A monoclonal antibody against group I type 8b avian adenovirus and its application

Abstract

The present invention discloses an anti-group I type 8b avian adenovirus monoclonal antibody and its application. The present invention provides a hybridoma cell line FAdV‑8b‑Hexon that secretes the anti-group I type 8b avian adenovirus monoclonal antibody, and its deposit number is CCTCC NO: C2024188. Also provided is an anti-group I type 8b avian adenovirus monoclonal antibody secreted by the above hybridoma cell line. The monoclonal antibody can specifically recognize the group I type 8b avian adenovirus, and does not cross-react with other 11 group I avian adenovirus serotypes and viruses such as avian reovirus. The method established by the present invention has good specificity and sensitivity, and the method can be used for accurate detection and epidemiological investigation of group I type 8b avian adenovirus in clinical practice.

Description

Technical Field

[0001] This invention belongs to the field of animal disease prevention and control detection, specifically relating to a monoclonal antibody against serotype I 8b avian adenovirus and its application, particularly in the application of establishing an indirect immunofluorescence method for detecting serotype I 8b avian adenovirus. Background Technology

[0002] Avian adenoviruses (FAdV) belong to the genus Avian adenovirus in the family Adenoviridae. They are non-enveloped, double-stranded DNA viruses, classified into groups I, II, and III based on their antigenic structure: Group I avian adenoviruses (FAdV-I) include traditional avian adenoviruses isolated from birds such as chickens, turkeys, geese, ducks, and pigeons, sharing common group antigens. The representative strain is chicken embryo lethal orphan virus (CELOV); Group II avian adenoviruses (FAdV-II) belong to the genus Sialidovirus and do not share the same group antigens as Group I viruses, including viruses related to turkey hemorrhagic enteritis; Group III avian adenoviruses (FAdV-III) belong to the genus Thymovirus and contain only egg drop syndrome virus, which shows some similar group antigens to FADV-I.

[0003] FAdV-I is classified into 5 genotypes (FAdVA–E) and 12 serotypes (FAdV-1–8a, FAdV-8b–11) based on viral gene sequence and seroneutralization assays. FAdV-I is widely distributed worldwide, and poultry of all ages are susceptible. Besides chickens, infection has also been found in turkeys, pigeons, budgerigars, and mallards. Different serotypes of FAdV-I exhibit varying virulence and pathogenicity in poultry. For example, FAdV-1 and FAdV-4 primarily cause gizzard erosion, ulceration, and pericardial effusion hepatitis syndrome in poultry. Serotypes 2, 7, 8a, 8b, and 11 cause inclusion body hepatitis (IBH) symptoms worldwide.

[0004] Inclusion body hepatitis caused by FAdV-8b virus was first discovered in the United States in 1963. It was reported in Taiwan, China in 1976, and subsequently in Hunan, Jiangsu, and other provinces and cities in my country after 1988. Since 2015, the infection rate has gradually increased in Shandong, Jilin, Henan, and Hebei provinces. Chickens aged 7 days to 20 weeks can be infected with FAdV-8b, with chickens aged 3 to 7 weeks being the most susceptible. Affected chicks mainly exhibit stunted growth, ruffled feathers, and squatting; most die within 48 hours or gradually recover. The mortality rate is relatively low, ranging from 10% to 30%. Necropsy of affected chickens reveals typical IBH symptoms, including hepatic hemorrhage, fragility, swelling, and yellowing of the liver; some may also show mild pericardial effusion or kidney swelling and hemorrhage. After HE staining, intranuclear inclusion bodies can be seen in the liver of IBH chickens under a light microscope.

[0005] The pathogenesis and prevalence of FAdV-8b in my country are not fully understood. Since there is currently no approved vaccine, the symptoms it causes, such as decreased egg production, low feed conversion rate, and weakened immunity, result in significant economic losses to my country's poultry farming industry. This disease can be transmitted both horizontally and vertically. If breeder hens are infected during their egg-laying period, it can greatly increase the morbidity and mortality rates of commercial chickens. Therefore, developing detection substances and methods for FAdV-8b to meet the testing requirements of food safety, slaughtering, and testing institutions is of great importance.

