A recombinant type IV collagen Pro.C4 and its preparation method and application

Abstract

The present invention discloses a recombinant type IV collagen protein Pro.C4, characterized in that its amino acid sequence is shown in any one of SEQ ID NO.1‑5. Also disclosed are its encoding gene, expression vector, host bacteria and application. The present invention designs recombinant human type IV collagen protein based on partial sequences in the α1 and α2 chains of human type IV collagen protein, expresses the protein by prokaryotes, and the expression system is mature. The purified recombinant type IV collagen protein is experimentally verified to be non-cytotoxic, has good cell repair and firming effects, and can be used as a biomaterial in beauty products, etc.

Description

Technical Field

[0001] The invention relates to a recombinant type IV collagen Pro.C4 and a preparation method and application thereof, belonging to the technical field of protein expression. Background Art

[0002] Collagen IVC is widely distributed in the basement membrane, and its presence in the basement membrane has been confirmed by immunological methods and X-ray diffraction experiments. IVC is a non-fibrillar collagen protein, which is divided into network / reticular / lamellar collagen. In mammals, there are six genetically different IVC chains ɑ1(Ⅳ)-ɑ6(Ⅳ), which are encoded by COL4A1-COL4A6 genes, respectively, and all have similar domain structures. Each ɑ chain is ∼400 nm long and can be divided into three domains: a short N-terminal non-collagenous 7S domain (26 kDa, ∼28 nm in length), a long intermediate triple-helical collagen domain (120 kDa, ∼320 nm or ∼1400 amino acids in length), and a C-terminal globular non-collagenous domain NC1 (25 kDa, ∼52 nm or ∼230 amino acids in length). Uniquely, the central helical portion of the α chain, which contains a 1400 Gly-XY sequence, is interrupted by approximately 20 short non-collagenous regions, providing flexibility to the molecule and conferring flexibility to the basement membrane. The 7S domain is named for its sedimentation property upon centrifugation following proteolytic digestion of IVC. Both the 7S and NC1 domains participate in the formation of the IVC network.

[0003] The α1(Ⅳ)2α2(Ⅳ) subtype is the main subtype and is ubiquitous in all epithelial tissue basement membranes. Basement membranes are multifunctional, providing structural support for the epithelium and attaching them to the underlying connective tissue, matrix or stroma. Traditionally, type IV collagen is isolated from the human placenta and purified using a multi-step process. This collagen extraction method has certain limitations, such as low extraction efficiency and low purity. With the development of genetic engineering technology, recombinant collagen has become the best alternative to animal-derived collagen in biomedicine and tissue engineering. Recombinant collagen is a protein obtained by cloning the human collagen gene into a selected expression vector and transforming it into expression cells, and finally through purification technology. Compared with collagen obtained by traditional extraction, recombinant collagen has the advantages of processability, no virus risks, good water solubility, batch stability and low rejection reaction. Selecting the right sequence is the key to the industrialization of highly active recombinant collagen. Summary of the invention

[0004] The purpose of the present invention is to provide a recombinant type IV collagen Pro.C4.

[0005] The technical solution adopted by the present invention is:

[0006] A recombinant type IV collagen Pro.C4, whose amino acid sequence is shown in any one of SEQ ID NO.1-5.

[0007] The gene encoding the aforementioned recombinant type Ⅰ collagen Pro.C1.

[0008] Preferably, the nucleotide sequence is shown in any one of SEQ ID NOs. 6-10.

[0009] The expression vector of the aforementioned recombinant type IV collagen Pro.C4.

[0010] The host bacteria of the aforementioned recombinant type IV collagen Pro.C4.

[0011] The aforementioned method for preparing the recombinant type IV collagen Pro.C4 comprises the following steps:

[0012] (1) constructing the aforementioned expression vector and transforming it into an expression host bacterium;

[0013] (2) Cultivating the expression host bacteria and inducing the expression of the recombinant protein;

[0014] (3) Purify the expression product to obtain the aforementioned recombinant type IV collagen Pro.C4.

[0015] The aforementioned recombinant type IV collagen Pro.C4 is used to promote cell proliferation in vitro.

[0016] The aforementioned application of recombinant type IV collagen Pro.C4 in promoting cell migration in vitro.

[0017] The aforementioned recombinant type IV collagen Pro.C4 is used to promote cell secretion of Elastin in vitro.

[0018] The use of the aforementioned recombinant type IV collagen Pro.C4 in the preparation of beauty products.

[0019] Beneficial effects of the present invention:

[0020] The present invention designs recombinant human type IV collagen based on partial sequences in the α1 and α2 chains of human type IV collagen, which is expressed by prokaryotes and has a mature expression system. The purified protein has been experimentally verified to be non-cytotoxic, and has the effects of helping cell repair and cell firming, and can become a biomaterial raw material for beauty products. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 The plasmid map of the recombinant expression vector pET30a-C4-1 of the present invention.

