detection are shown in Table 2: Table 2 Primer and probe sequence information

[0037] The primers and probes involved in the present invention are obtained through multiple screening and verification. This embodiment uses aggR, pic, astA and uidA genes as examples for verification. Two sets of primer probes are designed for aggR, pic, astA and uidA internal standard genes, as shown in Table 3 below (Group 1 and Group 2). Select the rapid amplification enzyme system AIN-Robust DNA qPCR Mix (UNG), item number CSMix-005 and the ordinary amplification enzyme system HSAI Taq DNA Polymerase, item number CSEN-005, respectively. Primer probe reaction liquid group 1 and group 2 are combined with the rapid amplification enzyme system and the ordinary amplification enzyme system, respectively, that is, combination one: primer probe reaction liquid group 1 + rapid amplification enzyme system, combination two: primer probe reaction liquid group 1 + ordinary amplification enzyme system, combination three: primer probe reaction liquid group 2 + rapid amplification enzyme system, combination four: primer probe reaction liquid group 2 + ordinary amplification enzyme system. The artificially synthesized fragments of the internal standard genes aggR, pic, astA and uidA were amplified and detected under the above amplification program under the four system combinations. The results are shown in Table 4 below. The combination of primer probe set 1 + rapid amplification enzyme system has an earlier Ct value for detecting each target, and the detection effect is significantly better than other combinations.

[0038] Table 3 Primer probe sequences of different combinations

[0039] Table 4 Verification comparison results under different system combinations

[0040] 2) Sample nucleic acid extraction Clinical sample collection, storage and transportation: Applicable to stool samples (or after enrichment). When collecting and storing samples, cross contamination between samples should be avoided and the samples should be sealed for testing. If the test cannot be performed immediately, the sample should be placed in Cary-Blair transport medium and sent for testing under refrigerated conditions; or the stool sample should be directly inoculated into the enrichment medium and shipped at room temperature. For detailed steps, refer to the WS271-2007 standard for operation.

[0041] Nucleic acid extraction: Sample nucleic acid was extracted using the nucleic acid extraction or purification kit of Jiangsu ShuoShi Biotechnology Co., Ltd. according to the instructions.

[0042] 3) Perform PCR test on the extracted sample nucleic acid Prepare the amplification reaction system according to Table 5: Table 5 Amplification reaction system preparation table

[0043] The detection solution includes escv, stx1, stx2, bfp, ipaH, lt, stp, sth, aggR, pic, astA genes and uidA internal standard gene primer probe (the concentration of SEQ ID No.29 is 0.1 μM; the concentration of SEQ ID No.25, SEQ ID No.33, and SEQ ID No.36 is 0.2 μM; the concentration of SEQ ID No.30 is 0.3 μM; the concentration of SEQ ID No.1, SEQ ID No.2, SEQ ID No.3, SEQ ID No.4, SEQ ID No.5, SEQ ID No.6, SEQ ID No.7, SEQ ID No.8, SEQID No.9, SEQ ID No.10, SEQ ID No.11, SEQ ID No.12, SEQ ID No.13, SEQ ID No.14, SEQID No.26, and SEQ ID No.28 is 0.4 μM; the concentration of SEQ ID No.15, SEQ ID No.16, SEQ ID No.17, SEQ ID No.18 is 0.5 μM; the concentration of SEQ ID No.19, SEQ ID No.20, SEQ ID No.21, SEQ ID No.22, SEQ ID No.23, SEQ ID No.24, SEQ ID No.25 The concentration of SEQ ID No.18, SEQ ID No.23, SEQ ID No.24, SEQ ID No.27, and SEQ ID No.31 is 0.5 μM; the concentration of SEQ ID No.19, SEQ ID No.20, SEQ ID No.21, SEQ ID No.22, and SEQ ID No.35 is 0.6 μM) and RNase-free water.