[0006] Preventing the spread of FAdV-8b is a crucial step in controlling inclusion body hepatitis, and strengthened quarantine is key to preventing its spread. Therefore, sensitive and effective virus detection technologies are extremely important. However, current domestic detection methods and kits primarily target serotypes I and serotype 4 avian adenoviruses, such as those using agricultural standards NY / T. The detection methods for Group I avian adenovirus (Patent 4027-2021) include clinical diagnosis, PCR detection, fluorescent PCR detection, IFA identification, and virus isolation and culture, but cannot distinguish the specific serotype of infection. Patent 202010304439.9 (2020) discloses an indirect immunofluorescence kit for detecting Group I avian adenovirus, which also cannot distinguish the specific serotype of infection. Patent CN116622643A discloses the preparation and application of a monoclonal antibody for the 100K protein of serotype 4 avian adenovirus, which is only for the diagnosis of serotype 4 avian adenovirus. Patent CN113981145A discloses a detection method and kit for Group I avian adenoviruses A, B, C, D, and E, which can distinguish different genotypes of Group I avian adenovirus by fluorescent quantitative PCR but cannot distinguish the serotype. Patent CN202111061712 discloses a method for identifying Group I avian adenovirus serotype 8, which can simultaneously identify FAdV-8a and FAdV-8b by LAMP, but cannot distinguish between these two serotypes. Currently, the only method to identify avian adenovirus type I 8b is to amplify the Hexon gene, sequence it, and then upload it to GenBank for BLAST analysis.

[0007] This invention provides a monoclonal antibody against serotype I avian adenovirus 8b and establishes an indirect immunofluorescence detection method capable of identifying the FAdV-8b serotype. It exhibits cross-reactivity with 11 other serotypes of serotype I avian adenovirus and common avian viruses such as avian reovirus. The method is convenient, efficient, highly operable, and possesses high specificity and sensitivity. Promoting and using this method will benefit the clinical detection and epidemiological investigation of FAdV-8b, providing a foundation for the prevention and diagnosis of FAdV-8b. Summary of the Invention

[0008] The purpose of this invention is to provide a monoclonal antibody against avian adenovirus type I 8b and its application.

[0009] Another objective of this invention is to provide an indirect immunofluorescence method for detecting serotype 8b of avian adenovirus group I. This invention analyzes the Hexon genes of 12 serotypes of FAdV-1, selects specific sequences of the FAdV-8b Hexon protein for secondary structure, hydrophilicity / hydrophobicity, and antigenicity analysis, selects specific antigenic epitope sequences, ligates them into a prokaryotic expression vector, expresses and purifies the target protein, prepares immunogens to immunize mice for monoclonal antibody preparation, and establishes an indirect immunofluorescence detection method for the specific detection and identification of FAdV-8b.

[0010] The objective of this invention can be achieved through the following technical solutions:

[0011] In a first aspect, the present invention seeks protection for a hybridoma cell line FAdV-8b-Hexon that secretes a monoclonal antibody against avian adenovirus group I 8b, with accession number CCTCC NO:C2024188.

[0012] Secondly, the present invention seeks protection for monoclonal antibodies against group I 8b avian adenovirus secreted by the aforementioned hybridoma cell lines.

[0013] Thirdly, the present invention seeks protection for the use of the above-mentioned monoclonal antibody against group I 8b avian adenovirus in at least one of the following:

[0014] 1) Prepare products for detecting avian adenovirus type I 8b;

[0015] 2) Detection of avian adenovirus type I 8b for non-diagnostic purposes.

[0016] Fourthly, this invention claims protection for a product comprising the aforementioned monoclonal antibody against serogroup I 8b avian adenovirus. Furthermore, the product has the function of detecting serogroup I 8b avian adenovirus.

[0017] The product described in this invention is a kit. The kit includes a monoclonal antibody against avian adenovirus group I 8b, a FITC-labeled goat anti-mouse secondary antibody, sample diluent (PBS), and wash buffer (PBST).

[0018] Fifthly, this invention claims protection for an indirect immunofluorescence detection method for avian adenovirus group I 8b (ADI 8b) for non-diagnostic purposes. The method uses the aforementioned anti-ADI 8b monoclonal antibody as the antibody to detect whether the sample contains ADI 8b. Further, the method comprises: adding the anti-ADI 8b monoclonal antibody to the sample, incubating and washing, then adding FITC goat anti-mouse secondary antibody, incubating and washing, and observing under an inverted fluorescence microscope. If specific green fluorescence appears in the cells, the sample is considered positive for ADI 8b; otherwise, it is negative.

[0019] This invention relates to a monoclonal antibody against avian adenovirus group I 8b, prepared based on the specific sequence of the hexon protein of avian adenovirus group I 8b (as shown in SEQ ID NO. 1). This antibody can specifically recognize avian adenovirus group I 8b and does not cross-react with the other 11 serotypes of avian adenovirus group I, as well as other avian viruses such as EDSV and avian reovirus. The hexon protein is an important structural protein of avian adenovirus. The L-loop region of this protein has the highest sequence variability and contains specific antigenic determinants, serving as the basis for viral serotyping.

