Intelligent temperature self-adaptive system for expanding temperature range of polycyclic aromatic hydrocarbon degrading bacteria, recombinant bacteria and application

Abstract

The invention provides an intelligent temperature self-adaptive system for expanding the temperature range of polycyclic aromatic hydrocarbon degrading bacteria, recombinant bacteria and application. The system comprises a heat-resistant gene element, a cold-resistant gene element, a temperature induction element expressed by the heat-resistant gene element and a temperature induction element expressed by the cold-resistant gene element, the heat-resistant gene element comprises a heat shock protein grpE gene; and the cold-resistant gene element comprises a ribosome assembly factor srmB. The intelligent temperature self-adaptive system has predictability of results and can automatically express corresponding stress-resistant elements according to changes of environment temperature, so that cells are effectively protected. An inducer does not need to be additionally added to induce the stress-resistant element, and the negative influence of the stress-resistant element on the cells at normal temperature is avoided. In addition, the recombinant strain containing the intelligent temperature self-adaptive system is stable in character and not prone to mutation, and great convenience and reliability are provided for laboratory research and application.

Description

(I) Technical field

[0001] The invention relates to the degradation of polycyclic aromatic hydrocarbons, and in particular to an intelligent temperature self-adapting system, recombinant bacteria and applications thereof for expanding the temperature range of polycyclic aromatic hydrocarbons-degrading bacteria. (II) Background technology

[0002] Polycyclic aromatic hydrocarbons (PAHs), as a class of hydrocarbon compounds composed of two or more benzene rings, are extremely stubborn and persistent in the environment due to their unique heterocyclic aromatic structure, significant hydrophobicity and thermal stability. They are extremely difficult to degrade and are difficult to treat pollutants. Not only are these compounds difficult to use, but they also have potential risks of carcinogenicity, teratogenicity, mutagenicity and neurotoxicity. The remediation solutions for PAHs mainly include physical remediation, chemical remediation and biological remediation. Microbial remediation is an efficient and environmentally friendly method for remediating PAHs pollution, and has broad prospects in practical applications.

[0003] Neosphingobacterium US6-1 is a bacterium that can use high molecular weight polycyclic aromatic hydrocarbons as the sole carbon source and has a unique ability to efficiently degrade 2-5 ring PAHs. Due to the extremely wide distribution of PAHs, the use of microorganisms for in situ treatment requires a complex temperature environment. The optimal working temperature of this strain is 30°C and cannot meet the needs well. How to broaden the working temperature range of the strain is one of the key issues in the application of Neosphingobacterium US6-1.

[0004] The commonly used methods for changing the working temperature of strains at present mainly include laboratory directed evolution, transcription factor engineering, and genetic engineering methods. Laboratory directed evolution mainly uses physical mutagenesis (such as ultraviolet irradiation, ionizing radiation, etc.) or chemical mutagenesis (such as nitrosoguanidine, ethyl methanesulfonate, etc.) to introduce random mutations to screen mutants with excellent characteristics, but only a small part can produce excellent variations that meet people's expectations, the direction of induced mutations is difficult to grasp and control artificially, and it is difficult for mutants to concentrate multiple ideal traits. Transcription factor engineering can enhance or inhibit the expression of certain stress resistance-related genes by regulating specific transcription factors, thereby improving the stress resistance of strains, but because the transcriptional regulatory network is highly complex in the organism, these effects are uncertain, and the expression level and function of transcription factors need to be accurately controlled. However, existing technical means may be difficult to achieve this accuracy. Genetic engineering integrates the high temperature resistant genes of high temperature resistant bacteria into the target microorganism, and after multiple generations of stability, the microorganism acquires heat resistance, but because the high / low temperature resistant genes often have a negative effect on the growth of strains at normal temperatures, it cannot achieve efficient work at complex temperatures.

[0005] Due to the limitations of traditional strain temperature adaptation modification methods, the temperature adaptation modification of chassis cells based on synthetic biology has attracted more and more attention and expectations. Researchers combined genetic engineering technology with high / low temperature resistant components, and designed temperature-induced switches to control the expression and shutdown of high / low temperature resistant components at specific temperatures, thereby improving the working efficiency of strains at multiple temperatures without human intervention and supervision. The key is to find suitable heat-resistant and cold-resistant components, as well as corresponding heat-induced and cold-induced switch components.