[0044] The nucleic acid amplification reaction solution includes PCR buffer, 3mM MgCl2, 0.1-0.4mM dNTPs (dATP: dTTP: dCTP: dGTP: dUTP=1:1:1:1:1), DNA polymerase, and UNG enzyme.

[0045] PCR amplification was performed on a Shanghai Hongshi SLAN-96H fluorescence quantitative PCR instrument according to the following procedure: 37°C for 2 min; 95°C for 5 min; 95°C for 5 s, 58°C for 20 s to collect fluorescence, for a total of 40 cycles. The temperature control mode of the SLAN-96H instrument was selected as fast temperature control, and the channels were selected as FAM, VIC, ROX, CY5, QUASAR 705, ATTO 425, and CY7.

[0046] 4) Result analysis According to the amplification of the internal standard, it is determined whether the sample contains the diarrheagenic Escherichia coli to be detected. According to the type of fluorescence channel corresponding to each target, the type of diarrheagenic Escherichia coli infected is determined. The determination results corresponding to each type are shown in Table 6: Table 6 Results interpretation

[0047] 5) Specificity analysis The above reaction system was used to detect other common pathogens (Yersinia enterocolitica, Yersinia pseudotuberculosis, Campylobacter jejuni, Campylobacter coli, Vibrio parahaemolyticus, rotavirus, norovirus, and saprovirus) and total nucleic acid of human leukocytes with the same infection site or similar infection symptoms. The test results are shown in the attached Figure 1 (The corresponding genes of each channel are the same as those in Table 4). When five diarrhea-causing Escherichia coli positive controls were detected, the amplification results of 12 virulence genes were all positive. When other pathogens other than the five diarrhea-causing Escherichia coli were detected, there were no corresponding amplification curves and no cross-reactions. This indicates that the primer-probe combination for rapid typing detection of five diarrhea-causing Escherichia coli according to the present invention has good specificity.

[0048] 6) Accuracy analysis The five diarrheagenic Escherichia coli purchased by BNCC: BNCC340977 (EPEC), BNCC340975 (EIEC), BNCC337272 (ETEC), BNCC345676 (EHEC), and BNCC340663 (EAEC) were extracted and amplified using the 12 primer-probe combinations designed by the present invention and the above detection method. The results are shown in the attached figure. Figure 2 -Attached Figure 6 (The corresponding genes of each channel are the same as Table 4). For BNCC340977 (EPEC): when udiA is positive, escv and bfp genes are detected as positive, stx1 and stx2 genes are negative, and the result is interpreted as EPEC; for BNCC340975 (EIEC): when udiA is positive, ipaH gene is detected as positive, and the result is interpreted as EIEC; for BNCC337272 (ETEC): when udiA is positive, lt / stp / sth gene channels are detected as positive, and the result is interpreted as ETEC; for BNCC345676 (EHEC): when udiA is positive, escv gene is detected as positive, stx1 / stx2 genes are positive, bfp gene is negative, and the result is interpreted as EHEC; for BNCC340663 (EAEC): when udiA is positive, aggR / pic / astA gene channels are detected as positive, and the result is interpreted as EAEC. Therefore, the primer-probe combination of the present invention can accurately type enteropathogenic Escherichia coli, enteroinvasive Escherichia coli, enterotoxigenic Escherichia coli, enterohemorrhagic Escherichia coli and enteroaggregative Escherichia coli.

[0049] Example 2: Rapid typing detection of five diarrhea-causing Escherichia coli using three tubes A method for rapidly detecting five types of diarrheagenic Escherichia coli comprises a nucleic acid amplification reaction solution, a tube A detection solution, a tube B detection solution, a tube C detection solution, a tube A positive control, a tube B positive control, a tube C positive control and a negative control.