[0020] A hybridoma cell line secreting monoclonal antibodies against avian adenovirus group I 8b was named the avian adenovirus group I 8b Hexon protein hybridoma cell line, abbreviated as FAdV-8b-Hexon. It was deposited at the China Center for Type Culture Collection on June 26, 2024, with accession number CCTCC NO: C2024188.

[0021] This invention establishes an indirect immunofluorescence detection method for avian adenovirus group I 8b. The establishment process of this detection method includes the following steps:

[0022] (1) Preparation of Hexon protein immunogen from serotype I avian adenovirus 8b: The reference sequences of the Hexon gene for 12 serotypes of serotype I avian adenovirus were analyzed. The most variable part was selected for antigenic epitope analysis, including the secondary structure and hydrophilicity / hydrophobicity of the protein sequence. A 756 bp nucleic acid sequence was selected, and NdeI and HindIII restriction enzyme sites were added to the 5' and 3' ends, respectively. After synthesis by Sangon Biotech (Shanghai) Co., Ltd., the sequence was digested with the pET28a vector using NdeI and HindIII, respectively. The vector was recovered and ligated with the digested fragment. After sequencing confirmation, the fragments were transformed into Rossetta competent cells for induced expression and purification. The purified target protein concentration was not less than 1 mg / mL, and the purity was not less than 90%, which was used as the immunogen for the preparation of monoclonal antibodies against serotype I 8b avian adenovirus.

[0023] (2) Preparation of monoclonal antibodies against avian adenovirus type I 8b: Ten healthy female Balb / c mice aged 6-8 weeks and of moderate size were immunized with purified Hexon protein. The protein and adjuvant were mixed in a 1:1 (v:v) ratio. After complete emulsification, the immunization dose per mouse was 100 μg / mouse, and the immunization volume was 200 μL. Three booster immunizations were given after the initial immunization, administered via subcutaneous injection at multiple sites on the back, with each immunization 14 days apart. Two weeks after the fourth immunization, blood was collected from the orbital venous plexus according to...

[0024] (3) The antibody titer in the serum of immunized mice was detected by the method. When the antibody titer in the mouse serum reached the cell fusion condition, intraperitoneal injection was performed to enhance immunization. Spleen cells were taken for cell fusion 3 to 5 days after the enhancement immunization.

[0025] (3) Method for detecting serum titer in immunized Balb / c mice: Two weeks after the fourth immunization of mice, blood was collected from the orbital venous plexus to separate serum. Purified Hexon protein was used as the coating antigen at a concentration of 2 μg / mL. The mixture was incubated overnight at 4°C. After washing three times with PBST, the mixture was blocked with PBST containing 2% skim milk powder (2g skim milk powder added to 100mL PBST buffer) for 2h. The mice were washed three times with PBST for 3min each time. The washings were discarded and the mixture was stored at 4°C for later use. Serum from immunized mice was serially diluted 2-fold as positive serum, and serum from the blank control group was used as negative serum. 100μL of each serum was added to the microplate and incubated at 37°C for 60min. The mice were then washed three times with PBST for 3min each time. 100μL of FITC-goat anti-mouse secondary antibody diluted 1:5000 was added to each well and the plates were incubated at 37°C for 1h. The mice were then washed three times with PBST for 3min each time. Add 100 μL of chromogenic solution to each well and incubate in the dark for 10 min. After incubation, add 50 μL of stop solution to each well to terminate the reaction. Read the OD values ​​using a microplate reader. 450 value.

[0026] (4) Fusion and screening of hybridoma cells: Balb / c mice with high serum titers were selected, euthanized by cervical dislocation, and then disinfected by immersion in 75% alcohol for 5 minutes. The disinfected mice were fixed, their spleens were removed, and homogenized in a homogenizer with basal culture medium. After standing, the cells were centrifuged to remove the supernatant, and an appropriate volume of HAT selective culture medium was added to resuspend the cells. The prepared mouse spleen cells were fused with myeloma cells SP2 / 0 using the PEG method to prepare hybridoma cells. The fused hybridoma cells were screened using HAT medium, and cell growth was observed. When hybridoma cells with good growth were retained, the cell supernatant from days 10 to 14 after cell fusion was used for antibody identification. Hybridoma cell lines secreting positive antibodies were numbered, and the positive cell lines were continuously cultured using limiting dilution until the positive cell rate reached 100%. The virus strain was then preserved and cryopreserved. Mice were immunized, ascites fluid was prepared, and protein-A affinity purification was used to obtain monoclonal antibodies against group I 8b avian adenovirus.

