Method for inducing differentiation of cardiomyocytes using granulocyte colony stimulating factor

Abstract

This invention provides a method for inducing cardiomyocyte differentiation and maturation using granulocyte colony-stimulating factor (G-CSF). The induced differentiated and mature cardiomyocytes show increased expression of genes related to cardiomyocyte maturation, and the differentiated and mature cardiomyocytes can serve as cell therapy agents for the prevention or treatment of heart disease.

Description

Technical Field

[0001] This invention relates to the field of cell preparation technology, specifically to a method for inducing cardiomyocyte differentiation and maturation using granulocyte colony-stimulating factor (G-CSF). Background Technology

[0002] In recent years, research on stem cell differentiation has increased significantly. Human pluripotent stem cells (hPSCs), including embryonic stem cells (ESCs) and induced pluripotent stem cells (iPSCs), have been successfully differentiated into myocardial cells (CMs) in vitro. Myocardial cells derived from stem cells have broad application prospects and are commonly used in regenerative therapies related to heart diseases, exploring the mechanisms of hereditary heart disease, discovering new drugs, and evaluating the cardiotoxicological safety of drugs.

[0003] While traditional 2D differentiation methods yield cardiomyocytes (hPSC-CMs) with similar molecular, structural, and functional characteristics to adult cardiomyocytes (CMs), a major challenge lies in the immaturity of hPSC-CMs induced by these methods. Compared to adult CMs, hPSC-CMs are structurally and functionally immature (Chen et al., 2019), particularly in morphology, metabolism, calcium handling, electrophysiology, and proliferation (Liao et al., 2021). These immature characteristics severely hinder the application prospects of hPSC-CMs. Many researchers have attempted to mimic the natural in vivo environment of cardiomyocytes by simulating different 3D conditions to promote their maturation. For example, Kadota et al. found improved maturation of hPSC-CMs transplanted into rat hearts. Other methods have involved encapsulating hPSC-CMs in fibrin hydrogels to form 3D structures, stretching and assisted contraction using molds, and applying regular electrical stimulation. These hPSC-CMs exhibit gene expression profiles, sarcomere structures, and metabolic pathways more closely resembling those of adult cardiomyocytes. However, the 3D approach is complex and not conducive to large-scale experimental operations for mass production of cardiomyocytes. Therefore, researchers in this field still look forward to methods that induce cardiomyocyte differentiation and maturation with more ideal differentiation and maturity and are convenient for subsequent mass production. Summary of the Invention

[0004] To address the aforementioned technical problems, this invention provides a method for inducing cardiomyocyte differentiation and maturation using granulocyte colony-stimulating factor (G-CSF). The induced cardiomyocytes exhibit increased expression of genes related to cardiomyocyte maturation, and the differentiated and matured cardiomyocytes can serve as cell therapy agents for the prevention or treatment of heart disease.

[0005] This invention provides a method for inducing cardiomyocyte differentiation and maturation using granulocyte colony-stimulating factor (G-CSF);

[0006] Preferably, the cardiomyocytes are cardiomyocytes induced from stem cells (e.g., pluripotent stem cells);

[0007] Preferably, the pluripotent stem cells are human pluripotent stem cells;

[0008] Preferably, the human pluripotent stem cells include human induced pluripotent stem cells.

[0009] In some embodiments, the concentration of granulocyte colony-stimulating factor (G-CSF) is 0.1-100 ng / mL, preferably 20-100 ng / mL, more preferably 20-50 ng / mL, and even more preferably 20 ng / mL.

[0010] In some embodiments, the time for inducing cardiomyocyte differentiation and maturation using granulocyte colony-stimulating factor (G-CSF) is selected from day 19-23 (D19-D23), day 23-27 (D23-D27), or day 19-27 (D19-D27) of cardiomyocyte differentiation, preferably day 19-27 (D19-D27).

[0011] In some embodiments, the method includes culturing cardiomyocytes, preferably differentiated cardiomyocytes, in a culture medium supplemented with granulocyte colony-stimulating factor (G-CSF).

[0012] In some implementations, the method includes the following steps:

[0013] (a) Stem cells were cultured in a differentiation medium supplemented with GSK-3 inhibitors to induce them to differentiate into cardiomyocytes;

[0014] (b) Continue to induce differentiation in differentiation medium;

[0015] (c) Continue to induce differentiation in differentiation medium supplemented with Wnt inhibitor;

[0016] (d) Continue to induce differentiation in differentiation medium;

[0017] (e) Induced differentiation and maturation in a medium supplemented with granulocyte colony-stimulating factor (G-CSF).

