Probe combination, kit and detection method for detecting influenza A virus

Abstract

The present invention provides a probe combination, a kit and a detection method for detecting influenza A virus. The probe combination includes a probe for capturing HA gene and a probe for capturing NA gene, and the probe combination includes a combination of nucleic acid sequences as shown in SEQ ID NOs: 1-198. The problem that it is difficult to quickly capture all known subtypes of influenza A virus in the prior art can be solved, and the method is applicable to the field of gene sequencing.

Description

Technical Field

[0001] The present invention relates to the field of gene sequencing, and in particular to a probe combination, a kit and a detection method for detecting influenza A virus. Background Art

[0002] Influenza is an acute respiratory infectious disease caused by influenza virus. Influenza viruses are divided into three types according to their surface proteins: type A, type B, and type C. Among them, type A and type B influenza viruses are the main viruses that cause seasonal influenza epidemics. The mutation of type B influenza virus will produce new mainstream strains, but there is cross-immunity between the new strain and the old strain, that is, the immune response to the old strain is still effective against the new strain; and type A influenza virus is the type that mutates most frequently, and antigenic drift will occur within the subtype, which usually occurs every 2 to 3 years, often causing seasonal or local epidemics. Every ten years, a major antigenic mutation will occur, resulting in a new strain.

[0003] Influenza A virus contains 8 negative-strand RNA genome segments, three medium-sized RNA segments encode HA, NA and NP, of which hemagglutinin (HA) and neuraminidase (NA) are the key surface proteins of influenza A virus. Hemagglutinin is a columnar trimer that basically covers the entire surface of the virus with the same spacing. During the virus infection process, HA binds to the host surface protein, mediates the binding of the virus membrane to the host cell nuclear membrane, and plays an important role in the process of virus transmission; neuraminidase is a tetramer composed of four subunits, which is not evenly distributed on the virus surface, but aggregates into groups, participates in the replication of the virus in multiple ways, and promotes the release of virus particles from infected host cells. According to the differences in hemagglutinin and neuraminidase on the virus surface, influenza A virus is divided into different subtypes. Serotypes are divided according to HA and NA genes, where HA (1-16) includes H1, H2, H3, H4, H5, H6, H7, H8, H9, H10, H11, H12, H13, H14, H15, and H16, and NA (1-11) includes N1, N2, N3, N4, N5, N6, N7, N8, N9, N10, and N11.

[0004] At present, the influenza A virus (Influenza A virus) that is prevalent in the population is mainly some subtypes of H1N1 and H3N2 influenza viruses. At present, the main methods for tracking the HA and NA gene mutations of influenza A virus are virus cell culture, serological diagnosis technology, Sanger sequencing and targeted NGS detection technology. Among them, virus cell culture is a classic method, which is to isolate the virus from infected tissue cells for identification. Although the results are reliable, it takes a long time. Generally, cell culture takes 3-4 days, and the isolation and culture of avian influenza virus needs to be carried out in a biosafety level 3 laboratory (BSL-3), which is not suitable for rapid detection of viruses. Serological diagnostic techniques include hemagglutination test and hemagglutination inhibition test (HI), agar diffusion test (AGP), ELISA, neutralization test (NT) and immunofluorescence technology (IFA). These methods have good specificity and are often used to identify subtypes, but serological methods usually require a long time of culture and processing. The Sanger sequencing process is as follows: specific primers are used to amplify NA and NA genes, vector construction, and Sanger sequencing. This technical process is relatively cumbersome, and it is necessary to identify the virus subtype according to the serotype, and then use specific primers for amplification. The primers need to be designed for conservative sequences, and the pathogen genome amplification often fails to be completed due to virus mutations. Targeted NGS sequencing is divided into multiplex PCR amplification and liquid hybridization capture technology. Multiplex PCR amplification requires primers that cover all subtypes, and there is a phenomenon of missed detection or inability to complete the amplification of the full-length genome for mutant strains; liquid hybridization capture technology designs specific probes based on the target sequence, and the probe specifically binds to the target to capture the target for sequencing. The probe has a certain fault tolerance and can track virus mutations, but the traditional liquid hybridization capture technology process is relatively cumbersome, which limits its application in the field of pathogen detection.

[0005] In summary, it is difficult for the existing methods to quickly and accurately identify all known subtypes of influenza A virus, and there is an urgent need to develop a new detection method. Summary of the invention

[0006] The main purpose of the present invention is to provide a probe combination, a kit and a detection method for detecting influenza A virus, so as to solve the problem in the prior art that it is difficult to quickly capture all known subtypes of influenza A virus.

[0007] In order to achieve the above object, according to the first aspect of the present invention, a probe combination for detecting influenza A virus is provided, the above probe combination includes a probe for capturing HA gene and a probe for capturing NA gene, and the probe combination includes a combination of nucleic acid sequences as shown in SEQ ID NOs: 1-198.

[0008] Furthermore, the probes in the probe combination all contain biomarkers.

[0009] Further, the biomarker includes biotin.

[0010] In order to achieve the above object, according to a second aspect of the present invention, a kit for detecting influenza A virus is provided, the kit comprising the above probe combination for detecting influenza A virus.

[0011] Furthermore, the kit also includes any one or more of the following: hybridization reaction solution, elution buffer, streptavidin magnetic beads, nucleic acid purification magnetic beads, reverse transcription buffer, PCR buffer, reverse transcriptase, DNA polymerase, end repair enzyme, end repair reaction buffer, linker containing molecular tag, library amplification primer, linker blocker, DNA blocker, hybridization enhancer or capture library PCR primer.

[0012] In order to achieve the above object, according to the third aspect of the present invention, a method for detecting influenza A virus is provided, which comprises: a) extracting RNA from a sample and performing reverse transcription to obtain a cDNA library; b) hybridizing a probe combination with the cDNA library to obtain a probe-target fragment complex; the probe combination is the above-mentioned probe combination for detecting influenza A virus, or the probe combination in the above-mentioned kit for detecting influenza A virus; c) performing PCR amplification on the probe-target fragment complex to obtain a capture library; d) sequencing the capture library to detect influenza A virus in the sample.

[0013] Furthermore, the influenza A virus is composed of an HA subtype and a NA subtype, the HA subtype is selected from any one or more of H1, H2, H3, H4, H5, H6, H7, H8, H9, H10, H11, H12, H13, H14, H15 or H16; the NA subtype is selected from any one or more of N1, N2, N3, N4, N5, N6, N7, N8 or N9.

[0014] Furthermore, the influenza A virus includes any one or more of H1N1, H3N2, H3N8, H5N1, H9N2 or H7N9.

[0015] Furthermore, the detection method is a detection method for non-diagnostic or therapeutic purposes.

[0016] Further, b) includes: mixing the cDNA library with the probe combination to obtain a hybridization system; placing the hybridization system at 55-65°C for hybridization for 0.5-2 hours; after the hybridization reaction is completed, using magnetic beads to capture and purify the probe-target fragment complex in the hybridization system to obtain the probe-target fragment complex.

[0017] By applying the technical solution of the present invention and utilizing the above-mentioned probe combination, it is possible to achieve specific capture of all influenza A virus subtypes, thereby achieving typing and identification of influenza A virus in a single sample, with a fast detection speed, which can meet the timeliness of epidemiological pathogen detection. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] The drawings constituting a part of the present application are used to provide a further understanding of the present invention. The exemplary embodiments of the present invention and their descriptions are used to explain the present invention and do not constitute an improper limitation of the present invention. In the drawings:

[0019] Figure 1 A schematic diagram of a detection method according to an embodiment of the present invention is shown.

[0020] Figure 2 The detection frequency result diagram according to Example 1 of the present invention is shown.

[0021] Figure 3A The influenza virus genome coverage and coverage depth results according to Example 2 of the present invention are shown.