[0022] Figure 2 The plasmid map of the recombinant expression vector pET30a-C4-2 of the present invention.

[0023] Figure 3 The plasmid map of the recombinant expression vector pET30a-C4-3 of the present invention.

[0024] Figure 4 The plasmid map of the recombinant expression vector pET30a-C4-4 of the present invention.

[0025] Figure 5 The plasmid map of the recombinant expression vector pET30a-C4-5 of the present invention.

[0026] Figure 6 The preliminary experimental results of cytotoxicity of the recombinant collagens Pro.C4-1, Pro.C4-2, Pro.C4-3, Pro.C4-4 and Pro.C4-5 of the present invention.

[0027] Figure 7 The cell scratch test results of the recombinant collagens Pro.C4-1, Pro.C4-2, Pro.C4-3, Pro.C4-4 and Pro.C4-5 of the present invention.

[0028] Figure 8 Elastin ELISA test results of the recombinant collagens Pro.C4-1, Pro.C4-2, Pro.C4-3, Pro.C4-4 and Pro.C4-5 of the present invention. DETAILED DESCRIPTION

[0029] The present invention is further illustrated by examples below, but is not intended to be limiting of the present invention. The specific materials used in the embodiments of the present invention and their sources are provided below. However, it should be understood that these are merely exemplary and are not intended to limit the present invention, and materials identical or similar to the types, models, qualities, properties or functions of the following reagents and instruments can be used to implement the present invention. The experimental methods used in the following examples are conventional methods unless otherwise specified. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial sources.

[0030] Example 1: Preparation of recombinant type IV collagen Pro.C4 plasmids

[0031] (1) Gene design and synthesis

[0032] First, an expression vector of recombinant human type IV collagen was constructed, wherein the recombinant type IV collagen Pro.C4 were Pro.C4-1, Pro.C4-2, Pro.C4-3, Pro.C4-4, Pro.C4-5, and their corresponding amino acid sequences were SEQ ID No.1, SEQ ID No.2, SEQ ID No.3, SEQ ID No.4, SEQ ID No.5, and the corresponding coding gene sequences were SEQ ID No.6, SEQ ID No.7, SEQ ID No.8, SEQ ID No.9, SEQ ID No.10. The coding genes SEQ ID No.6, SEQ ID No.7, and SEQ ID No.8 were commissioned to Beijing Qingke Biotechnology Co., Ltd. for synthesis, and SEQ ID No.9 and SEQ ID No.10 could be obtained by PCR from the synthetic fragments of SEQ ID No.6, SEQ ID No.7, and SEQ ID No.8.

[0033] (2) Construction of recombinant expression vector

[0034] The above-synthesized gene fragment was used as a template for PCR amplification, and the target gene fragment and the pET30a expression vector backbone were connected by Gibson-plasmid connection to obtain the corresponding plasmid.

[0035] Primer design:

[0036] Primer name Primer sequences Skeleton-F CATATGTATATCTCCTTCTTAAAGTTAAACAAAATTATTTCTAGAGGG Skeleton-R CACCACCACCACCACCACTGA Pro.C4-1-F GTGGTGGTGGTGGTGCTTTTCGCCCGGCAGGC Pro.C4-1-R ACTTAAGAAGGAGATATACATATGGGGATATCAGGTACACCCGGAGC Pro.C4-2-F GTGGTGGTGGTGGTGCGGAGCGCCAGGCCA Pro.C4-2-R ACTTAAGAAGGAGATATACATATGGGGCTACCAGGTACACCCG Pro.C4-3-F GTGGTGGTGGTGGTGGTCACCACGGCTGCCTTTG Pro.C4-3-R TTAAGAAGGAGATATACATATGGGGATGAAAGGACTATCAGGTGATAGGG Pro.C4-4-F GTGGTGGTGGGTGGTGCTTCTCGCCTGGCAAGCC Pro.C4-4-R TAAGAAGGAGATATACATATGGGAATGAAAGGACTATCAGGTGATAGGGG Pro.C4-5-F GTGGTGGTGGTGGTGCCGGAGCTCCAGGCCAG Pro.C4-5-R TTAAGAAGGAGATATACATATGGGGATGAAAGGACTATCAGGTGATAGGG

[0037] PCR amplification:

[0038] System components Ingredient volume Primer F 2.5μL Primer R 2.5μL 2xSuperNova PCR Mix(Dye) 25μL Genes encoding the biosynthesis of the 1μL <![CDATA[ddH 2 The]]> To 50μL

[0039] After the PCR system was prepared, it was mixed and centrifuged. The PCR amplification conditions were as follows: the first stage was pre-denaturation at 98°C for 30s; the second stage was denaturation at 98°C for 10s, annealing at 50-72°C for 30s, extension at 72°C for 30s / kb, and 33 cycles; the third stage was final extension at 72°C for 2min. The above vectors and gene fragments were recovered using a universal DNA purification kit (Tiangen Biochemical Technology Co., Ltd.) and the operating steps in the product manual were followed.