[0018] In some implementations, the method includes the following steps:

[0019] (a) On days 0-2, stem cells were cultured in differentiation medium supplemented with GSK-3 inhibitors to induce differentiation into cardiomyocytes;

[0020] (b) After one day of induction, continue to induce differentiation in differentiation medium;

[0021] (c) On days 3-5, differentiation was induced again in differentiation medium supplemented with Wnt inhibitor;

[0022] (d) Continue to induce differentiation in differentiation medium from day 5 to day 15;

[0023] (e) On days 15–27, differentiation and maturation were induced in a medium supplemented with granulocyte colony-stimulating factor (G-CSF).

[0024] In some implementations, the differentiation medium in steps (a), (b), (c), and (d) includes PRMI1640 basal medium and insulin-free B27 additive;

[0025] And / or, the culture medium in step (e) includes PRMI1640 basal medium and insulin-containing B27 additive.

[0026] In some implementations, the GSK-3 inhibitor is selected from CHIR99021;

[0027] And / or, the Wnt inhibitor is selected from any one, two or more of IWR-1, IWP-2, IWP-4, and C59.

[0028] In some implementations, the concentration of the GSK-3 inhibitor is 0.5 μM-10 μM, preferably 6 μM;

[0029] And / or, the concentration of the Wnt inhibitor is 0.5 μM-20 μM, preferably 2 μM.

[0030] In some implementations, when the cardiomyocytes reach 85-98% (e.g., 95%) confluence in step (a), the culture medium is replaced with a differentiation medium to induce differentiation.

[0031] In some implementations, spontaneously beating cells can be observed on day 9 of step (d).

[0032] In some implementations, the timing of step (e) inducing differentiation and maturation is selected from day 19-23 (D19-D23), day 23-27 (D23-D27), day 19-27 (D19-D27), and preferably day 19-27 (D19-D27).

[0033] In some implementations, stem cells include pluripotent stem cells, multipotent stem cells, and unipotent stem cells.

[0034] In some implementations, the stem cells are human pluripotent stem cells, such as human induced pluripotent stem cells.

[0035] In some implementations, granulocyte colony-stimulating factor (G-CSF) increases the expression level of at least one gene or protein selected from the group consisting of: TNNT2 (cardiac troponin T), TNNI3 (cardiac troponin I), SERCA2a (calcium ATPase 2a), RYR2 (human lanyl base receptor 2), KCNQ1 (potassium channel protein), KCNH2 (potassium voltage-gated channel subfamily H member 2), β-MHC (cardiac myosin heavy chain subunit), CACNA1c (calcium voltage-gated channel subunit alpha1 C), and LDHA (lactate dehydrogenase A).

[0036] In some implementations, granulocyte colony-stimulating factor (G-CSF)-induced differentiation of mature cardiomyocytes increases the secretion of vascular endothelial growth factor (VEGF).

[0037] This invention provides the use of granulocyte colony-stimulating factor (G-CSF) in the preparation of products that induce cardiomyocyte differentiation and maturation.

[0038] In some implementations, the product is selected from reagents, compositions, culture media, etc.

[0039] The present invention provides a culture medium for inducing the maturation and differentiation of cardiomyocytes, the culture medium comprising basal culture medium and granulocyte colony-stimulating factor (G-CSF);

[0040] Preferably, the concentration of granulocyte colony-stimulating factor (G-CSF) in the basal culture medium is 20-50 ng / mL, more preferably 20 ng / mL.

[0041] In some embodiments, the basal culture medium is selected from PRMI1640 medium, mTESR1 medium, etc.; more preferably, it is PRMI1640 medium supplemented with insulin B27.

[0042] The present invention provides a cell therapy agent for the prevention or treatment of heart disease, the cell therapy agent comprising differentiated mature cardiomyocytes prepared by the above method.

[0043] In some implementations, the heart disease may be selected from at least one of the following groups, but not limited to: myocardial infarction, angina pectoris, ischemic cardiomyopathy, primary cardiomyopathy, secondary cardiomyopathy, and heart failure.