[0022] Figure 3B The influenza virus genome coverage and coverage depth results according to Example 2 of the present invention are shown.

[0023] Figure 3C The influenza virus genome coverage and coverage depth results according to Example 2 of the present invention are shown.

[0024] Figure 3D The influenza virus genome coverage and coverage depth results according to Example 2 of the present invention are shown.

[0025] Figure 3E A graph showing the result of the variant site group according to Example 2 of the present invention is shown.

[0026] Figure 4 The results of sample detection of multiple mixed-infection influenza strains according to Example 3 of the present invention are shown.

[0027] Figure 5 The coverage depth results of influenza A virus according to the detection method of Example 4 of the present invention are shown.

[0028] Fig. 6A The coverage depth results of influenza A virus according to the detection method of Example 4 of the present invention are shown.

[0029] Figure 6B The coverage depth results of influenza A virus according to the detection method of Example 4 of the present invention are shown.

[0030] Figure 6CThe coverage depth results of influenza A virus according to the detection method of Example 4 of the present invention are shown. DETAILED DESCRIPTION

[0031] It should be noted that, in the absence of conflict, the embodiments and features in the embodiments of the present application can be combined with each other. The present invention will be described in detail below in conjunction with the embodiments.

[0032] As mentioned in the background technology, it is difficult to complete the identification of various subtypes of influenza virus, especially influenza A virus, in a short time in the prior art. In order to overcome the above problems, in this application, the inventors try to develop a probe combination for detecting influenza A virus, and on this basis develop a liquid phase hybridization capture technology with high detection sensitivity and simple process for typing and identification of influenza A virus. Therefore, a series of protection schemes of this application are proposed.

[0033] In a first typical embodiment of the present application, a probe combination for detecting influenza A virus is provided, wherein the probe combination comprises an HA gene probe and a NA gene probe, and the probe combination comprises a combination of nucleic acid sequences as shown in SEQ ID NOs: 1-198.

[0034] The specific sequences of the probes are shown below.

