A recombinant mutant Myceliophthora thermophila uricase and its application

Abstract

The present invention discloses a recombinant mutant Myceliophthora thermophila uricase and an application thereof; the recombinant mutant Myceliophthora thermophila uricase P227Q of the present invention has an in vitro catalytic activity increased by 114% compared with the wild-type uricase; the activity retention time at -80°C, -20°C, 4°C and room temperature is extended to 30 days. The recombinant mutant Myceliophthora thermophila uricase mutant of the present invention has higher catalytic activity and better stability, and can be used to prepare drugs for treating diseases related to elevated uric acid, such as hyperuricemia, hyperuricosuria and gout.

Description

Technical Field

[0001] The invention belongs to the field of biomedicine, and specifically relates to a recombinant mutant Myceliophthora thermophila uricase P227Q and an application thereof. Background Art

[0002] Hyperuricemia (HUA) refers to a disease caused by excessive production and / or insufficient excretion of uric acid in the body under normal dietary conditions. Hyperuricemia is closely related to many metabolic diseases. In related studies, hyperuricemia increases the incidence of hypertension, and asymptomatic hyperuricemia increases the risk of hypertension, chronic kidney disease, and obesity by 2-3 times. During chemotherapy for hematological tumors such as leukemia and lymphoma, a large number of tumor cells die and lyse, and a large amount of intracellular nucleic acid is degraded, causing a sharp increase in plasma uric acid. In a short period of time, a large amount of uric acid is deposited in the kidneys, causing acute renal failure, forming tumor lysis syndrome (TLS) represented by hyperuricemia.

[0003] Uric acid is the final product of purine metabolism in the human body. Excessive uric acid levels can lead to diseases such as gout and hyperuricemia. At present, drug therapy is mainly used clinically to lower uric acid levels. The drug treatment mechanism mainly includes inhibiting uric acid production, promoting uric acid excretion, and decomposing uric acid. The xanthine oxidase inhibitors febuxostat and allopurinol reduce serum uric acid concentrations by inhibiting uric acid synthesis, but there are cardiovascular risks and liver function abnormalities, nephrotoxicity, and allergic reactions. They are ineffective when the initial uric acid concentration is very high and are ineffective for some refractory gout. Drugs such as probenecid promote uric acid excretion by inhibiting the reabsorption of uric acid in the renal tubules, but can cause adverse reactions such as renal damage.

[0004] Uricase (uricase, urate oxidase, UOX) is a protein drug that is effective in treating hyperuricemia. It can quickly convert blood uric acid into allantoin, which is more easily soluble and excreted. It has strong specificity and high catalytic efficiency. Clinical studies have shown that uricase can quickly and efficiently reduce serum uric acid with almost no toxic side effects. It has good therapeutic effects on patients with severe hyperuricemia, refractory gout, and tumor lysis syndrome. However, it has disadvantages such as poor stability, easy clearance after administration, and immunogenicity problems, which greatly limit its clinical application.

[0005] Therefore, it is of great significance to develop a stable and catalytically efficient uricase for the treatment of hyperuricemia-related diseases. Summary of the invention

[0006] The first objective of the present invention is to address the deficiencies of the prior art and to provide a recombinant mutant Myceliophthora thermophila uricase with high degradation activity and good stability, which is expected to reduce the therapeutic dosage of uricase and reduce the immunogenicity caused by exogenous proteins.

[0007] The present invention adopts the following technical solutions:

[0008] A recombinant mutant Myceliophthora thermophila uricase comprises a mutation of proline Pro at position 227 to glutamine Gln at a position corresponding to the wild-type Myceliophthora thermophila uricase of SEQ ID NO: 1, denoted as mutant P227Q.

[0009] The mutant P227Q was recombinantly expressed in Escherichia coli as an active soluble tetramer; compared with wild-type uricase, the activity of the P227Q mutant was increased by 114%, the long-term stability was increased by about 1 times, and the activity was maintained at more than 90% of the initial value for nearly 30 days.

[0010] The second object of the present invention is to provide a nucleic acid sequence encoding the above-mentioned recombinant mutant Myceliophthora thermophila uricase.