[0027] (5) Establishment of an indirect immunofluorescence method for avian adenovirus group I 8b: This detection method includes a monoclonal antibody against avian adenovirus group I 8b and commercially available FITC goat anti-mouse antibody (purchased from Sigma). The steps and positive criteria for this immunofluorescence detection are as follows: The sample to be tested is inoculated into well-grown monolayer chicken liver cancer cells (LMH) and cultured at 37°C in a 5% CO2 incubator for approximately 48–60 h. After incubation, the cell culture medium is discarded, and the cells are fixed with cold methanol for 15 min. The methanol is then discarded, and the cells are left at room temperature for at least 10 min to allow the methanol to evaporate. The cells are washed once with PBST, and then diluted anti-group I 8b monoclonal antibody is added. The cells are incubated at 37°C for 1 h, washed three times with PBST, and gently dried. Then, FITC goat anti-mouse secondary antibody diluted 1:5000 is added, and the cells are incubated at 37°C for 1 h. After washing three times with PBST and gently drying, the cells are observed under an inverted fluorescence microscope. If specific green fluorescence appears in the cells, the sample is considered positive for avian adenovirus group I 8a; otherwise, it is negative.

[0028] The room temperature described in this invention is 25±10℃, but it is not limited thereto.

[0029] The beneficial effects of this invention are:

[0030] This invention relates to the preparation of a monoclonal antibody against serotype I 8b avian adenovirus and the establishment of an indirect immunofluorescence detection method for serotype I 8b avian adenovirus. The monoclonal antibody against serotype I 8b avian adenovirus in this invention is prepared based on different serotype variant regions of the Hexon structural protein of serotype I 8b avian adenovirus. It can specifically recognize serotype I 8b avian adenovirus without cross-reactivity with the other 11 serotypes of serotype I avian adenovirus or viruses such as avian reovirus. The method established in this invention has good specificity and sensitivity, and can be used for accurate detection of serotype I 8b avian adenovirus in clinical settings and for epidemiological investigations.

[0031] Preservation Instructions

[0032] Culture name: Hybridoma cell line FAdV-8b-Hexon

[0033] Classification and nomenclature: Hybridoma cell line FAdV-8b-Hexon

[0034] Preservation Institution: China Center for Type Culture Collection

[0035] Abbreviation for depository institution: CCTCC

[0036] Address: Wuhan University, China

[0037] Deposit date: June 26, 2024

[0038] Registration number at the Preservation Center: CCTCC NO:C2024188. Attached Figure Description

[0039] Figure 1 The image shows the protein expression. M: Marker; 1: Uninduced control (Rosstta); 2: Precipitate after ultrasonic disruption of bacterial cells; 3: Supernatant after ultrasonic disruption of bacterial cells.

[0040] Figure 2 Image showing the purification of the target protein; M: Marker; 1: Uninduced control; 2: Supernatant after purification; 3: Precipitate after purification. Detailed Implementation

[0041] To make the technical problems solved by the present invention, the technical solutions and the beneficial effects of the present invention clearer, the present invention will be further described in detail below with reference to the embodiments.

[0042] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0043] Unless otherwise specified, all materials and reagents used in the following examples are commercially available.

[0044] Example 1: Hexon protein sequence analysis of group I avian adenovirus

[0045] Reference sequences of the Hexon gene from 12 serotypes of Group I avian adenovirus were downloaded from GenBank. Protein sequence alignment analysis using MegAlign software revealed significant differences in the Hexon protein sequences among the 12 serotypes. DNAStar software was used to analyze the hydrophilicity / hydrophobicity, antigenicity, secondary structure, and functional regions of the Hexon protein. The regions 170–336 aa and 430–538 aa were found to contain antigenic epitopes with the most significant amino acid sequence differences, and could be used as specificity testing fragments for protein expression. Based on the protein structure analysis results, a suitable nucleotide fragment (756 bp) was selected for sequence synthesis (as shown in SEQ ID NO. 1), and NdeI and HindIII restriction enzyme sites were added to the 5' and 3' ends, respectively, for double enzyme digestion ligation and cloning with the expression vector. Sequence synthesis was completed at Sangon Biotech (Shanghai) Co., Ltd.