[0035] SEQ ID NO:1:tgaactactggacactagtagaaccgggagac,SEQ ID NO:2:aataacattcgaagcaactggtaatctagtggcac,SEQ ID NO:3:aggtatgcattcaatggaaagaagctgatct,SEQ ID NO:4Qtca:cacaatattcagccattcatcat ID NO:5:ttgtcagaccgagggtgcttaaacaccagcc,SEQ ID NO:6:ccatttcaaatgtacatccgatcacgattgggaat,SEQ ID NO:7:ccaagtatgtaagagcacaaattgagactggc,SEQ ID NO:agatcaa:gaggcat SEQGGAGGAG NO:9:cttggactctagatacatgggatgtcataaactttga,SEQID NO:10:gcactggtaatttaattgcaccagaatatggattcaaat,SEQ ID NO:11:caaagagaggaagctcaggaattatgagacagag,SEQ ID NO:12:aacacttgaaaattgtgagaccagatgtcagaccc,SEQID NO:13:ttaggggcaataaatacaatgccttccacaa,SEQ ID NO:14:ttcacccactgacaataggtgagtgccgacaat,SEQ ID NO:cagatggaggaggaccc IDNO:16:cccattggcaaatgtaagtctgaatgcatcactcc,SEQ ID NO:17:atggaagcattccaatgacaaccgttccaaaatgtaaa,SEQ ID NO:18:ggatcacatacggggcctgtcccaaatatgttaag,SEQ IDNO:19:aagcaccctgaaactggcaggacaggaatgcgaatg,SEQ ID NO:20:ccagagaaaaccagaggcatatttggcgcaat,SEQ ID NO:21:cgggtttcatagaaaatggatgggaggggaatggtg,SEQ ID NO:22:tggttggtacggtttcaggcatcaaaattctgagg,SEQ ID NO:23:gactgattcggagatgaacaagctctttgaaagagg\SEQ ID NO:24:aggcgacaactcagggagaatgctgaggacaaagg,SEQ ID NO:25:atgggtgctttgaaatattccacaagtgtgacaaa,SEQ ID NO:26:gcattgaaagcattcggaatgggacctatgatcat,SEQ ID NO:27:tgtttatagagatgaagcgatcaaccgattccaaata,SEQ ID NO:28:gggagtcaaattgacccaggggtacaaggacatca,SEQ ID NO:29:ctttggattcgttctccatatcatgctttttgctc,SEQ ID NO:30:gcccaagacaacaaaaaa ID NO:31:tctgtgatctaaatggggtgaagcctctgattttaaa,SEQ ID NO:32:attgtagtgtagctggatggctcctcggaaaccca,SEQ ID NO:33:gtgcgacgaattcatcagagtgccggaatggtcct,SEQ ID NO:34:atagtggagcgggctaatccagctaatgacctg,SEQ ID NO:35:acccagggagcctcaatgactacgaagaactgaaa,SEQ ID NO:36:cctgttgagcagaataaatcactttgaagagattctgat,SEQ ID NO:37:tccc NO:38:agaacctgcatgaaagggtcaaatcacaactgaga,SEQ ID NO:39:caatgctaatgacttagggaacgggtgctttgaat,SEQ ID NO:40:tggcataagtgtgacaatgaatgtatggagtcagt,SEQ ID NO:41:aaaatggtacctttaactaccccaagtatcaagcc,SEQ IDNO:42:gagtaggttaaacagacagaaaatagaatcagtaaaattg,SEQ ID NO:43:ggagtttggcgtgtatcaaatccttgccatatata,SEQ ID NO:44:agggtatggagcagtctagttgtggtagggctgat,SEQ IDNO:45:cggcaatgggtctttggatgtgttcaaatggctca,SEQ ID NO:46:attcgctctgattacgaccattccgacaaatgcag,SEQ ID NO:47:aaaatctgcctcggacatcactccgtgtcaaacgg,SEQ ID NO:48:ccaaagtaaacacattaactgaaaaaggagtggaagtc,SEQ ID NO:49:caatgcaaccgaaacagtggaacgaacaaacaccc,SEQ ID NO:50:aggatctgctcaaaagggaaaaagacagttgacct,SEQ ID NO:51:gtcaatgtggactcctgggaacaatcactggacca,SEQ ID NO:52:tcaatgtgaccaattcctaaaattttcagccgatttaatt,SEQ ID NO:53:acatgattctaatgtcaaaaacctgtttgatgaagtaagg,SEQ ID NO:54:gagactttctgccaatgcaatagatgctgggaatg,SEQ ID NO:55:tgcttcgatatacttcacaaatgtgacaatgaatgcatg,SEQ ID NO:56:gactataaagaatgggacttatgatcataaggagtatgag,SEQ IDNO:57:agaggccaaactggaaaggagcaagatcaatggag,SEQ ID NO:58:aaactagaggaaaataccacctataagattctcagcattt,SEQ ID NO:59:agtacagtggcggccagtctttgcttggcaatcct,SEQ IDNO:60:agagcgttgggttccaatgctgtggagatggaaa,SEQ ID NO:61:ggtgtttcgagctatatcacaatgtgatgaccaat,SEQ ID NO:62:atggacaattcgaaatgggacctataacaaaaggaaat,SEQ IDNO:63:caagaggagtcaaattggaagacagaaaatagaagg,SEQ ID NO:64:tcaagttggaatctgaggaacttacaaatcctcac,SEQ ID NO:65:tttattcgactgtcgcctcatctcttgtgattgca,SEQ IDNO:66:ggggtttgctgccttttgttctgggccatgtcca,SEQ ID NO:67:atcaagctgagctattggtagcaatggagaaccag,SEQ ID NO:68:cacaatcgatatggctgattcagaaatgttgaatctatat,SEQ IDNO:69:aagagtgagaaaaaactcaggcaaatgcagagaa,SEQ ID NO:70:tgggaaaggatgttcgaaatatatcacacttgtgatgat,SEQ ID NO:71:atgcatggagagcatagaaaacacatacgacc,SEQ IDNO:72:tcacagtacagagaagaagctattttaaaaagactgaata,SEQ ID NO:73:aacccagtgacactctcttctggcttaaagacat,SEQ ID NO:74:gaggatgctaaaggacaatgccaagatgagggaa,SEQ IDNO:75:ggatgttcaccttttaccataagtgtgacaacaatg,SEQ ID NO:76:tcgaaagggttaggaatgggacatacgatcacaa,SEQ ID NO:77:attcgaggaagaatctaaaatcaatcgtcaggagatc,SEQ IDNO:78:gggagtgaaattagactccaatgggaatgtatataaata,SEQ ID NO:79:gtcaatttacagctgcattgcaagcagtctcgtat,SEQ ID NO:80:gcagcactcatcatgggtttcatcttctgggcgtg,SEQ IDNO:81:cggatcagaagggtgttaaaagaaaacgcaatagata,SEQ ID NO:82:ggagatgggtgttttgaaatactacataaatgcaatgatg,SEQ ID NO:83:tgcatgaatacaatcaaaaacgggacttataaccacca,SEQID NO:84:actacgaagaagagagtaggcttgagcgacaaaga,SEQ ID NO:85:taatggagtgaaacttgaagagaactctacatataaaatc,SEQ ID NO:86:gagcatctacagcagtgttgcctcaagcttagtat,SEQID NO:87:ctgctcatgattattgggggtttcattttcggatg,SEQ ID NO:88:gtacttaagcacaaactcatcagaaagggttgaca,SEQ ID NO:89:ctgttagagaataatgtcccggttacaagctctgt,SEQ ID NO:90:acttggttgagactaaccacacaggaacatattgtt,SEQ ID NO:91:ttgggtggaattagtccggtgcatttgggagactg,SEQ ID NO:92:gcttcgagggctggattctagggaaccctgcctgt,SEQ ID NO:93:cagcaacctggggattagagaatggtcatatttga,SEQ ID NO:94:gaagacccttctgctcctcatggattgtgctatcc,SEQ ID NO:95:gagagttagacaacaatggagaattgaggcacttattta,SEQ ID NO:96:caaagttgcaacaggaagagtaacggtgtctaccc,SEQ ID NO:97:tcagatcaaatcagcattattcccaacataggaagtaga,SEQ ID NO:98:aagagtgaggaaccagagcggcagaataagcatct,SEQ ID NO:99:tggactctagtaaacccaggggattccatcatctt,SEQ ID NO:100:acagcatcgggaacttacgcaccaagaggccac,SEQ ID NO:101:caaatagcaaatccaaggagcactgtgctta,SEQ ID NO:102:agtgacaagaagattggattgcatgcacaagcccttg,SEQ ID NO:103:taccgataaggttcaatccaagtgataaaccttt,SEQ ID NO:104:aggatcgacttccattggatgctactagacccagg,SEQ ID NO:105:atacagtcactttttaccttcaatggtgcgttcatag,SEQ ID NO:106:cctgatagagccagcttcctccgctctaatgccct,SEQ ID NO:107:caggagttgaatacaatgggaaatcactgggaata,SEQ ID NO:108:gagtgatgcacaactcgatgactcatgtgaagggg,SEQ ID NO:109:tgtttctacagtggaggaacgattaatagcccgtt,SEQ ID NO:110:cgttccaaaacatcgatagcagcagttggaaaa,SEQ ID NO:111:tcccagatatgtgaagcagtcaagtctcccactgg,SEQ ID NO:112:cagaaatctacatcaggtcaaagggcattgaa,SEQ ID NO:113:ataatgcaattgacgaaggagatggttgcttcaatctt,SEQ ID NO:114:acacaaatgcaatgactcatgtatggaaccattagaat,SEQ ID NO:115:tacctacaatcatgagattaccaggagaatcacaact,SEQ ID NO:116:agagacaggaaattgggggaataaatttaagactgaga,SEQ IDNO:117:atgtttataaaatactatcgatttatagctgcattgcaag,SEQ ID NO:118:gtattgtgctggtaggtctcatacttgcatttataatgt,SEQ ID NO:119:gcaagtgcttgtcatgatggcaccaattggctaac,SEQ ID NO:120:ttggaatttctggcccagacagtggggcagtggct,SEQ ID NO:121:gttaaaatacaatggcataataacagacactatcaagagt,SEQ ID NO:122:gaggaacaagatattgaacacaagagtctgaatgt,SEQ ID NO:123:atgtgtaaatggttcttgctttaccataatgaccgatg,SEQ ID NO:124:ccaagtgatggacaggcctcatacaaaatcttcag,SEQ ID NO:125:tagagaagggaaagataatcaaatcagtcgaaatgaagg,SEQ ID NO:126:gtgttcctttccatctggggaccaagcaagtgtgc,SEQ ID NO:127:agcatggtccagctcaagttgtcacgatggaaaag,SEQ ID NO:128:tggctgcatgtttgtataacgggggatgaaaaat,SEQ ID NO:129:aactgctagcttcatttacaatgggaggcttgtag,SEQ ID NO:130:agtgttgtttcatggtccaacgatattctcagaac,SEQ ID NO:131:aggagtcagaatgcgtttgtatcaatggaacttgt,SEQ ID NO:132:agtagtaatgactgatggaaatgctacaggaaaagct,SEQ ID NO:133:tactaaaatactattcattgaggaggggaaaatcgttc,SEQ ID NO:134:cgatgggaaggaatggatgcatatttgtatgactg,SEQ ID NO:135:aacgacaatgatgcgagtggccaaatatatgca,SEQ ID NO:136:gagaatgacagactccattagatcatggaaaaaggatata,SEQ ID NO:137:aagaactcaagagtctgaatgtcaatgcattgacg,SEQ ID NO:138:acctgtgttgtagctgtaacagatggtcctgcggc,SEQ ID NO:139:gtagtgcagaccaccgaatctactggatacgagaa,SEQ ID NO:140:taaggtaatgaagtatgaaaacattcccaaaacaaagata,SEQ ID NO:141:ggttcgaaatggtctgggatgcaaatggatgggtg,SEQ IDNO:142:aacggataaggattcaaatggtgtgcaggacattata,SEQ ID NO:143:caatgacaattggtctggttatagtgggagtttca,SEQ ID NO:144:attagaggagaaacaactggtaggaactgcactgt,SEQ IDNO:145:catgtttttgggttgagatgataagggggcaacct,SEQ ID NO:146:ggaaaaaactatatggactagcggtagtagtattgcattt,SEQ ID NO:147:tggtgttaattctgataccacaggttggtcgtggc,SEQID NO:148:ggttcaagagggcatgtctttgttataagagagcc,SEQ ID NO:149:ttgtggcttgtggtccttcagagtgcaggacattt,SEQ ID NO:150:cttaactcaaggcgctctgttgaatgataagcatt,SEQ IDNO:151:aacaatacggtaaaagacaggagtccctatcgagc,SEQ ID NO:152:taatgagcgtgccattgggatcctctcccaatgct,SEQ ID NO:153:ccaagccaaatttgagtccgtcggatggtctgcta,SEQ ID NO:154:gcctgccatgacgggaaggagtggatggctattgg,SEQ ID NO:155:tgagtggtgcagacaatgatgcatatgccgtcatc,SEQ ID NO:156:catatcaaggatgtcaatatgcatctcaggaccga,SEQ ID NO:157:aacaatgcatcagcagtggtgtggtacgggggaag,SEQ ID NO:158:cagtaacagaaatcccatcatgggcagggaaQcatt ID, NO:159:taggactcaagaatcagaatgtgtgccataacg,SEQ ID NO:160:gtctgtccagtggtcatgacagatgtcctgcaaa,SEQ ID NO:161:ataggcagaaactaaataatttattttaaagagggaaa,SEQ ID NO:162:tacagaaaatcgaggaattgaagggtaacgctcaa,SEQ IDNO:163:catcgaggaatgttcgtgttatggaggcaggga,SEQ ID NO:164:cccagatcaagaagtggattgaatgttgaaataccta,SEQ ID NO:165:gcaggtactgatcccaattcttagaatagcagaacg,SEQID NO:166:aagaaattgtcgacaacaatattggtcaggctattcc,SEQ ID NO:167:aagcttcattgactattgggacgatacagtgaatg,SEQ ID NO:168:acaacccgtgtttctacgtagagttaattagaggaa,SEQ ID NO:169:cccgaagaggctaaatgtgtgtgacaagtaa,SEQ ID NO:170:gtttaattgccctatgtgggagcccattcccagtt,SEQ NO:171:gaccattagcagaacgtcagatcgggttttgaa,SEQID NO:172:ttgaaagtcagaaatggctggtacaaaaacagtaaaga,SEQ ID NO:173:aaatcaaaggcaagttgtggtcgataactcaaattSEQggt ID, NO:174:ggatacagtggttctttcacacataccagtggatt,SEQ ID NO:175:aaaaaacgatatggacctcaagtagctccattgtgat,SEQ ID NO:176:gtggagtagactatgagatgccgactggtcatgg,SEQ ID NO:177:acatcctcgaggtctgggtacgagatgttaaaaagt! NO:178:caaatgcattgacagatgatagatcaaagcccatc,SEQ ID NO:179:aggtcagacaattgtaaacgctgactggactg,SEQ ID NO:180:tacagtgggtcttcatagactattgggctgaagg,SEQID NO:181:actgctatcgaggtgtttttgtggagctata,SEQ ID NO:182:tgggaaacccaaggtaaagtgtggtggacca,SEQ ID NO:183:aatagtatagtatcgatgtgttccagtacagaattSEQIDg, NO:184:acaatggaactggcctgacggggctaaaatagagt,SEQ ID NO:185:attggagtaaaatgatgaagtactcctatttatgaatc,SEQ ID NO:186:tctgctggaattgaagggtttgagccatactgtat,SEQ ID NO:187:acagttcctcaaagcaactgtacgaaatacaatgga,SEQ ID NO:188:gattacccttcacagagaggtgctttga,SEQ ID NO:189:tagaggagaaccagaggatgttgatggcccaact,SEQ ID NO:gacaagcaattaaggaagga0: ID NO:191:gataaggaggaagtaacactcagaaagaagggaa,SEQ ID NO:192:ccagcgtccgtagaatgaagggaaagaaacttcc,SEQ ID NO:193:ttgattttgctccaagcaacatagcaccaattggg,SEQ ID NO: 194: aaatccaatctatttgtcaccatgtattcctaactttgat, SEQ ID NO: 195: aaacgtctgggaagcaacgatgtatcatcatcgtg, SEQ ID NO: 196: gcaactttgacaaagacaatgaattgcaactgttttcaaa, SEQ ID NO: 197: acaatttggtgccatccaaatccttcacgtatgag, SEQ ID NO: 198: tgagctatgcatttgttttgtattgcagaaatactaagaa. ,