[0011] The third object of the present invention is to provide an expression vector comprising the above nucleotide sequence.

[0012] The fourth object of the present invention is to provide a host cell, such as an Escherichia coli cell, comprising the above expression vector.

[0013] The fifth object of the present invention is to provide a pharmaceutical composition comprising the above-mentioned recombinant mutant Myceliophthora thermophila uricase. The enzyme can be in a soluble form or a crystalline form. In addition, the composition can contain an agent that increases pH.

[0014] Preferably, the pharmaceutical composition also includes a pharmaceutically acceptable carrier and / or excipient. The pharmaceutical composition can be, for example, formulated into an oral dosage form or a parenteral dosage form. In certain embodiments, the composition is formulated into a powder, granules, pellets, microspheres or small tablets. In certain embodiments, the composition is encapsulated in a capsule such as a hydroxypropyl methylcellulose capsule, a soft gelatin capsule or a hard gelatin capsule, or the composition is formulated into a tablet dosage form.

[0015] The sixth object of the present invention is to provide the use of the above-mentioned recombinant mutant Myceliophthora thermophila uricase in the preparation of a drug for treating hyperuricemia and / or hyperuricosuria.

[0016] The seventh objective of the present invention is to provide the use of the above-mentioned recombinant mutant Myceliophthora thermophila uricase in the preparation of a drug for treating gout.

[0017] In certain embodiments, in any of the above uses, the recombinant mutant Myceliophthora thermophila uricase can be administered alone or in combination with a xanthine oxidase inhibitor (e.g., allopurinol or febuxostat), a uricosuric acid drug (e.g., probenecid, benzbromarone, losartan or lecithinide) or a combination thereof.

[0018] Compared with the prior art, the beneficial effects of the present invention are at least:

[0019] The present invention provides a recombinant mutant Myceliophthora thermophila uricase, which has higher catalytic activity and better long-term stability. In practical applications, it can reduce the total dosage and single dosage, prolong the medication cycle, and is expected to provide a new solution for the treatment of uric acid-related diseases. The present invention uses artificial optimization to optimize the codons of the Escherichia coli expression system according to the amino acid sequence of Myceliophthora thermophila uricase (mtUOX), inserts it into the expression vector, and transfers it into the Escherichia coli strain to express the recombinant uricase. The prokaryotic expression system has lower cost and better yield for preparing uricase, and can achieve economical large-scale production. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 This is the SDS-PAGE diagram of the recombinant uricase purification process, which from left to right are: Marker; before induction; after induction; supernatant; precipitation; flow-through; elution.

[0021] Figure 2 This is the three-dimensional structure of the wild-type thermophilic Myceliophthora uricase.

[0022] Figure 3 These are the results of in vitro enzyme activity tests of wild-type uricase and mutants.

[0023] Figure 4 These are the long-term stability test results of wild-type uricase and mutants, where A is the long-term storage result at -80°C, B is the long-term storage result at -20°C, C is the long-term storage result at 4°C, and D is the long-term storage result at room temperature. DETAILED DESCRIPTION

[0024] The present invention is described in detail below in conjunction with specific embodiments. The following embodiments will help those skilled in the art to further understand the present invention, but are not intended to limit the present invention in any form. It should be noted that, for those of ordinary skill in the art, without departing from the concept of the present invention, several variations and improvements can also be made, which all belong to the protection scope of the present invention.

[0025] The amino acid sequence of the wild-type Myceliophthora thermophila uricase (mtUOX) is shown in SEQ ID NO: 1:

[0026] MPNLASARYGKDNVRVCKVQRDEKTGFHTVTEMTVSCLLEGQIETSYTAADNSVVVATDSIKNTIYIKAKEHPVNPPELYASLLGQHFLDKYPHISTAHVNLAVHRWTRLEVDGAPHPHSFYRDGQETRNVEVAVSRGPGGIRIKSSIVGLSVFKSTGSAFHGFVRDEYTTLPETWDRILSTDVDCSWTWKPFDTVEAVQQRVERFDKAWESARGIILRLFAVEESPSVQNTMYKMSEQILEAVPEVDRVDFALPNKHYFELDLSWHKGIKNTGKDAEVYVPQSGPNGLIKCEVARDETTLAHR