[0006] Protein quality control (PQC) plays a crucial role in bacteria facing heat stress, ensuring that proteins can maintain their native active conformation under high temperature. The core component of the PQC network is heat shock proteins (HSPs), which are a collection of chaperone proteins and proteases with key biological functions. In prokaryotes, heat shock proteins mainly include Hsp70 family proteins (DnaK, DnaJ and GrpE) and Hsp60 family proteins (GroEL and GroES). Among them, the ATP-dependent Hsp70 protein family, as an evolutionarily conserved molecular chaperone present in all organisms, participates in a variety of cellular processes, covering core life activities such as protein folding, transport and degradation. The function of Hsp70 family protein DnaK is highly dependent on the synergistic effect of two types of co-factor proteins, J domain proteins (JDPs) DnaJ and nucleotide exchange factors (NEFs) GrpE. The Hsp60 family protein GroEL and its auxiliary factor GroES together constitute a typical molecular machine in the protein folding process. As a large bicyclic cylindrical structure with ATPase activity, GroEL specifically binds to non-natural substrate proteins through the hydrophobic residues exposed in the center of its ring. The binding of GroEL to GroES creates a relatively stable spatial environment, effectively preventing the potential toxicity of substrate proteins caused by aggregation during the folding process. This stable physical environment not only promotes the protein folding process, but also significantly accelerates its completion speed until all initially bound substrate proteins reach their native conformation.

[0007] Under low temperature conditions, bacterial core cellular activities such as metabolism, replication, transcription, and translation are significantly affected. To cope with this challenge, bacteria adopt a series of adaptive strategies during the cold shock response to reduce potential damage to heat-sensitive components. These adaptive strategies cover adjustments to enhance membrane fluidity to promote the correct folding of proteins; optimize RNA metabolism, including the folding and degradation of RNA; and restore and maintain normal translation activities through the action of ribosome biogenesis and translation factors. In order to restore the normal assembly of ribosomes under low temperature conditions, bacteria produce a variety of ribosome assembly factors. In bacteria, the folding process of the decoding center of the 30S ribosomal small subunit involves specific ribosome assembly factors such as RbfA, YjeQ (RsgA), Era, KsgA (RsmA), RimJ, RimM, RimP, and Hfq. The ribosome assembly factors assembled by the 50S ribosomal large subunit mainly include CsdA (DeaD), SrmB, RhlE, DbpA, RsgA, Der, and YihI. It is worth noting that as the temperature decreases, the expression levels of CsdA (DeaD), SrmB, KsgA (RsmA) and RbfA will increase significantly, which can assist bacteria in correctly assembling ribosomes in low temperature environments.

[0008] In summary, screening suitable heat-resistant elements, cold-resistant elements and temperature-induced switches to increase the temperature range of PAH-degrading bacteria has become a problem to be solved. (III) Summary of the invention

[0009] The purpose of the present invention is to provide an intelligent temperature adaptive system, recombinant bacteria and applications for expanding the temperature range of polycyclic aromatic hydrocarbons-degrading bacteria. By screening heat-resistant elements and cold-resistant elements and accurately regulating the expression of heat-resistant elements and cold-resistant elements, the temperature range of polycyclic aromatic hydrocarbons-degrading bacteria is effectively expanded, especially the growth and PAHs metabolism ability of new sphingobacillus US6-1 at high and low temperatures is improved, and the problems of poor temperature adaptability, narrow working temperature range, and great influence of temperature fluctuations on degradation efficiency of polycyclic aromatic hydrocarbons-degrading bacteria are solved.

[0010] The technical solution adopted by the present invention is:

[0011] The invention provides an intelligent temperature self-adaptive system for expanding the temperature range of polycyclic aromatic hydrocarbon degrading bacteria. The system comprises a heat-resistant gene element, a cold-resistant gene element, a temperature-inducing element expressed by the heat-resistant gene element, and a temperature-inducing element expressed by the cold-resistant gene element; the heat-resistant gene element comprises a heat shock protein grpE gene; the cold-resistant gene element comprises a ribosome assembly factor srmB; the temperature-inducing element expressed by the heat-resistant gene element comprises an RNA thermometer (RNAthermometers, RNATs), and the nucleotide sequence is shown in SEQ ID NO.4; the temperature-inducing element expressed by the cold-resistant gene element comprises an RNA heat-repressible RNA thermosensors (referred to as coldRNAT), and the nucleotide sequence is shown in SEQ ID NO.5.