[0036] The above probe combination is based on probes obtained from genes encoding key surface proteins (hemagglutinin HA and neuraminidase NA) in various subtypes of influenza A viruses.

[0037] When designing this probe combination, we are faced with the problem that HA and NA proteins have high sequence and structural variations between different subtypes, and even within the same subtype, the virus may produce new variants due to antigenic drift. Therefore, in the development of the above-mentioned probe combination, based on the above-mentioned problems, the inventors have developed a variety of probe sequences (such as the above-mentioned SEQ ID NOs: 1-198) to achieve specific capture of viruses of different subtypes. Moreover, even if the virus mutates, the above-mentioned probe combination can widely identify influenza A viruses of different subtypes. And in the design, the inventors also ensure that structures such as dimers will not be formed between the probes, affecting the capture efficiency. Using this probe combination, it is possible to accurately detect one or more influenza A viruses that may be present in the sample.

[0038] Although not all HA and NA combinations exist in nature, because some combinations may not form stable virus subspecies due to biological reasons. But in theory, the above probe combination can identify 16×9=144 different combinations. This is also one of the highlights of this probe combination, which can identify new combinations or gene reassortments, such as the combination of H7N9: the two gene fragments of the virus come from the avian H7N9 virus, which is then transmitted from wild birds to poultry, and reassorts for the second time with the H9N2 virus that was originally prevalent in poultry in a specific area, eventually forming the H7N9 virus that can infect humans. This process reveals that the generation of new influenza viruses may be the result of "multiple reassortments in multiple hosts", and the above probe combination can achieve good identification and tracking.

[0039] The probes in the above-mentioned probe combination are short probes, and the probes can interact with each other (such as the complementary pairing of the terminal base sequences of two consecutive probes to form a side wall), which can enhance the molecular interaction force between the probes and the target, thereby improving the binding stability, and can greatly improve the binding efficiency between the probes, and greatly improve the capture efficiency of the probes for low-copy pathogens.

[0040] When the above probe combination is used to capture influenza A virus in a sample, since there are homologous sequences between different virus subtypes, a single probe may be able to bind to multiple virus subtypes. Therefore, after capture, accurate typing of virus subtypes is achieved by combining and analyzing multiple specific probes detected from the captured sample.

[0041] The above probe combination can achieve full-length capture of all influenza A subtypes within a single day due to the combination of μCaler rapid liquid phase hybridization capture, which is difficult to achieve such a rapid capture effect using existing technologies. In addition, the above probe combination can cover all known and potential subtypes of influenza A with high sensitivity and specificity, providing a comprehensive solution, which is of great significance in disease monitoring and prevention, and the technical advantages far exceed RT-qPCR.

[0042] In a preferred embodiment, all probes in the probe combination contain biomarkers.

[0043] By using the above biomarkers, after the probe hybridizes with the target sequence to form a probe-target fragment complex, the complex can be enriched and purified using magnetic beads that can bind to the biomarkers, facilitating the subsequent construction of a sequencing library for the target fragment.

[0044] In a preferred embodiment, the biomarker comprises biotin.

[0045] In a second typical embodiment of the present application, a kit for detecting influenza A virus is provided, the kit comprising the above-mentioned probe combination for detecting influenza A virus.

[0046] In a preferred embodiment, the kit further includes any one or more of the following: hybridization reaction solution, elution buffer, streptavidin magnetic beads, nucleic acid purification magnetic beads, reverse transcription buffer, PCR buffer, reverse transcriptase, DNA polymerase, end repair enzyme, end repair reaction buffer, linker containing molecular tag, library amplification primer, linker blocker, DNA blocker, hybridization enhancer or capture library PCR primer.

[0047] The above kit can be used not only to capture the genes encoding HA and NA in influenza A virus, but also to perform operations including but not limited to reverse transcribing the RNA genetic information of influenza A virus into cDNA, capturing and purifying the target fragments in the cDNA, and building a library for the captured target fragments, thereby realizing the full process from biological samples to high-throughput sequencing library construction.

[0048] In a third typical embodiment of the present application, a method for detecting influenza A virus is provided, the detection method comprising: a) extracting RNA from a sample and performing reverse transcription to obtain a cDNA library; b) hybridizing the above-mentioned probe combination for detecting influenza A virus, or the above-mentioned probe combination in the kit for detecting influenza A virus, with the cDNA library to obtain a probe-target fragment complex; c) performing PCR amplification on the probe-target fragment complex to obtain a capture library; d) sequencing the capture library to detect the influenza A virus in the sample.