[0050] 1) Composition and preparation of three-tube test solution The above-designed primers and Taqman probes for specific amplification of escv, stx1, stx2, bfp, ipaH, lt, stp, sth, aggR, pic, astA genes of EPEC, EIEC, ETEC, STEC / EHEC, and EAEC, as well as the uidA internal standard gene, were synthesized by Shanghai Shuoying Biotechnology Co., Ltd. The detection solution in tube A contains primers of SEQ ID No.1 to SEQ ID No.8 at a concentration of 0.4 μM and probes of SEQ ID No.25 to SEQ ID No.28 at a concentration of 0.2 μM, and the probes are respectively labeled with FAM, VIC, ROX and CY5 fluorescent groups; the detection solution in tube B contains primers of SEQ ID No.9 to SEQ ID No.16 at a concentration of 0.4 μM and probes of SEQ ID No.29 to SEQ ID No.32 at a concentration of 0.2 μM, and the probes are respectively labeled with FAM, VIC, ROX and CY5 fluorescent groups; the detection solution in tube C contains primers of SEQ ID No.17 to SEQ ID No.24 at a concentration of 0.4 μM and probes of SEQ ID No.33 to SEQ ID No.36 at a concentration of 0.2 μM, and the probes are respectively labeled with FAM, VIC, ROX and CY5 fluorescent groups.

[0051] 2) Optimization of rapid amplification enzyme system In order to achieve rapid detection of five types of diarrhea-causing Escherichia coli, a DNA enzyme system that can support the rapid amplification and extension of 12 gene primer probes for identifying five types of diarrhea-causing Escherichia coli was screened through experiments. A total of three different directed mutagenesis Taq enzyme systems were selected to perform amplification detection on artificially synthesized positive controls, among which the AIN-Robust DNA qPCR Mix (UNG) enzyme system can quickly complete the typing detection of five types of diarrhea-causing Escherichia coli within 30 minutes at the fastest under the primer probe combination of the present invention, and has stable performance.

[0052] 3) Detection of five types of diarrhea-causing Escherichia coli The above extraction method was used to extract nucleic acid from the sample. The reaction system was prepared in three tubes. The reaction solution in tube A contained 12.5 μL of nucleic acid amplification reaction solution, 7.5 μL of detection solution in tube A, and 5 μL of sample nucleic acid; the reaction solution in tube B contained 12.5 μL of nucleic acid amplification reaction solution, 7.5 μL of detection solution in tube B, and 5 μL of sample nucleic acid; the reaction solution in tube C contained 12.5 μL of nucleic acid amplification reaction solution, 7.5 μL of detection solution in tube C, and 5 μL of sample nucleic acid. The total system of the three reaction solutions in tubes A / B / C was 25 μL each.

[0053] QuantStudio TM 5. Select "Fast" mode under "Run mode" in the "Experiment Properties" interface of the fluorescence quantitative PCR instrument. The specific program settings are as follows: 37℃ 2min; 95℃ 30s; 95℃ 5s, 58℃ 10s, for a total of 40 cycles; 4) Sensitivity analysis The synthetic gene containing the target fragment of enteroaggregative Escherichia coli was diluted in a 10-fold gradient, and the PCR amplification system of the present invention was used to analyze the minimum detection limit of its detection. The amplification can be completed quickly within 30 minutes. The amplification results are shown in the attached Figure 7 , it can be seen from the detection amplification graph that when the concentration of the artificially synthesized gene fragment is greater than or equal to 4.0×10 2 When the number of copies / mL was 1.0×10-1, the corresponding enteroaggregative Escherichia coli EAEC could be stably detected. Therefore, the detection limit of the probe and primer combination for rapid detection of five diarrheagenic Escherichia coli involved in the present invention was 4.0×10 2 copies / mL.

[0054] Artificially synthesized fragment for detection of enterodiarrhea Escherichia coli escV gene: TGCTGAAGTGAGTGCTCGTTTTTCCCTTGATGGTATGCCAGGAAAACAAATGAGTATTGATGGTGATATGCGCGCAGGCGTTATTGATCCGCTTGAGGCAAAAGTTCTTCGCTCCCGAGTGCAAAAGGAAAGCCAGTTTTATGGTTCAATGGACGGGGCGATGAAGTTTGTAAAAGG; SEQ ID No. 49.