[0044] Beneficial effects

[0045] This study demonstrates that granulocyte colony-stimulating factor (G-CSF) can effectively promote the maturation of cardiomyocytes under 2D culture conditions. Simultaneously, the expression of function-related genes in mature cardiomyocytes is significantly increased. Attached Figure Description

[0046] Figure 1 A schematic diagram of the process for differentiating, culturing, and treating hiPSCs-CMs.

[0047] Figure 2 The expression trends of myocardial-related genes under different treatments that induce cardiomyocyte maturation are shown. The myocardial-related genes are TNNT2, TNNI3, SERCA2a, RYR2, KCNQ1, KCNH2, β-MHC, CACNA1c, and LDHA. The horizontal axis of the quantitative real-time PCR graph represents the negative control, scheme1, scheme2, scheme3, scheme4, and scheme5.

[0048] Figure 3 Under different treatments to induce cardiomyocyte maturation, the positive rate of CTNT did not change significantly after induction with granulocyte colony-stimulating factor (G-CSF), indicating that the addition of G-CSF does not affect the positive rate of cardiomyocyte differentiation. The horizontal axis in the figure represents the negative control, scheme 1, scheme 2, scheme 3, scheme 4, and scheme 5, respectively.

[0049] Figure 4 The figure shows the increase in VEGF secretion by cardiomyocytes under different treatments that induce cardiomyocyte maturation. The horizontal axis in the figure represents the negative control, scheme 1, scheme 2, scheme 3, scheme 4, and scheme 5, respectively.

[0050] Figure 5 The effect of Scheme3-induced cardiomyocyte maturation on the recovery of cardiac function in mice was investigated.

[0051] Terminology Explanation

[0052] hiPSCs-CMs: Cardiomyocytes induced by hiPSC cells.

[0053] TNNT2: Cardiac troponin T. This gene encodes the troponin-binding subunit of the troponin complex, located on the filaments of striated muscle, and regulates muscle contraction through changes in intracellular calcium ion concentration. Mutations in this gene are associated with familial hypertrophic cardiomyopathy and dilated cardiomyopathy.

[0054] TNNI3: Cardiac troponin I. TNNI3 is a protein encoded by the TNNI3 gene in humans. It is a tissue-specific subtype of troponin I, which is part of the troponin complex. The TNNI3 gene encoding cardiac troponin I (cTnI) is located at 19q13.4 of the human chromosome genome.

[0055] SERCA2a: Calcium ATPase 2a, sarcoplasmic reticulum / endoplasmic reticulum ATPase 2a (SERCA2a) is the main calcium pump in cardiomyocytes that recycles calcium ions in the sarcoplasmic reticulum. It transports calcium ions from the cytoplasm to the lumen of the sarcoplasmic reticulum by consuming ATP. SERCA2a is crucial for maintaining calcium homeostasis and cardiac function in cardiomyocytes, and changes in its activity and expression level are closely related to the occurrence and development of heart failure.

[0056] RYR2: The human ryanodine receptor 2 (RyR2) is a calcium ion release channel located on the sarcoplasmic reticulum of cardiomyocytes. As an important component of myocardial excitation-contraction coupling, RyR2 dysfunction plays a crucial role in the occurrence and progression of many heart diseases. Catecholamine-sensitive polymorphic ventricular tachycardia (CPVT) is associated with RyR2 gene mutations.

[0057] KCNQ1, also known as Kv7.1, is a voltage-dependent K+ channel that regulates gastric acid secretion, homeostasis of salts and glucose, and heart rhythm. Its functional properties are regulated in a tissue-specific manner through co-assembly with the β-subunit KCNE1-5. In inexcitable cells, KCNQ1 forms a complex with KCNE3, thereby inhibiting channel closure under negative membrane voltages, which would otherwise cause the channel to close. Pore opening is regulated by the signaling lipid PIP2.

[0058] KCNH2: This gene encodes a component of a voltage-activated potassium channel found in cardiomyocytes, nerve cells, and microglia. Four copies of this protein interact with one copy of the KCNE2 protein to form a functional potassium channel. Mutations in this gene can lead to long QT syndrome type 2 (LQT2). Transcriptomorphs encoding different subtypes have been identified.