[0049] In the above detection method, based on μCaler rapid liquid phase hybridization capture, the typing and identification of influenza A virus was realized on the NGS platform. Figure 1 As shown in the figure, it is possible to capture 16 subtypes of HA and 11 subtypes of NA of influenza A virus in one experimental process, thereby realizing the identification of various combined subtypes of influenza A virus in one high-throughput sequencing reaction, reducing the time required for detection, improving timeliness, and reducing detection costs.

[0050] In a preferred embodiment, the influenza A virus consists of an HA subtype and a NA subtype, the HA subtype is selected from any one or more of H1, H2, H3, H4, H5, H6, H7, H8, H9, H10, H11, H12, H13, H14, H15 or H16; the NA subtype is selected from any one or more of N1, N2, N3, N4, N5, N6, N7, N8 or N9.

[0051] In a preferred embodiment, the influenza A virus includes any one or more of H1N1, H3N2, H3N8, H5N1, H9N2 or H7N9.

[0052] In a preferred embodiment, the above detection method is a detection method for non-diagnostic or therapeutic purposes.

[0053] In a preferred embodiment, b) includes: mixing the cDNA library with the probe combination to obtain a hybridization system; placing the hybridization system at 55-65°C for hybridization for 0.5-2 hours; after the hybridization reaction is completed, using magnetic beads to capture and purify the probe-target fragment complex in the hybridization system to obtain the probe-target fragment complex.

[0054] In the specific experiment of the present application, some samples infected with a single subtype of influenza were first randomly selected, and the basic performance of the probes was tested. At the same time, the detected gene fragments were assembled to evaluate the genome coverage and coverage depth of the probes for different subtypes; then, the samples infected with a single subtype of influenza were mixed for testing and analysis, and the performance of the designed full-length probe in identifying samples mixedly infected with influenza viruses was further evaluated; finally, samples with a pathogen load gradient were selected to evaluate the detection limit of the inventive process and scheme.

[0055] The beneficial effects of the present application will be further explained in detail below in conjunction with specific embodiments.

[0056] Example 1

[0057] Detection rates of different subtypes of influenza A virus

[0058] Based on the designed and synthesized full-length HA and NA probes, randomly selected influenza samples were identified. The experimental design was based on the μCaler® rapid capture hybridization system as follows.

[0059] The sample information is shown in Table 1.

[0060] Table 1

[0061] .

[0062] The “ / ” means “and”.

[0063] 1. Nucleic Acid Extraction

[0064] 2. Library Construction

[0065] The library was constructed using the NadPrep® Total RNA-To-DNA Module library construction kit as follows:

[0066] 1. RNA fragmentation & random primer binding (B-grade RNA)

[0067] 1.1. Take out the Random Primer and place it on ice to thaw naturally. Mix well and centrifuge it for standby use.

[0068] 1.2. Prepare the reaction system in a 0.2 mL PCR tube placed on ice, as shown in Table 2.

[0069] Table 2

[0070] .

[0071] Note: If the RNA volume is less than 5 μL, add Nuclease Free Water to make up to 5 μL.

[0072] 1.3. Mix well and centrifuge briefly to place all the reaction solution at the bottom of the PCR tube.

[0073] 1.4. Place the PCR tube into the PCR instrument and start the program shown in Table 3 below:

[0074] Table 3 .

[0075] 1.5. Store unused reagents at -25 ~ -15℃.

[0076] This instruction manual divides RNA samples into two levels according to their quality: intact or partially intact Grade A RNA (RIN > 7, 3 < RIN < 7 for cells and general tissues; DV 200 > 50% for FFPE tissues) and highly degraded Grade B RNA (RIN < 3 for cells and general tissues; DV 200 < 50% for FFPE tissues).

[0077] 2. Single-strand synthesis of cDNA (B-grade RNA)

[0078] 2.1. Take out 1 Strand Synth. Buffer and 1 Strand Synth. Enzyme and place them on ice to thaw naturally. Mix well and centrifuge for instant use.

[0079] 2.2. Prepare the reaction system in a 0.2 mL PCR tube placed on ice according to Table 4 below:

[0080] Table 4

[0081] .

[0082] 2.3. Mix well and centrifuge briefly to allow all the reaction solution to settle at the bottom of the PCR tube.

[0083] 2.4. Place the PCR tube into the PCR instrument and start the program shown in Table 5 below:

[0084] Table 5

[0085] .

[0086] 2.5. Store unused reagents at -25 ~ -15℃.

[0087] 3. Second-strand cDNA synthesis

[0088] 3.1. Take out 2nd Strand Synth. Buffer and 2nd Strand Synth. Enzyme and place them on ice to thaw naturally. Mix well and centrifuge for instant use.

[0089] 3.2. Prepare the reaction system in a 0.2 mL PCR tube placed on ice according to Table 6 below:

[0090] Table 6

[0091] .

[0092] 3.3. Mix well and centrifuge briefly to allow all the reaction solution to settle at the bottom of the PCR tube.

[0093] 3.4. Start the reaction program shown in Table 7 below on the PCR instrument. When the temperature stabilizes to 16°C, place the reaction tube into the PCR instrument.

[0094] Table 7 .

[0095] 4. Purification of double-stranded DNA

[0096] 4.1. Add 90 μL of NadPrep® SP Beads to the cDNA double-strand synthesis product prepared above, mix well, and incubate at 25°C for 10 min.

[0097] 4.2. Centrifuge the PCR tube briefly and place it on a magnetic rack for 5 min until the liquid is completely clear. Use a pipette to remove and discard the supernatant.

[0098] Note: It must be made clear that different brands of magnetic racks require adjustment of the placement time.

[0099] 4.3. Slowly add 150 µL of 80% ethanol along the side wall of the PCR tube, being careful not to disturb the magnetic beads. Let it stand for 30 sec, and use a pipette to remove and discard the supernatant.

[0100] 4.4. Repeat step 4.3 once.

[0101] 4.5. After instant centrifugation, place the PCR tube on a magnetic rack and use a 10 µL pipette to remove a small amount of residual ethanol. Be careful not to suck up the magnetic beads.

[0102] 4.6. Open the PCR tube cap and let it stand at room temperature for about 5 min until the ethanol evaporates completely.

[0103] Note: Do not over-dry, otherwise the yield will be reduced.

[0104] 4.7. Remove the PCR tube, add 45 µL Nuclease Free Water to the PCR tube, use a pipette to evenly suspend the magnetic beads, and incubate at 25°C for 2 min.

[0105] 4.8. Centrifuge the PCR tube briefly and place it on a magnetic rack for 2 min until the liquid is completely clear. Use a pipette to carefully transfer the supernatant to a new 0.2 mL PCR tube for storage, taking care not to absorb the magnetic beads.

[0106] 4.9. Use a nucleic acid fluorescence quantifier to quantify double-stranded DNA.

[0107] 4.10. Double-stranded DNA products should avoid repeated freezing and thawing and can be stored at -25 ~ -15℃ for one week or at -80℃ for longer term storage.

[0108] 5. End repair & A addition

[0109] 5.1. Take out End Repair & A-Tailing Buffer and dissolve it at room temperature. Mix well and place on ice for later use.

[0110] 5.2. Take out End Repair & A-Tailing Enzyme and place it on ice to thaw naturally. Mix well and centrifuge it for later use.

[0111] 5.3. Prepare the reaction system in a 0.2 mL PCR tube placed on ice according to Table 8 below:

[0112] Table 8

[0113] .

[0114] Note: If the amount of DNA is less than 40 μL, add Nuclease Free Water to make up to 40 μL.

[0115] 5.4. Mix well and centrifuge briefly to allow all the reaction solution to settle at the bottom of the PCR tube.

[0116] 5.5. Start the reaction program shown in Table 9 below on the PCR instrument. When the temperature stabilizes to 20°C, put the reaction tube into the PCR instrument:

[0117] Table 9

[0118] .

[0119] Note: This program is run with the heated lid set at 70°C.