[0027] Its nucleotide sequence is as shown in SEQ ID NO: 2:

[0028] ATGCCGAACTTGGCATCCGCTCGTTACGGCAAAGATAACGTTCGTGTTTGCAAAGTTCAGCGTGATGAAAAAACCGGTTTCCACACCGTTACCGAAATGACTGTTAGCTGTCTGCTGGAAGGTCAGATCGAAACTTCTTACACTGCAGCGGACAACTCCGTTGTTGTTGCGACCGATTCCATCAAGAATACCATCTACATCAAAGCGAAAGAACATCCGGTAAACCCACCGGAACTGTACGCTTCTCTGCTGGGTCAGCACTTCTTGGACAAATATCCACACATCTCTACCGCTCACGTTAACCTGGCTGTGCACCGTTGGACTCGTCTGGAAGTTGATGGTGCACCGCATCCGCACTCTTTCTACCGTGACGGCCAAGAAACTCGTAACGTTGAAGTTGCTGTTTCTCGTGGTCCAGGTGGTATCCGCATCAAATCCAGCATCGTGGGCCTGTCTGTGTTCAAATCTACCGGTTCTGCGTTCCACGGTTTCGTTCGTGACGAATACACCACTCTGCCGGAAACCTGGGACCGTATCTTGTCTACCGACGTTGACTGCTCTTGGACCTGGAAACCGTTCGATACCGTTGAAGCGGTTCAGCAGCGTGTTGAACGTTTCGACAAGGCGTGGGAATCCGCGCGTGGTATCATCTTGCGTCTGTTCGCGGTAGAAGAATCTCCGTCCGTTCAGAACACCATGTACAAGATGAGCGAACAGATCTTGGAAGCAGTACCGGAAGTTGACCGTGTTGATTTCGCTTTGCCGAACAAACACTACTTCGAACTGGACCTGTCTTGGCACAAAGGTATCAAGAACACCGGTAAAGACGCTGAAGTTTACGTACCGCAGTCTGGTCCGAACGGTCTGATCAAATGCGAAGTAGCACGTGACGAAACCACTCTGGCGCACCGT

[0029] The three-dimensional structure diagram of the wild-type Myceliophthora thermophila uricase is as Figure 2 shown.

[0030] Example 1: Construction of recombinant expression vector of Myceliophthora thermophila uricase P227Q mutant

[0031] Using pET28(+)-mtUOX as template, the 227th proline was selected as the mutation site, and the primer sequence of the point mutation primer P227Q was:

[0032] Upstream primer P227Q-F: 5′-AGAATCTCAGTCCGTTCAGAACACCATGTAC-3′

[0033] Downstream primer P227Q-R: 5′-GGACTGAGATTCTTCTACCGCGAACAGACGCAA-3′

[0034] The mutant sequences were constructed by PCR. The high-fidelity enzyme KOD One PCR Master Mix (TOYOBO) was used for point mutagenesis.

[0035] PCR conditions:

[0036] Components Volume (μL) 2×KOD One PCR Master Mix 25 Plasmid template (50 ng / μL) 1 Upstream primer (10 μM) 2.5 Downstream primer (10 μM) 2.5 Sterilized water 19

[0037] The PCR program was as follows: pre-denaturation at 98°C for 3 min; denaturation at 98°C for 10 s; annealing at 60°C for 10 s; and extension at 68°C for 1 min. After 30 cycles of denaturation, annealing, and extension, the final extension was performed at 72°C for 10 min.

[0038] After nucleic acid gel verification, a portion of the PCR product was taken and DpnI enzyme (Biyuntian) was added to react at 37°C for more than 1 h. The digested product was transferred into Escherichia coli DH5α, and the mutant coding sequence was determined by picking single clones on a conventional kanamycin plate to confirm that the thermophilic Myceliophthora uricase mutant was obtained.