[0059] β-MHC: Encoded by the Myh7 gene, located on mouse chromosome 14, Myh7 is a hexameric protein containing two heavy chain subunits, two alkali metal light chain subunits, and two regulatory light chain subunits. This gene encodes the β-heavy chain subunit of cardiac myosin. It is primarily expressed in the ventricles of normal human hearts, and also in skeletal muscle tissue rich in type I slow-twitch muscle fibers. The relative abundance of this protein and variations in the α-heavy subunit of cardiac myosin are correlated with the rate of myocardial contraction.

[0060] CACNA1c: CACNA1C (Calcium Voltage-Gated Channel Subunit Alpha1 C) is a protein-coding gene. This gene encodes the alpha-1 subunit of a voltage-dependent calcium channel. Calcium channels mediate calcium ion influx into cells during membrane polarization. The alpha-1 subunit consists of 24 transmembrane segments, forming pores for ion entry into the cell. Calcium channels are composed of a complex of alpha-1, alpha-2 / delta, beta, and gamma subunits in a 1:1:1:1 ratio. Diseases associated with CACNA1C include Timothy syndrome and Long Qt syndrome.

[0061] LDHA: The protein encoded by this gene catalyzes the conversion of L-lactic acid and NAD to pyruvate and NADH in the final step of anaerobic glycolysis. This protein is primarily found in muscle tissue and belongs to the lactate dehydrogenase family. Mutations in this gene are associated with exertional myoglobinuria. Several transcriptomic variants of this gene have been identified. The human genome contains several non-transcriptional pseudogenes of this gene.

[0062] Stem cells are the fundamental cells that constitute an object's cells or tissues. They are pluripotent cells, characterized by their ability to self-renew through repeated division and differentiate into cells with specific functions according to their environment. Stem cells can be classified into pluripotent stem cells, multipotent stem cells, and unipotent stem cells based on their differentiation capacity. Pluripotent stem cells are pluripotent cells with the potential to differentiate into all types of cells (totipotency). Human pluripotent stem cells (hPSCs) include embryonic stem cells (ESCs) and induced pluripotent stem cells (iPSCs), etc. In this invention, the stem cells can be pluripotent stem cells, and are preferably human pluripotent stem cells, but are not limited thereto.

[0063] Cardiomyocytes: including but not limited to cardiac progenitor cells with the potential to become functional cardiomyocytes, or fetal cardiomyocytes, and cells at all stages of differentiation of adult cardiomyocytes; referring to cells that can be identified by at least one, preferably multiple, markers or standards using at least one, preferably multiple, of the following methods. The expression of various cardiomyocyte-specific markers can be detected by known biochemical or immunochemical methods, and these methods can be used without restriction. In this method, polyclonal or monoclonal antibodies specific to markers binding to cardiac progenitor cells or cardiomyocytes can be used. Without restriction, antibodies targeting a single specific marker can be commercially available or prepared by known methods.

[0064] Cell therapy agents: These are drugs prepared by isolating, culturing, and specially processing cells and tissues from humans, intended for therapeutic, diagnostic, and preventative purposes (as defined by the US FDA). They are drugs that restore the function of cells or tissues through a series of actions, such as in vitro proliferation and selection of living autologous, allogeneic, or xenogeneic cells, or by otherwise altering the biological characteristics of cells to achieve therapeutic, diagnostic, and preventative purposes.

[0065] Prevention: refers to any effect of inhibiting or delaying the progression of heart disease by applying the cell therapy agent according to the invention.

[0066] Treatment: refers to any effect of improving or beneficially altering heart disease by administering the cell therapy agent according to the present invention. Detailed Implementation

[0067] The technical solution of the present invention will be further described in detail below with reference to specific embodiments. It should be understood that the following embodiments are merely illustrative and explanatory of the present invention, and should not be construed as limiting the scope of protection of the present invention. All technologies implemented based on the above content of the present invention are covered within the scope of protection intended by the present invention.

[0068] Unless otherwise stated, the raw materials and reagents used in the following examples are commercially available products or can be prepared by known methods.