[0055] Artificially synthesized fragment for detection of stx1 gene of enterohemorrhagic Escherichia coli: TTTTCGGCAAATACAGAGGGGATTTCGTACAACACTGGATGATCTCAGTGGGCGTTCTTATGTAATGACTGCTGAAGATGTTGATCTTACATTGAACTGGGGAAGGTTGAGTAGTGTCCTGCCTGACTATCATGGACAAGACTCTGTTCGTGTAGGAAGAATTTCTTTTGGAAGCATTAATGCAA; SEQ ID No. 50.

[0056] Artificially synthesized fragment for detection of stx2 gene of enterohemorrhagic Escherichia coli: GTGGCCGGGTTCGTTAATACGGCAACAAATACTTTCTACCGTTTTTCAGATTTTACACATATATCAGTGCCCGGTGTGACAACGGTTTCCATGACAACGGACAGCAGTTATACCACTCTGCAACG TGTCGCAGCGCTGGAACGTTCCGGAATGCAAATCAGTCGTCACTCACTGGTTTCATCATATCTGGCGTTAATGGAGTTCAGTGGTAATACAATGACCAGAGATGCATCCAGAGCAGTTCTGC; SEQ ID No.51.

[0057] Artificially synthesized fragment for detection of bfp gene of enteropathogenic Escherichia coli: GAATAAGAAATACGAAAAAGGTCTGTCTTTGATTGAATCTGCAATGGTGCTTGCGCTTGCTGCCACCGTTACCGCAGGTGTGATGTTTTACTACCAGTCTGCGTCTGATTCCAATAAGTCGCAGAATGCTATTTCAGAAGTAATGAGCGCAACGTCTGCAATTAATGGTCTGTATATTGGGCAGACCAGTTATAGTGGATTGG; SEQ ID No. 52.

[0058] Artificially synthesized fragment for detection of enteroinvasive Escherichia coli ipaH gene: GGTCGCTGCATGGCTGGAAAAACTCAGTGCCTCTGCGGAGCTTCGACAGCAGTCTTTCGCTGTTGCTGCTGATGCCACTGAGAGCTGTGAGGACCGTGTCGCGCTCACATGGAACAATCTCCGGAAAACCCTCCTGGTCCATCAGGCATCAGAAGGCCTTTTCGATAAT; SEQ ID No. 53.

[0059] Artificially synthesized fragment for detection of enterotoxigenic Escherichia coli lt gene: TGTGATTGTTCTTGATGAATTTCCACAACCTTGTGGTGCATGATGAATCCAGGGTTCTTCTCTCCAAGCTTGGTGATCCGGTGGGAAACCTGCTAATCTGTAACCATCCTCTGCCGGAGCTATATTCAGATTTCTGT; SEQ ID No. 54.

[0060] Artificially synthesized fragment for detection of stp gene of enterotoxigenic Escherichia coli: CTGTATTATCTTTCCCCTCTTAGTCAGTCAACTGAATCACTTGACTCTTCAAAAGAGAAAATTACATTAGAGACTAAAAAGTGTGATGTTGTAAAAAACAACAGTGAAAAAAAATCAGAAAATATGAACAACACATTTACTGCTGTGAACTTTGTTGTAATCCTGCCTGTGCTGGATGTTATTAAA; SEQ ID No. 55.

[0061] Artificially synthesized fragment for detection of sth gene of enterotoxigenic Escherichia coli: CTGTATTGTCTTTTTCACCTTTCGCTCAGGATGCTAAACCAGTAGAGTCTTCAAAAGAAAAAATCACACTAGAATCAAAAAAATGTAACATTGCAAAAAAAAGTAATAAAAGTGGTCCTGAAAGCATGAATAGTAGCAATTACTGCTGTGAATTGTGTTGTAATCCTGCTTGTACCGGGTGCTATTAAT; SEQ ID No. 56.