[0046] Example 2: Construction of recombinant expression plasmids and protein expression and purification

[0047] 1. Construction of recombinant expression vectors

[0048] The synthesized 756 bp sequence and pET28a vector were double-digested with NdeI and HindIII restriction endonucleases, respectively. The recovered vector and the double-digested fragments were ligated with DNA ligase and transformed into DH5α competent cells. 200 μL of the bacterial culture was plated on LB agar plates containing Amp and incubated upside down at 37°C for 12–16 h. Single colonies from three plates were picked and placed in LB liquid medium containing Amp and incubated at 37°C with shaking at 200 rpm for 4 h. The bacterial culture was then sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing. After amplification and culture of the correctly sequenced strains, plasmids were extracted, transformed into Rossetta competent cells, and 200 μL of the bacterial culture was plated on LB agar plates containing Amp and incubated upside down at 37°C for 12–16 h. At least three single colonies were picked and placed in LB liquid medium containing Amp. The culture was then placed in a shaker at 37°C and shaken at 200 rpm for 4 hours. The bacterial culture was then sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing. The sequencing results were compared and analyzed. The completely correct bacterial strain was named Pet-28a-FAdV-8b-Hexon.

[0049] 2. Induced expression of recombinant proteins

[0050] The correctly sequenced bacterial culture was inoculated into 10 mL of LB liquid medium containing AMP at a ratio of 1:100 (v:v) and cultured in a shaker at 200 rpm at 37°C. When the OD value reached 0.6–0.8, 1 mL of the control bacterial culture was centrifuged and the supernatant was discarded. 0.5 Mm IPTG was added to the remaining bacterial culture for induction for 3 h. After induction, 1 mL of the control bacterial culture was centrifuged and the supernatant was discarded. Both the control and control bacterial cultures were resuspended in 200 μL of PBS solution. 50 μL of 5× loading buffer was added to each culture, and the cultures were heated in a water bath at 100°C for 5 min. SDS-PAGE was used to detect protein expression. The results showed that a clear protein expression band was observed in the induced culture at a position of approximately 28 kDa, while no specific target band was observed in the uninduced culture, indicating successful Hexon protein expression.

[0051] The cultured bacterial suspension was transferred to 1000 mL of LB liquid medium containing AMP at a ratio of 1:50 and cultured at 200 rpm in a shaker at 37°C. When the OD value reached 0.6–0.8, 0.5 mM IPTG was added for induction culture for 4 h. The bacterial suspension was centrifuged at 8000 rpm for 6 min at 4°C, the supernatant was discarded, and the bacterial cells were resuspended in an appropriate amount of PBS. The suspension was then centrifuged at 8000 rpm for 5 min at 4°C, repeated twice. After washing away the culture medium components, the bacterial pellet was resuspended in 100 mL of PBS and placed in an ice-water mixture. The bacterial cells were then sonicated for 5 min at 40 Hz with 8-second intervals. When the bacterial suspension changed from milky white to clear and transparent, it was centrifuged at 1000 rpm for 10 min at 4°C, and the supernatant was transferred to a new container. 200 μL of the pellet and supernatant were taken separately, and 50 μL of 5× loading buffer was added. The mixture was heated in a water bath at 100°C for 5 min, and protein expression was detected by SDS-PAGE. The results showed that the target protein was expressed in both the supernatant and precipitate of the bacterial culture after induction at a position of approximately 28 kDa, with expression mainly occurring in the precipitate. No specific target band was observed in the uninduced bacterial culture. Figure 1 ).

[0052] 3. Purification of recombinant proteins

[0053] SDS-PAGE results showed that the recombinant protein was mainly expressed as insoluble inclusion bodies. The Beyotime His-tagged protein purification kit (denaturing formulation) was used to purify the inclusion body recombinant protein. The expressed bacterial cell pellet was collected, denaturing lysis buffer was added, and the mixture was sonicated for 1 min. The pellet was then centrifuged at 12000 rpm for 10 min at 4℃, and the supernatant was collected. The column was equilibrated twice with denaturing lysis buffer, and the lysate supernatant was added to the equilibrated column stock. The column was gently shaken to fully bind the tag protein. Elution buffer was added to elute the target protein, and the eluent was collected in a new container. The concentration of the eluted protein was measured, and the protein sample was collected in a dialysis bag for refolding of the recombinant protein. Dialysis was performed at 4℃, using a decreasing urea concentration at 6M, 4M, and 2M urea buffer for 8 h, until the recombinant protein solution became turbid. The dialysis bag was then placed in PBS buffer for further dialysis. After dialysis, the recombinant protein was centrifuged at 8000 rpm for 6 minutes at 4°C. The supernatant was collected, and the protein concentration was determined. 5× loading buffer was added, and the mixture was heated in a 100°C water bath for 5 minutes. SDS-PAGE electrophoresis was then performed for identification. Figure 2 Using BSA as a reference, the purified protein concentration was found to be no less than 1 mg / mL and the purity to be no less than 90% by SDS-PAGE gel scanning analysis. It was named FAdV-8b-Hexon.