[0069] Example 1: Induction of cardiomyocytes derived from iPSC cells

[0070] hiPSCs (using the CTS kit) TM CytoTune TM When the hiPSCs (iPSC 2.1 Sendai Reprogramming Kit, catalog number: A34546) reached approximately 95% confluence, they were washed with DPBS, then 1 mL of ethylenediaminetetraacetic acid (EDTA) digestion solution (versene, 0.02% EDTA solution) was added and digested at 37°C for 5 min. The digestion solution was removed, and the digested cells were pipetted into single cells using 1 mL of mTeSR1 medium containing 10 μM Y-27632 (Tocris, catalog number TB1254-GMP). After counting, the cells were divided into groups of 2 × 10⁻⁶ cells. 5Cells were seeded at a density of [number] cells / well in 12-well Matrigel-coated cell culture plates, marked as day -2 of induction. On day -1, cells were cultured for another day in fresh mTeSR1 medium without Y-27632. On day 0 of induction, when cells reached approximately 95% confluence, the medium was changed to cardiomyocyte differentiation medium for induction. From day 0 to day 2 of induction, 6 μM CHIR99021 (purchased from Tocris, catalog number TB4423-GMP) was added to the medium. After one day of induction, the medium was changed to fresh differentiation medium. From day 3 to day 5 of induction, 2 μM IWR-1 (purchased from Tocris, catalog number 3532) was added to the medium. On day 5, the medium was changed to fresh differentiation medium, and the medium was changed every two days. On day 9 of induction, spontaneously beating cells were observed. On day 15 of differentiation, the medium was discarded, and 500 μLaccutase was added to each well, and the cells were digested at 37°C for 5-6 min. Cells were pipetted and collected to form a cell suspension. The wells were then rinsed with differentiation medium, and any remaining cells were collected. The cell suspension was then filtered through a 70-mesh nylon filter and centrifuged at 200g for 5 minutes. The cell pellet was resuspended in cardiomyocyte maintenance medium and centrifuged at 4 × 10⁻⁶ cells / mL. 5 HiPSCs-CMs were seeded at a density of [number] cells / well in Matrigel-coated 12-well plates and cultured, with medium changed every two days. This yielded hiPSCs-CMs cells. The induction process for hiPSCs-CMs cardiomyocytes is as follows: Figure 1 As shown.

[0071] Figure 1 This includes the timeframes for embryonic stem cell culture, cardiomyocyte differentiation, culture, purification, and compound treatment, as well as the culture media, additives, compounds used, and corresponding procedures. Day -2 to day 0 is the hiPSC culture phase, using mTESR1 medium; days 0-15 is the cardiomyocyte induction phase, using PRMI1640 medium supplemented with insulin-free B27, and cells are induced with the GSK3 inhibitor CHIR99021 and the Wnt inhibitor IWR-1, respectively; days 15-30 is the cardiomyocyte maintenance phase, using PRMI1640 medium supplemented with insulin-free B27; days 19-27 are treated with G-CSF (purchased from R&D, catalog number 214-CS-025 / CF).

[0072] Example 2: Induced maturation of cardiomyocytes

[0073] To promote the maturation of hiPSCs-CMs, five drug dosing intervals and concentrations were established to test the maturity of hiPSCs. HiPSCs were plated in culture dishes and, once they reached over 95% confluence, myocardial differentiation was induced according to the procedure in Example 1. The differentiated hiPSCs-CMs were then subjected to myocardial cell maturation induction according to the table below.

[0074] Table 1 shows the five different dosing time segments and concentrations.

[0075] Setting Mode Dosing time segment G-CSF concentration Scheme1 D19-D23 20ng / mL Scheme2 D23-D27 20ng / mL Scheme3 D19-D27 20ng / mL Scheme4 D19-D23 50 ng / mL Scheme5 D19-D27 100ng / mL

[0076] Example 1: Comparison of expression of genes related to cardiomyocytes using quantitative real-time PCR.

[0077] Using hiPSCs-CMs prepared using different maturation modes in Example 2, quantitative analysis of myocardial cell-related genes was performed. The method was as follows: The culture medium was aspirated, the cells were washed once with PBS, and 500 μL of Trizol was added to each well of a 12-well plate to lyse the cells. The cell lysates were collected into 1.5 mL RNase-free EP tubes. 100 μL of chloroform was added to each tube, and the tube was vortexed vigorously for 15 seconds. After standing at room temperature for 5 minutes, the tube was centrifuged at 12000 g for 15 minutes at 4°C. The supernatant was carefully aspirated into a new 1.5 mL RNase-free EP tube, and an appropriate amount of isopropanol was added. The tube was gently inverted 6 times, and after standing at room temperature for 10 minutes, it was centrifuged at 12000 g for 10 minutes at 4°C. The supernatant was removed, and the tube was rinsed with 500 μL of pre-chilled 75% ethanol and centrifuged at 7500 g for 5 minutes at 4°C. Ethanol was removed as much as possible, and the tube was left exposed to air dry for 5 minutes. 15-20 μL of DEPC water was added and the tube was placed on ice. After the RNA was dissolved, its concentration was measured using a Nano Drop analyzer. Reverse transcription was performed according to PrimeScript. TM Follow the instructions for the RT Master Mix kit. Prepare the reaction mixture on ice.