[0120] 5.6. Store unused reagents at -25 to -15℃.

[0121] 6. Connector connection

[0122] 6.1. Take out the Ligation Buffer and dissolve it at room temperature. Mix well and place it on ice for later use.

[0123] Note: Ligation Buffer is very viscous. Pipette aspiration and release should be slow and steady to ensure accurate volume.

[0124] 6.2. Take out the DNA Ligase and place it on ice to thaw naturally. Mix well and centrifuge it for standby use.

[0125] 6.3. Take out the above PCR reaction tube from the PCR instrument, place it on ice, and prepare the reaction system according to the following Table 10:

[0126] Table 10

[0127] .

[0128] Note 1: To avoid self-ligation of the adapter, NadPrep® Universal Stubby Adapter should be added to the bottom of the PCR tube before adding Ligation Buffer and DNA Ligase.

[0129] Note 2: When operating multiple samples, in order to avoid self-ligation of adapters due to slow operation, the Ligation Buffer and DNA Ligase mixture should be pre-prepared in proportion.

[0130] 6.4. Mix well and centrifuge briefly to allow all the reaction solution to settle at the bottom of the PCR tube.

[0131] 6.5. Start the reaction program shown in Table 11 below on the PCR instrument. When the temperature stabilizes to 20°C, put the reaction tube into the PCR instrument:

[0132] Table 11

[0133] .

[0134] NOTE: A heated lid is not required for this procedure.

[0135] 6.6. Store unused reagents at –25 ~ –15℃.

[0136] 6.7. Purification of Ligation Product

[0137] 6.7.1. Take out the NadPrep® SP Beads in advance, vortex mix, and equilibrate at room temperature for 30 minutes before use.

[0138] 6.7.2. Add 40 μL of NadPrep® SP Beads to the ligation reaction product prepared above, mix well, and incubate at 25°C for 5–10 min.

[0139] 6.7.3. Centrifuge the PCR tube briefly and place it on a magnetic rack for 5 minutes until the liquid is completely clear. Use a pipette to remove and discard the supernatant.

[0140] Note: It must be made clear that different brands of magnetic racks require adjustment of the placement time.

[0141] 6.7.4. Slowly add 150 µL of 80% ethanol along the side wall of the PCR tube, taking care not to disturb the magnetic beads. Let it stand for 30 seconds and use a pipette to remove and discard the supernatant.

[0142] 6.7.5. Repeat step 6.7.4 once.

[0143] 6.7.6. Centrifuge the PCR tube briefly and place it on a magnetic rack. Use a 10 µL pipette tip to remove a small amount of residual ethanol, being careful not to suck up the magnetic beads.

[0144] 6.7.7. Open the PCR tube cap and let it stand at room temperature for about 5 minutes until the ethanol evaporates completely.

[0145] Note: Do not over-dry, otherwise the yield will be reduced.

[0146] 6.7.8. Remove the PCR tube, add 20 µL Nuclease Free Water to the PCR tube, and perform PCR amplification with magnetic beads.

[0147] 8. PCR Amplification

[0148] 8.1. Take out 2X HiFi PCR Master Mix and NadPrep® Universal UDI-Index Primer Mix and place them on ice to thaw naturally. Mix well and centrifuge them for later use.

[0149] 8.2. Prepare the reaction system in a 0.2 mL PCR tube placed on ice according to Table 12 below (add from top to bottom):

[0150] Table 12

[0151] .

[0152] 8.3. Place the PCR tube into the PCR instrument and start the following program as shown in Table 13:

[0153] Table 13

[0154] .

[0155] 8.4. Store unused reagents at -25 to -15℃.

[0156] 9. Amplification Library Purification

[0157] 9.1. Add 50 µL of NadPrep® SP Beads to the PCR tube containing the amplification product prepared above, mix well, and incubate at 25°C for 5-10 min.

[0158] 9.2. Centrifuge the PCR tube and place it on the magnetic rack.

[0159] Incubate for 5 min until the liquid is completely clear and discard the supernatant using a pipette.

[0160] Note: It must be made clear that different brands of magnetic racks require adjustment of the placement time.

[0161] 9.3. Slowly add 150 µL of 80% ethanol along the side wall of the PCR tube, being careful not to disturb the magnetic beads. Let it stand for 30 seconds and use a pipette to remove and discard the supernatant.

[0162] 9.4. Repeat step 9.3 once.

[0163] 9.5. After instant centrifugation, place the PCR tube on a magnetic rack and use a 10 µL pipette tip to remove a small amount of residual ethanol. Be careful not to suck up the magnetic beads.

[0164] 9.6. Open the PCR tube cap and let it stand at room temperature for about 5 min until the ethanol evaporates completely.

[0165] Note: Do not over-dry, otherwise the yield will be reduced.

[0166] 9.7. Remove the PCR tube, add 20 µL TE Solution to the PCR tube, use a pipette to evenly suspend the magnetic beads, and incubate at 25°C for 2 min.

[0167] 9.8. Centrifuge the PCR tube briefly and place it on a magnetic rack for 2 min until the liquid is completely clear. Use a pipette to carefully transfer the supernatant to a new 0.2 mL PCR tube for storage. Be careful not to suck up the magnetic beads.

[0168] 3. Hybridization Capture

[0169] Hybrid capture was performed using the μCaler® Hybrid Capture Reagents v2 hybrid capture kit as follows:

[0170] The preparation work is shown in Table 14.

[0171] Table 14

[0172] .

[0173] Note: If μHyb #1 and Wash Buffer A Pro are to be aliquoted for use / storage, the original tube / bottle must be heated until the crystals are completely melted before aliquoting. Do not aliquot directly. In addition, ensure that all reagent components are fully melted and vortexed before use.

[0174] 1. Library hybridization

[0175] 1.1. Prepare the hybridization reaction system according to Table 15 below:

[0176] Table 15

[0177] .

[0178] Note: * To maintain the complexity of the library, it is recommended that ≥ 50% of the total volume of each constructed library be used for hybridization. If the total library volume is > 18 μL, the library can be concentrated. The number of pre-libraries contained in the total library can be selected as 1, 2, 3, 4, 5, or 6.

[0179] 1.2. Vortex the hybridization reaction mixture for more than 10 seconds, centrifuge it, and collect the reaction mixture to the bottom of the PCR tube (avoid generating bubbles).

[0180] 1.3. Place the PCR tube into the PCR instrument and start the reaction program as shown in Table 16 below:

[0181] Table 16

[0182] .

[0183] 2. Magnetic Bead Cleaning

[0184] 2.1. Vortex the Streptavidin Beads for 15 seconds to ensure complete mixing.

[0185] 2.2. Take n×25 μL Streptavidin Beads and mix and wash in a 0.2 mL centrifuge tube (n is the total number of capture reactions, and n ≤ 5).

[0186] Note: Return Wash Buffer A Pro to 50-60°C for heating.

[0187] 2.3. Place the Streptavidin Beads on a magnetic rack and let it stand for about 2 minutes. When the liquid is completely clear, discard the supernatant using a pipette.

[0188] 2.4. Remove the centrifuge tube from the magnetic stand, add 150 μL preheated Wash Buffer A Pro, and mix gently by pipetting for more than 10 times.

[0189] 2.5. Place the centrifuge tube on the magnetic rack and let it stand for about 2 minutes. When the liquid is completely clear, use a pipette to discard the supernatant.

[0190] 2.6. Repeat steps 2.4 and 2.5 once.

[0191] Note: When n > 5, it must be divided into multiple tubes for mixed cleaning.

[0192] 2.7. Centrifuge the tube briefly and place it on a magnetic rack for 10 seconds. Use a 10 μL pipette tip to discard all the Wash Buffer A Pro at the bottom of the tube.

[0193] 2.8. Take n×9 μL μHyb #1 to resuspend Streptavidin Beads and gently blow and mix for more than 10 times.