[0062] Artificially synthesized fragment for detection of enteroaggregative Escherichia coli aggR gene: ATATCAGTAAGATTGCAAAAGAAGAAATCAACAGTAAATCCATTTATCGCAATCAGATTAAGCAGCGATACATTAAGACGCCTAAAGGATGCCCTGATGATAATATACGGAATATCAAAAGTAGATGCTTGCAGTTGTCCGAATTGGTCAAAAGGAATAATTGTAGCTGATG; SEQ ID No. 57.

[0063] Artificially synthesized fragment for detection of enteroaggregative Escherichia coli pic gene: CCAGGAAACCTGTACAGCATGATACTCAACAGCCAGACCCGCTTCTATATTCTGAAATCTGCCAGCTATGGTAACACTCTGTGGGGGAACAGCCTGAATGATCCGGCTCAGTGGGAGTTTGTTGGCATGAACAAAAACAAAGCAGTTCAGACAGTAAAAGATAGGATCCTGGCCGGGCGGGCAAAACAACCCGTTATCTTTCATGGTCAGCTGACCGGGAATATG; SEQ ID No. 58.

[0064] Artificially synthesized fragment for detection of astA gene of enteroaggregative Escherichia coli: SEQ ID No. 59.

[0065] Artificially synthesized fragments for detection of internal standard uidA gene of five diarrheagenic Escherichia coli: GCGTGATGCGGATCAACAGGTGGTTGCAACTGGACAAGGCACCAGCGGGACTTTGCAAGTGGTGAATCCGCACCTCTGGCAACCGGGTGAAGGTTATCTCTATGAACTGTGCGTCACAGCCAAAA SEQ ID No.60.

[0066] The above describes the specific embodiments of the present invention. It should be understood that the present invention is not limited to the above specific embodiments, and those skilled in the art may make various modifications or variations within the scope of the claims, which do not affect the essence of the present invention.

Claims

1. A probe primer combination for rapid detection of five types of diarrhea-causing Escherichia coli, characterized in that: Primers and Taqman probe sets were designed based on the escV, stx1, stx2, and bfp genes of EPEC and STEC / EHEC, the ipaH gene of EIEC, the lt, stp, and sth genes of ETEC, and the aggR, pic, and astA genes of EAEC, respectively, including: The primer pair used to detect the escV gene is shown in SEQ ID No. 1 and SEQ ID No. 2, and the probe sequence is shown in SEQ ID No. 25; The primer pair used to detect the stx1 gene is shown in SEQ ID No. 3 and SEQ ID No. 4, and the probe sequence is shown in SEQ ID No. 26; The primer pair used to detect the stx2 gene is shown in SEQ ID No. 5 and SEQ ID No. 6, and the probe sequence is shown in SEQ ID No. 27; The primer pair used to detect the bfp gene is shown in SEQ ID No.7 and SEQ ID No.8, and the probe sequence is shown in SEQ ID No.28; The primer pair used to detect the ipaH gene is shown in SEQ ID No. 9 and SEQ ID No. 10, and the probe sequence is shown in SEQ ID No. 29; The primer pair used to detect the lt gene is shown in SEQ ID No.11 and SEQ ID No.12, and the probe sequence is shown in SEQ ID No.30; The primer pair used to detect the stp gene is shown in SEQ ID No. 13 and SEQ ID No. 14, and the probe sequence is shown in SEQ ID No. 31; The primer pair used to detect the sth gene is shown in SEQ ID No. 15 and SEQ ID No. 16, and the probe sequence is shown in SEQ ID No. 32; The primer pair used to detect the aggR gene is shown in SEQ ID No. 17 and SEQ ID No. 18, and the probe sequence is shown in SEQ ID No. 33; The primer pair used to detect the pic gene is shown in SEQ ID No. 19 and SEQ ID No. 20, and the probe sequence is shown in SEQ ID No. 34; The primer pair for detecting the astA gene is shown in SEQ ID No.21 and SEQ ID No.22, and the probe sequence is shown in SEQ ID No.