[0054] Example 3: Preparation of Monoclonal Antibodies

[0055] 1. Mouse immunization

[0056] Six healthy female Balb / c mice aged 6-8 weeks with moderate body size were selected and immunized with FAdV-8b-Hexon protein. The protein and adjuvant were emulsified in a 1:1 ratio and administered to each mouse via multiple subcutaneous injections on the back. Each mouse received 100 μg of the immunized protein, for a total immunization volume of 200 μL. The specific immunization procedure is shown in Table 1. Two weeks after the fourth immunization, blood was collected via the orbital venous plexus to detect the antibody titer in the serum of the immunized mice. Mice with high serum titers were selected for booster immunization. Spleen cells were harvested 3-5 days after the booster immunization for cell fusion.

[0057] Table 1. Immunization schedule for mice

[0058]

[0059] 2. Detection of serum titer in immunized Balb / c mice

[0060] Two weeks after the fourth immunization of mice, blood was collected from the orbital venous plexus to separate serum. Purified Hexon protein was used as the coating antigen at a concentration of 2 μg / μL, incubated overnight at 4°C, washed three times with PBST, and then blocked with PBST containing 2% skim milk powder for 2 hours. The mice were washed three times with PBST for 3 minutes each time, the wash buffer was discarded, and the solution was stored at 4°C. Serum from immunized mice was serially diluted 2-fold as positive serum, and serum from the control group was used as negative serum. 100 μL of each solution was added to each well of an ELISA plate, and the plate was incubated at 37°C for 60 minutes. The plates were then washed three times with PBST for 3 minutes each time. 100 μL of FITC-goat anti-mouse secondary antibody (1:5000 dilution) was added to each well, and the plate was incubated at 37°C for 1 hour. The plates were washed three times with PBST for 3 minutes each time. 100 μL of chromogenic buffer was added to each well, and the plate was incubated in the dark for 10 minutes. 50 μL of stop solution was added to each well after incubation to terminate the reaction. The OD values ​​were then read using an ELISA reader. 490 Value. Select mice with high serum titers for booster immunization, and collect spleen cells for cell fusion 3-5 days after immunization.

[0061] 3. Cell fusion and screening

[0062] Frozen SP2 / 0 myeloma cells were revived. When the cells were in good growth condition and adhered to the culture vessel to 80%–90% confluence, they were passaged. SP2 / 0 cell suspensions were prepared and subcutaneously injected into the back of 6-week-old healthy, non-immunized female Balb / c mice to induce cell proliferation in vivo. Fresh myeloma cells were then isolated. One immunized Balb / c mouse was subjected to orbital bloodletting, and negative serum was collected. The mouse was then disinfected by immersing in 75% alcohol for 5 minutes and used to prepare an immune spleen cell suspension. Immune spleen cells were fused with SP2 / 0 cells using the standard PEG method. The fused cells were then placed in 96-well cell plates and selectively cultured in HAT medium. The fused cells were cultured in an incubator. After 6 days, half of the culture medium was replaced with HT medium, and the HAT medium content was gradually reduced. Cell growth was observed, and hybridoma cells were screened using an indirect ELISA method as follows:

[0063] 1) Prepare the coated plate: Coat the detection plate with a protein concentration of 2 μg / mL and set up blank control wells. Coat overnight at 4℃. Wash 3 times with PBST for 3 min each time, and gently shake dry on the last wash. Add 200 μL of PBST containing 2% skim milk powder (containing 0.05% (v / v) Tween PBS) to each well. Block at 37℃ for 2 h. Wash 3 times with PBST (containing 0.05% Tween PBS) for 3 min each time, and gently shake dry on the last wash.

[0064] 2) Primary antibody incubation: Add 100 μL of hybridoma cell culture supernatant, negative control (SP2 / 0 culture supernatant), blank control (PBS), and positive control (FAdV-8b positive serum diluted 1000 times with PBS) to the detection plate as primary antibody, and incubate at 37°C for 1 h. Wash 3 times with PBST (PBS containing 0.05% Tween) for 3 min each time, and gently shake dry on the last wash.