[0078] Reaction system (20 μL):

[0079]

[0080] Reaction procedure:

[0081]

[0082] The obtained cDNA can be stored at -20℃.

[0083] The real-time PCR reaction system was prepared using 2×SYBR Green qPCR Master Mix reagent.

[0084] Reaction system (20 μL):

[0085]

[0086]

[0087] Primer table

[0088] Primers sequence TNNT2-F CTGCTGTTCTGAGGGAGAGC TNNT2-R CACCAAGTTGGGCATGAACG TNNI3-F TTTGACCTTCGAGGCAAGTTT TNNI3-R CCCGGTTTTCCTTCTCGGTG MYH7-F ACCTGTCCAAGTTCCGCAAG MYH7-R TCATTCAAGCCCTTCGTGCC RYR2-F TCCGGAAACAGTATGAAGACCA RYR2-R CACACAACGCTGGCAATTCA SERCA2-F ACCTGGAACCTGTTCTTAGCTC SERCA2-R CATCACAGATGACAATTAGTGCC CACNA1c-F CATGCTCACGGTGTTCCA CACNA1c-R TCCTACGGCATCATTGACC KCNH2-F TGTCACGGATGAATGCCCAA KCNH2-R CTGCGCCAATGATGAAAGCA LDHA-F GACTTCTGAGGAAGAGGCCC LDHA-R CATGCACAACCTCCACCTAGA KCNQ1-F TGTCCACCATCGAGCAGTATG KCNQ1-R CCGTCCCGAAGAACACCAC GAPDH-F AGATCCCTCCAAAATCAAGTGG GAPDH-R GGCAGAGATGATGACCCTTTT

[0089] Reaction procedure:

[0090]

[0091] Based on the Ct value provided by the software, the difference in fold change of mRNA expression in the samples is calculated using the ΔΔCt algorithm.

[0092] The maturity of cardiomyocytes can be compared by detecting genes related to cardiomyocyte maturation. For example, genes related to cardiomyocyte sarcomere structure, such as TNNT2 and TNNI3, β-MHC (cardiac myosin heavy chain subunit), potassium ion channel proteins KCNQ1 and KCNH2, calcium voltage-gated channel protein CACNA1c, sarcoplasmic reticulum calcium ion transporters RYR2 and SERCA2a, and lactate dehydrogenase LDHA are all typical markers of cardiomyocyte maturation. Their expression levels are very low in immature cardiomyocytes and significantly increased in mature cardiomyocytes.

[0093] Quantitative real-time PCR showed that the expression of related genes in hiPSCs-CMs treated with granulocyte colony-stimulating factor (G-CSF) was significantly enhanced, indicating that G-CSF can promote the maturation of hiPSCs-CMs by increasing the expression of cardiomyocyte genes. (See details...) Figure 2 It is evident that, based on the expression of cardiomyocyte-specific genes, the expression levels of genes related to cardiomyocyte sarcomere structure, such as TNNT2 and TNNI3, β-MHC (cardiac myosin heavy chain subunit), potassium ion channel proteins KCNQ1 and KCNH2, calcium voltage-gated channel protein CACNA1c, sarcoplasmic reticulum calcium ion transporters RYR2 and SERCA2a, and lactate dehydrogenase LDHA, were significantly increased in the Scheme 3 setting mode. Therefore, it is planned to add 20 ng / mL of G-CSF on days 19-27.

[0094] Example 2: Immunofluorescence staining and flow cytometry detection

[0095] Thirty days after differentiation, hiPSCs-CMs cells were digested with acutase, and the cell suspension was collected, centrifuged, and washed with PBS. The cells were then fixed with 4% PFA at room temperature for 30 min, blocked with antibody, and incubated at room temperature for 10 min. The primary antibody was diluted according to the manufacturer's instructions, added to the cells, and incubated at room temperature for 1 hour. After washing twice with PBS to remove non-specifically bound primary antibody, the cells were analyzed by flow cytometry. The results showed that the proportion of cTnt+ cells in the DMSO control group was 92.27%, while the proportion of cTnt+ cells in the granulocyte colony-stimulating factor (G-CSF) treatment group was 90.82-97.62%. Compared with the control group, G-CSF treatment did not significantly change the purity of cardiomyocytes.