[0039] Example 2: Expression and purification of Myceliophthora thermophila uricase mutants

[0040] The target protein was expressed using the Escherichia coli BL21 (DE3) prokaryotic expression system. The transformed Escherichia coli cells were cultured in LB medium (containing 0.1 g / L kanamycin) for 4-6 h, induced with 200 μM isopropyl-β-D-thiogalactoside (IPTG) at 17°C for 12 h, and the cells were collected by centrifugation at 4000 rpm for 15 min. The collected supernatant was used for the purification of the uricase mutant.

[0041] The purification process is to first use affinity chromatography to mix the supernatant of the broken bacterial solution with the nickel medium, and use the 6×His-tag to make the target protein specifically bind to the nickel medium. After low-concentration imidazole washing and high-concentration imidazole elution steps, a high-purity target protein solution is obtained. The purity of the target protein is detected by SDS-PAGE. The results are as follows Figure 1 As shown. The molecular weight of mtUOX and its mutants is about 34.2 kDa. After exploring the pH and salt concentration of the buffer, mtUOX and its mutants are stable in Tris-HCl pH 8.0, 150 mM NaCl solution.

[0042] Example 3: Activity determination of Myceliophthora thermophila uricase mutant P227Q

[0043] Activity determination definition: The amount of enzyme required to catalyze 1 μmol of substrate uric acid per minute is one activity unit.

[0044] Enzyme activity assay steps: Dissolve an appropriate amount of uric acid powder in sodium tetraborate solution at pH 8.6 to prepare a 1 mM uric acid solution. Dilute the appropriate uricase solution to 50 uM with SEC buffer (Tris-HCl pH 8.0, 150 mM NaCl).

[0045] Set the detection wavelength of the microplate reader to 293 nm and 37°C; take a 96-well plate without UV absorption, add 40 uL of uricase solution to the wells in turn, put it in the microplate reader and preheat it for 5 min, then take 160 uL of uric acid solution preheated to 37°C and mix it with the uricase solution, start the reaction, and continuously measure the change of the absorbance value at 293 nm for 20 min, and measure the value every 1 min. Use the same uric acid concentration and no enzyme solution as a blank control.

[0046] The results of in vitro catalytic activity characterization are as follows Figure 3 As shown. The specific enzyme activity of the wild type is 5.35 U / mg, and the specific enzyme activity of the mutant P227Q is 11.49 U / mg. Compared with the wild type, the activity of the mutant P227Q can be increased by 114%. The catalytic reaction activity is compared by the rate of decrease of uric acid concentration. The results show that the mutant of the present invention has good enzyme activity.

[0047] Example 4: Long-term stability determination of Myceliophthora thermophila uricase mutant P227Q

[0048] 50uM uricase solution was stored in 20 mM Tris-HCl pH 8.0, 150 mM NaCl buffer, and placed at -80℃, -20℃, 4℃, and room temperature (RT), respectively. 20ul was taken out for enzyme activity detection on days 0, 3, 7, 14, 21, 28, 35, 42, and 60. The results are shown in Figure 4 shown.

Claims

1. A recombinant mutant Myceliophthora thermophila uricase, characterized in that: The proline Pro at position 227 of the wild-type Myceliophthora thermophila uricase of SEQ ID NO: 1 was mutated to glutamine Gln, which was recorded as mutant P227Q.

2. A nucleic acid, characterized in that The nucleic acid sequence encodes the recombinant mutant Myceliophthora thermophila uricase according to claim 1.

3. An expression vector, characterized in that: The expression vector comprises the nucleic acid of claim 2.

4. A host cell, characterized in that The host cell comprises the expression vector according to claim 3.

5. A pharmaceutical composition, characterized in that The pharmaceutical composition comprises the recombinant mutant Myceliophthora thermophila uricase according to claim 1.

6. The pharmaceutical composition according to claim 5, characterized in that The pharmaceutical composition further comprises a pharmaceutically acceptable carrier and / or excipient.

7. Use of the recombinant mutant Myceliophthora thermophila uricase according to claim 1 in the preparation of a drug for treating hyperuricemia.

8. Use of the recombinant mutant Myceliophthora thermophila uricase according to claim 1 in the preparation of a drug for treating hyperuricosuria.

9. Use of the recombinant mutant Myceliophthora thermophila uricase according to claim 1 in the preparation of a drug for treating gout.

Images