[0040] Gibson Connection:

[0041]

[0042]

[0043] After mixing the above components on ice, place in a 37°C heat bath for 60 min. The obtained ligation product is stored on ice or at -20°C for subsequent competent cell transformation.

[0044] The ligation product was transformed into the host bacteria E. coli DH5α by heat shock method, coated with LB culture resistance plate, incubated at 37°C overnight, randomly picked positive clones, cultured in LB liquid culture medium, 37°C, 220rpm overnight, and the plasmid was extracted using a plasmid rapid extraction kit. The successful plasmids pET30a-C4-1, pET30a-C4-2, pET30a-C4-3, pET30a-C4-4, and pET30a-C4-5 were constructed. The map is shown in Figure 1-5 .

[0045] (3) Construction of engineered bacteria

[0046] The recombinant expression plasmid obtained above was transferred into the competent Escherichia coli cells BL21 (DE3) by heat shock, and positive Escherichia coli genetically engineered bacteria were screened. The specific process was as follows: ① 5 μL of the recombinant expression plasmid was added to 100 μL of the competent Escherichia coli cells BL21 (DE3), and the mixture was placed on ice for 30 min; ② the mixture was heat shocked in a 42°C water bath for 90 s, and then quickly placed on ice for 2 min; ③ 500 μL of non-resistant LB liquid culture medium (10 g / L peptone, 5 g / L yeast extract, 10 g / L sodium chloride) was added to the mixture, and the mixture was incubated at 37°C, 220 rpm for 30 min. Culture for 0.5h; ④ Take 200μL of the bacterial solution and evenly spread it on an LB solid culture medium plate containing ampicillin (10g / L peptone, 5g / L yeast extract, 10g / L sodium chloride, 15g / L agar, 100μg / mL ampicillin); ⑤ Incubate the plate upside down in a 37°C incubator for about 16h until clearly visible colonies grow, and obtain the corresponding DE3-pET30a-C4-1, DE3-pET30a-C4-2, DE3-pET30a-C4-3, DE3-pET30a-C4-4, and DE3-pET30a-C4-5 engineered bacteria.

[0047] Example 2: Induced expression of engineered bacteria

[0048] The single colony on the plate was placed in LB liquid medium containing ampicillin antibiotics, and cultured at 37°C, 220rpm for 10 hours. This was the primary seed solution, which was inoculated into a new LB medium at a 2% inoculum, cultured at 37°C for 2 hours, and induced expression by adding IPTG at a final concentration of 0.2mM at 18°C ​​for 20 hours. The bacteria were collected by centrifugation at 4000g and 4°C for 20 minutes.

[0049] The cells were resuspended in lysis buffer (20 mM Tris-HCl, 1 mM EDTA, 500 mM NaCl, pH 8.5), 100X protease inhibitor PMSF was added, and then the cells were disrupted by ultrasonication at 360W for 30 min (ultrasonication for 3 s and 6 s intervals). Then 1 mL of the disrupted liquid was centrifuged at 4°C and 10000 g for 10 min, 80 μL of the supernatant was taken, and the precipitate was resuspended in 200 μL of lysis buffer, 120 μL of the resuspension was discarded, 20 μL of 5X protein loading buffer was added to the supernatant and the precipitate, and the mixture was heated in a boiling water bath for 10 min for SDS-PAGE.

[0050] Example 3: Purification of expression products

[0051] The crushed liquid obtained in Example 2 was centrifuged at 10000g and 4°C for 30 minutes, the supernatant was collected, the Ni affinity column material was washed with clean water, the column material was equilibrated with buffer 1 (25mMTris, 200mM NaCl, pH8.0), the sample was loaded, the impurities were rinsed with a washing buffer containing 20mM imidazole (20mM imidazole, 25mM Tris, 200mM NaCl, pH8.0), and the target protein was eluted with a solution containing 250mM imidazole (250mM imidazole, 25mM Tris, 200mM NaCl, pH8.0); the column material was washed with a solution containing 1M imidazole, then washed with water, and finally filled with 20% ethanol.

[0052] After purification, 80 μL of supernatant was taken from the protein sample, and 20 μL of 5X protein loading buffer was added, mixed, and heated in a boiling water bath for 10 min for SDS-PAGE. It can be seen that Pro.C4-1 to 5 are all soluble.