[0096] In conclusion, G-CSF can promote the expression of mature myosarcomas in cardiomyocytes and increase the percentage of ventricular myocytes in hiPSCs-CMs without altering cell differentiation efficiency (e.g., Figure 3 ).

[0097] Example 3

[0098] Cardiomyocytes differentiated for 30 days were cultured in serum-free medium for 48 hours. The cell supernatant was then collected for ELISA quantitative VEGF detection. The results showed that the addition of G-CSF significantly promoted VEGF expression (e.g., ...). Figure 4 ).

[0099] Example 4

[0100] Myocardial infarction (MI) and acute coronary artery disease are among the most prominent causes of death in cardiovascular diseases. A mouse model of MI with permanent ligation of the left anterior descending (LAD) coronary artery is very similar to human MI. The mouse surgical model of myocardial infarction via permanent LAD coronary artery ligation is highly reproducible and is currently the most widely used method for creating mouse myocardial infarction models, providing a stable model basis for subsequent product efficacy validation. After successful establishment of the MI model, blood flow ceases in most of the left ventricular myocardium. Insufficient myocardial oxygen supply leads to ischemic death of cardiomyocytes. This pathological condition triggers a response in ventricular tissue, ultimately leading to ventricular dysfunction, remodeling, and heart failure.

[0101] Modeling of acute myocardial infarction in mice by permanent ligation of the left anterior descending coronary artery: Mouse weight was measured to determine the dosage of anesthetic drugs and tidal volume of the ventilator. Mice were anesthetized by intraperitoneal injection of 1.25% tribromoethanol at a dose of 10 μL / g. After anesthesia, the heart was exposed by thoracotomy at the 3rd to 4th intercostal space. The left anterior descending coronary artery was permanently ligated about 2 mm below the lower edge of the left atrial appendage using a 7-0 suture needle to create a mouse model of acute myocardial infarction.

[0102] Sham surgery mice: After anesthesia, the heart was exposed by opening the chest at the 3rd to 4th intercostal space. A 7-0 suture needle was used to thread the suture about 2 mm below the lower edge of the left atrial appendage, without ligating the left anterior descending coronary artery.

[0103] Four days after modeling, a second thoracotomy was performed. Cells were enriched around the infarct and injected at three points, approximately 5-10 μL per point, for a total cell count of approximately 2 million. Cardiac echocardiography was performed two months after cell injection. Echocardiography allows for in vivo assessment of cardiac structure and function. Relevant measurements included left ventricular wall thickness, diameter, mass, fractional shortening, and ejection fraction. The specific procedures were performed after anesthetizing the mice in the chest and abdomen:

[0104] The left ventricle was imaged in B-mode in a parasternal long-axis view. The mouse ultrasound processing stage was carefully adjusted to position the long axis of the left ventricle in the same plane as the ultrasound beam. During image acquisition, the aortic valve and the apex of the left ventricle were positioned in the same plane as the ultrasound beam. The aortic valve and the apex served as fixed points, remaining constant across a series of studies in the same animal. M-mode was then applied to the left ventricle to image the ventricular wall and interior. After imaging, based on the maximum ventricular systolic and diastolic amplitudes, relevant characteristic values ​​were calculated at the selected locations: ejection fraction (EF%), left ventricular intramural shortening fraction (FS%), left ventricular terminal systolic volume (LV Vol,S), and left ventricular terminal diastolic volume (LV Vol,D).

[0105] The efficacy of myocardial cells differentiated for approximately 30 days was evaluated in mice with myocardial infarction. The efficacy of myocardial cells treated with 20 ng / mL G-CSF (Scheme 3) was compared. The mice included a sham-operated group (n=4), a solvent group (n=14), a cell group without G-CSF treatment (n=11), and a cell group with G-CSF treatment (n=9). The solvent used was 5% human serum albumin and 95% compound electrolyte solution.

[0106] Depend on Figure 5 It can be seen that the addition of G-CSF to more mature cardiomyocytes has a significant effect on the recovery of cardiac function in mice. Compared with the cells without G-CSF, the EF value increased from 30.1 to 33.6, the FS value increased from 14.0 to 15.9, the systolic end volume decreased from 54.2 to 47.5, and the diastolic end volume decreased from 77.4 to 70.6.