[0065] 3) Secondary antibody incubation: Dilute FITC-goat anti-mouse secondary antibody 20,000 times with PBS, add 100 μL / well to each detection plate, and incubate at 37°C for 1 h. Wash 3 times with PBST (PBS containing 0.05% Tween) for 3 min each time, and gently shake dry on the last wash.

[0066] 4) Color development: Add 100 μL of TMB color development solution per well, react at room temperature in the dark for about 10 min, and then add 50 μL of stop solution (1M sulfuric acid) per well to terminate the reaction.

[0067] 5) Reading: Place the ELISA plate into the ELISA reader and read the OD value. 490nm The value at that location is recorded and saved. The closer the value is to 1, the stronger the positive result.

[0068] 6) Cloning: Three limiting dilutions were performed on the wells with strong positive results and vigorous cell growth until the cell cloning antibody positivity rate reached 100%, resulting in the hybridoma cell line FADV-8b-Hexon with accession number CCTCC NO:C2024188.

[0069] 4. Indirect immunofluorescence detection

[0070] To verify that the prepared monoclonal antibody could specifically react with FAdV-8b, viral fluids of 12 serotypes of FAdV-I, as well as avian reovirus (ARV) and egg drop syndrome virus (EDSV) (Table 2), were diluted to 100 TCID using DMEM / F12 medium. 50 0.1 mL of the virus strain was inoculated into 96-well plates containing a monolayer of well-grown chicken liver cancer cells (LMH). Each strain was inoculated into 4 wells at a rate of 100 μL / well, with a blank control included. The plates were incubated at 37°C in a 5% CO2 incubator for 4 days before fluorescent staining. All virus strains used were obtained from the National Veterinary Microbiology Culture Collection Center.

[0071] Table 2 Information on the virus strains used for testing

[0072]

[0073]

[0074] 1) Fixation: After culturing the virus on a cell culture plate for 4 days, discard the cell culture medium in the 96-well plate, add about 200 μL of PBS to each well, gently wash the cell surface once, gently shake off the PBS, add 100 μL of pre-cooled methanol at -20℃ per well, fix at room temperature for 10-15 min, discard the methanol, and air dry naturally for 2-5 min.

[0075] 2) Primary antibody incubation: Gently wash the cell surface once with PBS, dilute the supernatant of the hybridoma cell line 100 times with PBS, add 50 μL / well to the virus culture cell plate, and incubate at 37°C in the dark for 1 h.

[0076] 3) Washing: Discard the monoclonal antibody, add 0.3 mL of PBS to each well, gently shake to wash, discard the washing buffer, wash 3 times with PBS, and gently shake dry the last time.

[0077] 4) Secondary antibody incubation: Add 50 μL of FITC goat anti-mouse IgG diluted (1:200) with PBS to each well and incubate at 37°C in the dark for 1 h.

[0078] 5) Washing: Discard the secondary antibody, add 0.3 mL of PBS to each well, gently shake to wash, discard the washing buffer, wash 3 times with PBS, and gently shake dry the last time.

[0079] 6) Result Interpretation: The reaction plate was placed under an inverted fluorescence microscope and observed using excitation light at a wavelength of 490 nm. Cells were found to have intact morphology. When specific green fluorescence appeared in the field of view of the inoculated well, further magnification revealed staining of the cell nucleus and cytoplasm of the infected cells, indicating a positive FAdV-8b test for that well. When no specific green fluorescence appeared in the inoculated well, the field of view was dark, indicating that the cells were not infected, and the FAdV-8b test for that well was negative. The results showed that only the wells infected with FAdV-8b virus showed green fluorescence (positive), while the rest showed no green fluorescence (negative).

[0080] Implementation Case 4: Identification of Hybridoma Cells

[0081] 1) Cultivation characteristics

[0082] Hybridoma cells were cultured in DMEM medium containing 10-15% fetal bovine serum at 37°C in a 5% CO2 incubator. The cell morphology of the hybridoma cell line was observed under a microscope, and the cell morphology was found to be consistent.

[0083] 2) Purity test

[0084] According to the methods in the appendix of the current Chinese Veterinary Pharmacopoeia (2020 edition), the tests for sterility, mycoplasma, and exogenous viruses should be performed, and the results should indicate contamination by bacteria, fungi, mycoplasma, and exogenous viruses.

[0085] 3) Nucleic acid examination

[0086] Hybridoma cells cultured for 24 hours were treated with colchicine to check chromosome number and observe whether chromosome characteristics matched the staining characteristics of hybridoma cells.