[0194] 3. Magnetic Bead Capture

[0195] 3.1. After the hybridization reaction, enter the capture phase and maintain the PCR instrument running state.

[0196] 3.2. Keep the PCR tube in the PCR instrument, take 8 μL of resuspended Streptavidin Beads and immediately add it to each hybridization reaction solution, and mix it by gently pipetting for more than 10 times.

[0197] 3.3. Incubate at 60℃ for 10 min.

[0198] 3.4. After the incubation is completed, remove the PCR tube from the PCR instrument and place it on a magnetic rack for 2 minutes. When the liquid is completely clear, use a pipette to discard the supernatant (try to remove the supernatant as much as possible).

[0199] 4. Elution

[0200] 4.1. Remove the PCR tube from the magnetic rack, add 150 μL preheated Wash Buffer A Pro, and mix by gently pipetting for more than 10 times (avoiding bubbles).

[0201] 4.2. Place the PCR tube on a magnetic rack and let it stand for 2 min. When the liquid is completely clear, discard the supernatant using a pipette.

[0202] 4.3. Remove the PCR tube from the magnetic stand, add 100 μL preheated Wash Buffer A Pro, mix gently by pipetting for more than 10 times, and transfer the reaction solution to a new PCR tube.

[0203] Note: Try to avoid generating bubbles in this step. Bubbles contacting the tube cap may reduce the hit rate.

[0204] 4.4. Place the PCR tube into the PCR instrument and incubate at 60℃ for 3 min.

[0205] 4.5. After the incubation is completed, remove the PCR tube from the PCR instrument and place it on a magnetic rack for 2 minutes. When the liquid is completely clear, use a pipette to discard the supernatant.

[0206] 4.6. Add 150 μL of room temperature Wash Buffer B to the PCR tube and mix by gently pipetting for more than 10 times.

[0207] 4.7. Place the PCR tube on a magnetic rack and let it stand for 2 min. When the liquid is completely clear, discard the supernatant using a pipette.

[0208] 4.8. Centrifuge the PCR tube briefly and place it on a magnetic rack. Use a 10 µL pipette tip to remove a small amount of residual liquid, being careful not to suck up the magnetic beads.

[0209] 4.9. Add 22.5 μL Nuclease Free Water and gently blow for more than 10 times to resuspend the magnetic beads.

[0210] Optional step: Transfer all resuspended magnetic beads to a new PCR tube to reduce nonspecific capture and increase the on-target rate

[0211] 5. PCR Amplification of Hybrid Capture Library

[0212] 5.1. Take out 2X PCR Master Mix and Primer Mix and thaw them naturally on ice. Use a pipette or vortex mixer to mix them gently and centrifuge them for later use.

[0213] 5.2. Prepare the reaction system in a centrifuge tube placed on ice according to the system in Table 17.

[0214] Table 17

[0215] .

[0216] 5.3. Place the PCR tube into the PCR instrument and start the program shown in Table 18 below.

[0217] Table 18

[0218] .

[0219] After amplification, use Qubit to detect the concentration immediately. It should be >2 ng / µL. Do not over-amplify.

[0220] 6. Library Purification and Quantification

[0221] 6.1. After PCR amplification is completed, take out the PCR tube and place it on a magnetic rack for 2 min until the supernatant is completely clarified. Use a pipette to transfer the supernatant to a new centrifuge tube.

[0222] 6.2. Add 50 µL of NanoPrep SP Beads to the PCR tube and mix well using a pipette or vortex mixer. Incubate at 25°C for 5 min.

[0223] 6.3. Centrifuge the PCR tube briefly and place it on a magnetic rack for 5 min until the supernatant is completely clear. Use a pipette to remove and discard the supernatant.

[0224] 6.4. Slowly add 150 µL of 80% ethanol along the side wall of the PCR tube, being careful not to disturb the magnetic beads. Let it stand for 30 seconds, and use a pipette to aspirate and discard the supernatant.

[0225] 6.5. Repeat step 6.4 once.

[0226] 6.6. Centrifuge the PCR tube briefly, place it on a magnetic rack, and use a 10 µL pipette to remove a small amount of residual ethanol, being careful not to suck up the magnetic beads.

[0227] 6.7. Place the PCR tube back on the magnetic rack and leave it at room temperature for 5 min until the ethanol evaporates completely (do not over-dry, which may damage the DNA and make it difficult to redissolve).

[0228] 6.8. Add 15 µL TE Solution to the PCR tube, use a pipette to evenly suspend the magnetic beads, and incubate at 25°C for 2 minutes.

[0229] 6.9. Centrifuge the PCR tube briefly and place it on a magnetic rack for 2 min until the supernatant is completely clear. Use a pipette to carefully transfer the supernatant to a new centrifuge tube for storage, taking care not to absorb the magnetic beads.

[0230] 6.10. Use Qubit to quantify the library, with a concentration of >2 ng / µL.

[0231] The test results are shown in Table 19:

[0232] Table 19

[0233] .

[0234] The results of this process were compared with the results of qPCR, a traditional disease control detection method. The results showed a high degree of consistency (for detailed detection frequency, refer to Figure 2 ), for four different subtypes of influenza virus, H3N2, H3N8, H5N1 and H7N9, the detection results of this system are basically consistent with the gold standard. This system can be used to detect different subtypes of influenza virus.

[0235] Figure 2 The figure shows the performance of the HA (1-16): H1, H2, H3, H4, H5, H6, H7, H8, H9, H10, H11, H12, H13, H14, H15, H16, and NA (1-11): N1, N2, N3, N4, N5, N6, N7, N8, N9, N10, N11 full-length mixed tube probes designed in the present invention in identifying different influenza A virus subtypes. Randomly selected influenza A infection samples (qPCR identification results): H3N2, H5N1, H3N8 and H7N9, the main abundant virus subtypes detected by the technical process and the qPCR results have a 100% consistency, and the virus subtype detection rates of different samples are 91.5%, 78.8%, 66.5% and 87.2%, respectively.

[0236] Example 2

[0237] Coverage and depth of HA and NA genes of different influenza virus subtypes

[0238] Based on the results of the 4 randomly selected samples in Implementation 2, the coverage rate and coverage depth of influenza virus genomes with high detection frequency and dominant abundance in the samples were analyzed in detail through the bioinformatics terminal. The detailed results are as follows: Figure 3A , Figure 3B , Figure 3C , Figure 3D and Figure 3E From the figure, we can see that the main virus subtypes detected in the four samples have a genome coverage rate of nearly 100% after genome assembly, which can achieve full coverage of HA and NA genes of all subtypes of influenza viruses.

[0239] Figure 3A-3D The coverage and depth of HA and NA genes of different influenza virus subtypes are shown, and Figure 3EThe display shows the mutation site group. From the analysis results, it can be seen that the genome coverage of the main virus subtypes detected in the four samples is close to 100% after genome assembly. Except for the H3 subtype of sample LQ12 (H3), the coverage depth of the rest is relatively uniform. This may be related to the sample itself, because in sample ML24040803-IV, the coverage depth of H3 is relatively uniform; Figure 3E It shows that some bases have certain polymorphism, suggesting that liquid hybridization capture technology has better ability than Sanger sequencing in tracking viral mutations.

[0240] This embodiment illustrates that the HA (1-16): H1, H2, H3, H4, H5, H6, H7, H8, H9, H10, H11, H12, H13, H14, H15, H16, NA (1-11): N1, N2, N3, N4, N5, N6, N7, N8, N9, N10, N11 full-length mixed tube probes designed by the present invention have achieved the expected coverage of the genome of different subtypes, and the coverage depth is relatively uniform, indicating that the performance of the probes designed by the technical process is superior and can meet the requirements of different subtype identification. At the same time, in the process of genome assembly, such as Figure 3E , there will be a display of variant site groups, which is also the advantage of this process. The presentation of base polymorphism suggests that liquid phase hybridization capture technology has the ability to track viral mutations.