35.

2. The probe-primer combination according to claim 1, characterized in that: It also includes a primer pair for detecting the internal standard gene uidA gene as shown in SEQ ID No.23 and SEQ ID No.24, and a probe sequence as shown in SEQ ID No.

36.

3. The probe primer combination according to claim 1 or 2, characterized in that: The two ends of the probe respectively carry a fluorescent group and a quenching group, wherein the fluorescent group is selected from any one or more of FAM, HEX, VIC, JOE, TET, TAMRA, ROX, QUASAR705, ATTO425, AF405, CY3.5, CY5, and CY7; the quenching group is selected from any one or more of BHQ0, BHQ1, BHQ2, BHQ3, DABCYL, and MGB.

4. A kit comprising the probe-primer combination according to claim 1.

5. The kit according to claim 4, characterized in that The kit includes a detection solution and a nucleic acid amplification reaction solution; The detection solution includes TE buffer, RNase-free water and the primer-probe combination; The nucleic acid amplification reaction solution includes PCR buffer, MgCl2, dNTPs, DNA polymerase and UNG enzyme.

6. The kit according to claim 5, characterized in that The method also includes a positive control and a blank control, wherein the positive control is an escV gene sequence fragment shown in SEQ ID No.37, an stx1 gene sequence fragment shown in SEQ ID No.38, an stx2 gene sequence fragment shown in SEQ ID No.39, a bfp gene sequence fragment shown in SEQ ID No.40, an ipaH gene sequence fragment shown in SEQ ID No.41, an lt gene sequence fragment shown in SEQ ID No.42, an stp gene sequence fragment shown in SEQ ID No.43, an sth gene sequence fragment shown in SEQ ID No.44, an aggR gene sequence fragment shown in SEQ ID No.45, a pic gene sequence fragment shown in SEQ ID No.46, an astA gene sequence fragment shown in SEQ ID No.47, and an uidA gene sequence fragment shown in SEQ ID No.48, and the blank control is RNase-free water.

7. The kit according to claim 5, characterized in that The probes are respectively marked in a single tube of detection solution, wherein, Group A: SEQ ID No. 25, Group B: SEQ ID No.26 and SEQ ID No.27, Group C: SEQ ID No. 28, Group D: SEQ ID No. 29, Group E: SEQ ID No.30~SEQ ID No.32, Group F: SEQ ID No.33~SEQ ID No.35, Group G: SEQ ID No. 36; Each set of probes is labeled with a different fluorescent group.

8. The kit according to claim 7, characterized in that The SEQ ID No.25 probe is labeled with a FAM fluorescent group, the SEQ ID No.26 and SEQ ID No.27 probes are labeled with a VIC or HEX fluorescent group, the SEQ ID No.28 probe is labeled with a ROX fluorescent group, the SEQ ID No.29 probe is labeled with a QUASAR 705 fluorescent group, the SEQ ID No.30 to SEQ ID No.32 probes are labeled with an ATTO 425 fluorescent group, the SEQ ID No.33 to SEQ ID No.35 probes are labeled with a CY7 fluorescent group, and the SEQ ID No.36 probe is labeled with a CY5 fluorescent group.

9. The kit according to claim 5, characterized in that The probes are separately labeled in three tubes of detection solution, wherein: Tube A: primers of SEQ ID No.1 to SEQ ID No.8, probes of SEQ ID No.25 to SEQ ID No.28; Tube B: primers SEQ ID No.9 to SEQ ID No.16, probes SEQ ID No.29 to SEQ ID No.32; Tube C: primers of SEQ ID No.17 to SEQ ID No.24, probes of SEQ ID No.33 to SEQ ID No.36; The probes in each tube were labeled with FAM, VIC, ROX and CY5 fluorescent groups respectively.

10. Use of the kit according to claim 4 in rapid typing and identification of EPEC, EIEC, ETEC, STEC / EHEC, and EAEC.

Images