[0107] The embodiments of the present invention have been described above. However, the present invention is not limited to the above embodiments. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A method for inducing cardiomyocyte differentiation and maturation using granulocyte colony-stimulating factor; The cardiomyocytes are cardiomyocytes induced from stem cells; The stem cells mentioned are human induced pluripotent stem cells; The concentration of granulocyte colony-stimulating factor is 20-100 ng / mL; The timing of cardiomyocyte differentiation and maturation induced by granulocyte colony-stimulating factor was selected from day 19-23, day 23-27, or day 19-27 of cardiomyocyte differentiation.

2. The method according to claim 1, characterized in that, The concentration of granulocyte colony-stimulating factor is 20-50 ng / mL; The time period for inducing cardiomyocyte differentiation and maturation using granulocyte colony-stimulating factor was selected from day 19 to day 27 of cardiomyocyte differentiation.

3. The method according to claim 1 or 2, characterized in that, The method involves culturing cardiomyocytes in a culture medium supplemented with granulocyte colony-stimulating factor.

4. The method according to claim 3, characterized in that, The method involves culturing differentiated cardiomyocytes in a culture medium supplemented with granulocyte colony-stimulating factor.

5. The method according to claim 1 or 2, characterized in that, The method includes the following steps: (a) Stem cells were cultured in a differentiation medium supplemented with GSK-3 inhibitors to induce them to differentiate into cardiomyocytes; (b) Continue to induce differentiation in differentiation medium; (c) Continue to induce differentiation in differentiation medium supplemented with Wnt inhibitor; (d) Continue to induce differentiation in differentiation medium; (e) Induced differentiation and maturation in a medium supplemented with granulocyte colony-stimulating factor (G-CSF).

6. The method according to claim 5, characterized in that, The differentiation media in steps (a), (b), (c), and (d) include PRMI1640 basal medium and insulin-free B27 additive; And / or, the culture medium in step (e) includes PRMI1640 basal medium and insulin-containing B27 additive; And / or, the GSK-3 inhibitor is selected from CHIR99021; And / or, the Wnt inhibitor is selected from any one, two or more of IWR-1, IWP-2, IWP-4, and C59; And / or, the concentration of the GSK-3 inhibitor is 0.5 μM-10 μM; And / or, the concentration of the Wnt inhibitor is 0.5 μM-20 μM.

7. The method according to claim 6, characterized in that, The concentration of the GSK-3 inhibitor was 6 μM; And / or, the concentration of the Wnt inhibitor is 2 μM.

8. The method according to claim 1 or 2, characterized in that, Granulocyte colony-stimulating factor increases the expression level of at least one gene or protein selected from the group consisting of the following in differentiated cardiomyocytes: TNNT2 (cardiac troponin T), TNNI3 (cardiac troponin I), SERCA2a (calcium ATPase 2a), RYR2 (human lanidine receptor 2), KCNQ1 (potassium channel protein), KCNH2 (potassium voltage-gated channel subfamily H member 2), β-MHC (cardiac myosin heavy chain subunit), CACNA1c (calcium voltage-gated channel subunit alpha1 C), and LDHA (lactate dehydrogenase A). And / or, granulocyte colony-stimulating factor (G-CSF)-induced increase in the secretion of vascular endothelial growth factor (VEGF) by differentiated and mature cardiomyocytes.

9. The use of granulocyte colony-stimulating factor in the preparation of products that induce cardiomyocyte differentiation and maturation; The cardiomyocytes are cardiomyocytes induced from stem cells; the stem cells are human induced pluripotent stem cells. The concentration of granulocyte colony-stimulating factor is 20-100 ng / mL; The timing of cardiomyocyte differentiation and maturation induced by granulocyte colony-stimulating factor was selected from day 19-23, day 23-27, or day 19-27 of cardiomyocyte differentiation.

10. The use according to claim 9, characterized in that, The concentration of granulocyte colony-stimulating factor is 20-50 ng / mL; The time period for inducing cardiomyocyte differentiation and maturation using granulocyte colony-stimulating factor was selected from day 19 to day 27 of cardiomyocyte differentiation.

11. The use according to claim 9 or 10, characterized in that, The product is selected from reagents, compositions, and culture media.

Images