[0087] 4) Preparation of ascites

[0088] Eight to ten-week-old female Balb / c mice were injected intraperitoneally with 0.5 mL of paraffin oil. Ten days later, each mouse was injected intraperitoneally with 3 million hybridoma cells diluted in serum-free DMEM basal medium. The mice were observed daily. When the abdomen of the mice became significantly distended, ascites fluid was collected, centrifuged at 5000 rpm for 10 min, and the supernatant was aliquoted and stored.

[0089] 5) Ascites titer determination

[0090] Ascites fluid was serially diluted at 1:100, 1:200, 1:400, 1:800, 1:1600, 1:3200, 1:6400, 1:12800, and 1:25600 to serve as primary antibodies. 100 μL / well was added to the immobilized FAdV-8b plate, and the titer was determined according to the steps in Example 3. The results showed that the ascites fluid titer was 1:10000.

[0091] SEQ ID NO.1

[0092] TTCTTTAACAACTGGATCGAGGACGATGGAAACAACACAACCATCACGGGACAAATG

[0093] ACCAATCCGTACAAGAACGAGGCGCAAAACACAGCTACGGCAACAGCTGCAGCAAT

[0094] CGCCAGCGTTTCAGGCTCTTATCCTAACCCTAACGTGGGGCTGGGCATTAGCGAAATG

[0095] GGAGCCCTCACCCCGACACTAGCAGCACAGGTCGGTCTGGCCGGTCGGTTTGCCAA

[0096] GGTGTCGAATGAGAACACGCGCCTGGCTTATGGAGCGTATGTGAAGCCTCTAAAAGA

[0097] CGACGGCTCTCAGTCACTTGGAACAACGCCTTACTACGTGTTAGACACCACCGCACA

[0098] GAAATACTTGGGCGTCATGGGGGTAGAAGACTTTACGCAAAGTCTTACCTACCCAGA

[0099] CAGTCTGTTAATCCCCCCTCCTTCTGAGTACGGAGAGGTTAACAGCGGGGTGATGAA

[0100] AGCGAACAGACCCAACTACATCGGGTTCCGTGACAATTTCATCAACCTCCTGTACCAC

[0101] GATACCGGCGTGTGCTCCGGGACCCTCAACTCCGAACGGTCAGGCATGAACGTGGTG

[0102] GTGGAATTGCAGGACCGAAACACCGAACTCAGCTACCAGTACATGCTCGCCGATATG

[0103] ATGTCCAGGCATCACTATTTCGCTCTCTGGAACCAGGCCGTGGATCAGTACGACCACG

[0104] ACGTGCGCGTGTTTAACAACGACGGTTACGAGGAGGGCGTGCCCACGTACGCCTTCTCGCCCGAGGGTACA。

Claims

1. A hybridoma cell line secreting monoclonal antibodies against avian adenovirus group I type 8b, whose deposit number is CCTCC NO:C2024188.

2. A monoclonal antibody against avian adenovirus group I type 8b secreted by the hybridoma cell line of claim 1.

3. Use of the anti-group I type 8b avian adenovirus monoclonal antibody according to claim 2 in at least one of the following: 1) Preparation of products for detecting avian adenovirus group I type 8b; 2) Detection of avian adenovirus group I type 8b for non-diagnostic purposes.

4. The use according to claim 3, characterized in that: The product described is a test kit.

5. A product comprising the anti-group I type 8b avian adenovirus monoclonal antibody according to claim 2.

6. The product according to claim 5, characterized in that: The product has the function of detecting group I type 8b avian adenovirus.

7. The product according to claim 5 or 6, characterized in that: The product is a test kit.

8. The product according to claim 7, characterized in that: The kit comprises a monoclonal antibody against group I type 8b avian adenovirus, a FITC-labeled goat anti-mouse secondary antibody, a sample diluent and a washing solution.

9. An indirect immunofluorescence detection method for detecting avian adenovirus group I type 8b for non-diagnostic purposes, characterized in that: The anti-group I type 8b avian adenovirus monoclonal antibody according to claim 2 is used as an antibody to detect whether the sample to be tested contains group I type 8b avian adenovirus.

10. The method according to claim 9, characterized in that Add anti-group I type 8b monoclonal antibody to the sample to be tested, add FITC goat anti-mouse secondary antibody after incubation and washing, observe under an inverted fluorescence microscope after incubation and washing, if specific green fluorescence appears in the cells, the sample is judged to be positive for group I type 8a avian adenovirus, otherwise it is negative.

Images