[0241] Example 3

[0242] Test results of samples infected with multiple influenza strains

[0243] In order to further evaluate whether the detection method of the present invention can be applied to clinical multi-influenza virus subtype mixed infection, or human common influenza and avian influenza mixed infection, we mixed samples containing multiple influenza virus subtypes for detection, and selected samples such as Example 2. The detection results are shown in Table 20 below.

[0244] Table 20

[0245] .

[0246] It can be seen from Table 20 that the virus subtypes with higher detection frequency are consistent with the target virus subtypes with the highest abundance in the initially selected samples. The consistency rate of the identified serotype combinations with higher abundance and the reference subtypes of the mixed infection samples reached 100%, and the total influenza detection rate accounted for 45.7%. Figure 4 shown.

[0247] Figure 4Table 20 shows the mixed tube probes of 16 HA and 9 NA virus subtypes for samples mixed with influenza strains: mixed with 4 subtypes of H3N2, H5N1, H3N8 and H7N9. The consistency rate of the identified serotype combinations with higher abundance and the reference subtypes of the mixed infection samples reached 100%. The results of the detection and detection frequency of different serotypes are shown as follows Figure 4 shown.

[0248] This example illustrates that the mixed tube probe of 16 HA and 9 NA virus subtypes of the present invention has good identification ability for samples mixed with influenza strains.

[0249] Example 4

[0250] Detection of influenza samples with different viral loads

[0251] In order to further evaluate the advantages of the present invention, in this example, samples with a pathogen load gradient were selected to evaluate the detection limit of the process and scheme of the invention.

[0252] 1. RNA nucleic acid library construction: Nucleic acid extracted from throat swabs was used with NadPrep® Total RNA-To-DNA Module library construction kit to construct RNA library. Samples containing the following pathogens were used for library construction and hybridization capture. Sample selection is shown in Table 21.

[0253] Table 21

[0254] .

[0255] Among them, all samples were selected from influenza A virus infection samples, infected with the same subtype, with a gradient change in pathogen load, to test the detection limit of the technical process of the invention: detected species, detection rate and consistency of clinical identification results.

[0256] Step 1: Library construction

[0257] See Example 1

[0258] Step 2: Hybridization capture

[0259] See Example 1

[0260] The test results are shown in Table 22:

[0261] Table 22

[0262] .

[0263] Note: For HA and NA subtype detection results, only the typing results with the highest read ratio are displayed.

[0264] The above is the downsample as low as 0.02G, clinical sample type: throat swab. The coverage and coverage depth are shown in detail as follows Figure 5 and Fig. 6A , Figure 6B , Figure 6C shown.

[0265] Figure 5 The results show that the detection limit of influenza virus by the system of the present invention is improved: the clinical sample types of throat swabs with different pathogen loads are used for testing, and the results show that the detection limit of full-length assembly of influenza virus is: H1N1 (Ct=34) / H3N2 (Ct=31) / H7N9 (Ct=34), and the HA genome coverage can reach 100%; the detection limit of influenza virus species identification is: H1N1 (Ct=36) / H3N2 (Ct>31) / H7N9 (Ct=37), and the overall performance is better than RT-gPCR.

[0266] Figure 6A-6C The figure shows the analysis of the sequencing depth of samples with HA genome coverage reaching 100% detected by the system of the present invention in the detection of samples with different viral loads.

[0267] Among them, when analyzing the full-length coverage of HA and NA: H1N1 (Ct=34) / H3N2 (Ct=31) / H7N9 (Ct=34), the HA genome coverage can reach 100%.

[0268] The detection limits of influenza virus species identification were: H1N1 (Ct=36) / H3N2 (Ct>31) / H7N9 (Ct=37), and the overall performance was better than that of RT-gPCR.

[0269] For the two samples with negative Ct values ​​in Table 22: H3N2 ML240423H3-7_S57 was not detected by RT-qPCR, but the current process can detect it, and the genome coverage is above 50%; H7N9 ML240423H7-9_S71 sample was not detected by RT-qPCR, but the current process can detect it, but its NA gene coverage and HA gene coverage are significantly different, so it is not included in the coverage analysis here.

[0270] From the above description, it can be seen that the above embodiments of the present invention achieve the following technical effects: the present invention is designed based on the μCaler targeted hybridization capture process, and uses its advantages of rapid hybridization to detect various subtypes of acute influenza, breaking the limitations of the traditional detection technology in the prior art that can only detect a limited number of strains and is time-consuming and labor-intensive.

[0271] Compared with the prior art, the present invention has at least the following advantages:

[0272] 1. More time-effective: Compared with the traditional liquid hybridization capture process, the library construction and capture and sequencing of pathogen samples can be completed within a single day, meeting the timeliness of epidemiological pathogen detection;

[0273] 2. Easier operation / lower cost: Only one library is needed for one sample to complete the identification of all influenza A virus subtypes, which is more clinically accessible than existing technologies such as serological identification;

[0274] 3. Tracking mutations and human-infected avian viruses: The probe has a certain degree of fault tolerance and can track virus mutations. At the same time, since the designed influenza virus subtypes are relatively comprehensive, new subtypes and / or human-infected avian strains can be discovered in a timely manner.

[0275] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. For those skilled in the art, the present invention may have various modifications and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. A probe combination for detecting influenza A virus, characterized in that: The probe combination includes a probe for capturing the HA gene and a probe for capturing the NA gene. The probe combination includes a combination of nucleic acid sequences shown as SEQ ID NOs: 1-198.

2. The probe combination according to claim 1, characterized in that: The probes in the probe combination all contain biomarkers.

3. The probe combination according to claim 2, characterized in that: The biomarker includes biotin.

4. A kit for detecting influenza A virus, characterized in that: The kit comprises the probe combination for detecting influenza A virus according to any one of claims 1 to 3.

5. The kit according to claim 4, characterized in that The kit also includes any one or more of the following: hybridization reaction solution, elution buffer, streptavidin magnetic beads, nucleic acid purification magnetic beads, reverse transcription buffer, PCR buffer, reverse transcriptase, DNA polymerase, end repair enzyme, end repair reaction buffer, adapter containing molecular tags, library amplification primers, adapter blocker, DNA blocker, hybridization enhancer or capture library PCR primer.

6. A method for detecting influenza A virus, characterized in that: The detection method comprises: a) Extract RNA from the sample and perform reverse transcription to obtain a cDNA library; b) hybridizing the probe combination with the cDNA library to obtain a probe-target fragment complex; the probe combination is the probe combination for detecting influenza A virus according to any one of claims 1 to 3, or the probe combination in the kit for detecting influenza A virus according to claim 4 or 5; c) performing PCR amplification on the probe-target fragment complex to obtain a capture library; d) sequencing the captured library to detect the influenza A virus in the sample; The detection method is a detection method not for diagnosis or treatment purposes.

7. The detection method according to claim 6, characterized in that: The influenza A virus is composed of HA subtype and NA subtype. The HA subtype is selected from any one or more of H1, H2, H3, H4, H5, H6, H7, H8, H9, H10, H11, H12, H13, H14, H15 or H16; The NA subtype is selected from any one or more of N1, N2, N3, N4, N5, N6, N7, N8 or N9.

8. The detection method according to claim 7, characterized in that: The influenza A virus includes any one or more of H1N1, H3N2, H3N8, H5N1, H9N2 or H7N9.

9. The detection method according to any one of claims 6 to 8, characterized in that: b) includes: Mixing the cDNA library with the probe combination to obtain a hybridization system; The hybridization system is placed at 55-65° C. for hybridization for 0.5-2 hours; After the hybridization reaction is completed, the probe-target fragment complex in the hybridization system is captured and purified using magnetic beads to obtain the probe-target fragment complex.

Images