[0053] Example 4: Detection of biological activity of recombinant humanized type IV collagen

[0054] Cytotoxicity and cell scratch experiments were performed using the recombinant type IV collagen Pro.C4 obtained in Example 3

[0055] (1) Preliminary experiment (cytotoxicity experiment)

[0056] Cytotoxicity test. Ultrapure water was used to dissolve the samples. The results of the cytotoxicity test were as follows: Figure 5 As shown, it can be seen that the prepared recombinant type IV collagen Pro.C4 has no cytotoxicity and can promote cell proliferation.

[0057] (2) Formal experiment (cell scratch test)

[0058] Add 2 mL of the diluted cell suspension to a 6-well plate to a concentration of 1 × 10 6cells / well. When the cells adhered to the wall and filled the 6-well plate to about 80-90%, they were pretreated with DMEM medium containing mitomycin C for 2 hours. The scratch was made with a 10μL pipette tip, and after washing three times with PBS, DMEM medium containing mitomycin C and sample protein solution were added to make the final protein concentration 1.0%. After adding the sample, the scratch width was photographed and recorded at 0h under an inverted microscope, and then placed in an incubator for 24h. After 24h, the scratch was removed from the CO 2 The 6-well plate was taken out from the incubator and placed under an inverted microscope to photograph the scratch width for 24 h and record the data.

[0059] Calculation: Scratch healing rate (%) = (S 0 -S 24 Scratch area) / S 0 Scratch area × 100%.

[0060] The results are as follows Figure 6 As shown, in this experiment, the sample group within the detection concentration range had significant differences compared with the Control group (blank control), which had the effect of promoting cell migration.

[0061] (3) Compactness experiment

[0062] The Elastin ELISA Kit (Human Elastin ELISA Kit, Abcam) was used to detect and analyze the effect of recombinant humanized type IV collagen on the Elastin content in fibroblasts according to the operating instructions. The Elastin content results were expressed as Mean±SD. The specific detection steps can be routinely adjusted according to the instructions of the kit.

[0063] Take a sterile ELISA plate, design blank wells, standard wells, and sample wells to be tested respectively, add 50 μL of standards of different concentrations to each standard well, add 10 μL of samples to be tested to the sample wells, wherein the sample to be tested is a protein solution with a concentration of 5.0%, and then add 40 μL of sample diluent (i.e., the sample is diluted 5 times), and nothing is added to the blank wells; except for the blank wells, add 100 μL of HRP-labeled detection antibody to each of the standard wells and sample wells, seal the reaction wells with a sealing film, incubate at 37° C. in the dark for 60 min, discard the liquid, pat dry on absorbent paper, fill each well with washing solution, let it stand for 1 min, discard the washing solution, pat dry on absorbent paper, repeat the washing 5 times, add 50 μL of substrates A and B to each well, incubate at 37° C. in the dark for 15 min, add 50 μL of stop solution to each well, and measure the OD value of each well at a wavelength of 450 nm within 15 min.

[0064] like Figure 7As shown, recombinant humanized type IV collagen Pro.C4 has a unique advantage in the production of Elastin, and the Elastin content of fibroblasts in the sample group can reach up to 1822.45 pg / mL. This further shows that recombinant humanized type IV collagen Pro.C4 can increase skin tightness and tighten the skin by producing a large amount of Elastin.

Claims

1. A recombinant type IV collagen Pro.C4, characterized in that Its amino acid sequence is shown in any one of SEQ ID NO.1-5.

2. The gene encoding the recombinant type IV collagen Pro.C4 according to claim 1.

3. The coding gene according to claim 2, characterized in that The nucleotide sequence thereof is shown in any one of SEQ ID NOs.6-10.

4. The expression vector of the recombinant type IV collagen Pro.C4 according to claim 1.

5. The host bacteria of the recombinant type IV collagen Pro.C4 as claimed in claim 1.

6. The method for preparing the recombinant type IV collagen Pro.C4 according to claim 1, characterized in that The steps include: (1) constructing the expression vector according to claim 4 and transforming it into an expression host bacterium; (2) Cultivating the expression host bacteria and inducing the expression of the recombinant protein; (3) Purify the expression product to obtain the recombinant type IV collagen Pro.C4 as described in claim 1.

7. Use of the recombinant type IV collagen Pro.C4 described in claim 1 in promoting cell proliferation in vitro.

8. Use of the recombinant type IV collagen Pro.C4 described in claim 1 in promoting cell migration in vitro.

9. Use of the recombinant type IV collagen Pro.C4 according to claim 1 in promoting cell secretion of Elastin in vitro.

10. Use of the recombinant type IV collagen Pro.C4 according to claim 1 in the preparation of beauty products.

Images