[0012] Furthermore, the nucleotide sequence of the grpE gene is shown in SEQ ID NO.1, and the nucleotide sequence of the ribosome assembly factor srmB is shown in SEQ ID NO.2.

[0013] The RNA thermometer designed by the present invention is located in the complex RNA structure of the 5' untranslated region of mRNA, has the ability to respond to temperature changes and adjust its own conformation, includes a ribosome binding site (RBS) and its complementary base pair region anti-RBS, and relies on the post-transcriptional regulatory mechanism of the RNA secondary structure, and is used as a heat-induced switch element for the target gene. Under normal temperature conditions (30°C), RNATs form a stable secondary structure through interactions between bases, thereby preventing ribosome binding and further inhibiting the initiation of translation. However, as the ambient temperature increases (reaching 42°C), the balance between the closed conformation and the open conformation gradually shifts toward the open conformation, which will improve the initiation efficiency of translation and ensure that the target gene can be expressed normally.

[0014] RNase E, as a naturally occurring and conservative ribonuclease, has the ability to accurately cut RNA molecules at the cleavage site (especially UCUUCC) in a specific single-stranded RNA region, and cannot recognize RNA chains with secondary structures. Based on this unique biological property, the present invention has successfully constructed a small-sized, simple-mechanism cold-induced RNA thermometer element through precise design, named coldRNAT. The core of this element contains an RNase E cleavage site (RC), which is protected by a specific sequence (ARC) that resists RNase E cleavage. In a low-temperature environment (below 30°C), the base interaction inside the element will promote the formation of a stable hairpin structure, thereby effectively preventing RNase E from recognizing RC, thereby avoiding the degradation of mRNA and ensuring that the target gene is expressed normally. However, when the temperature returns to normal levels (about 30°C), the hairpin structure will disintegrate due to thermodynamic instability, exposing the RC site to the recognition of RNase E, thereby triggering the degradation process of mRNA and ultimately shutting down the expression of the target gene.

[0015] The intelligent temperature adaptive system of the present invention is transferred into the genome of polycyclic aromatic hydrocarbon degrading bacteria by genetic engineering means and successfully expressed, and the cold-resistant gene elements and heat-resistant gene elements are controlled by temperature-induced elements to express in response to changes in environmental temperature. At high temperatures, the high-temperature induced switch of RNATs is turned on to express the heat-resistant element grpE to help proteins fold correctly and thus maintain cell activity at high temperatures; while at low temperatures, the low-temperature induced switch coldRNAT is turned on to induce the expression of the cold-resistant element srmB to help ribosomes assemble correctly, restore gene translation efficiency, and restore cell activity at low temperatures.

[0016] The present invention also provides a recombinant polycyclic aromatic hydrocarbons-degrading bacterium containing an intelligent temperature adaptive system, and the degrading bacterium is constructed according to the following method: (1) a heat-resistant gene element and a temperature-induced element expressed by the heat-resistant gene element are connected to the multiple cloning site of a pHGE-Ptac vector, and the vector promoter Ptac is replaced by the promoter PJ23119; (2) a cold-resistant gene element and a temperature-induced element expressed by the cold-resistant gene element are connected to the multiple cloning site of a pHGE-Ptac vector, and Ptac is replaced by the promoter PJ23119; (3) the plasmids constructed in step (1) are respectively expressed in E. coli WM3064; (4) the bacterial solution of step (3) is co-incubated with the polycyclic aromatic hydrocarbons-degrading bacterium, and recombinant bacteria containing the heat-resistant gene element and the temperature-induced element expressed by the heat-resistant gene element are screened; (5) the plasmid of step (2) is expressed in E. coli WM3064 and co-incubated with the strain of step (4) to screen the recombinant polycyclic aromatic hydrocarbons-degrading bacterium containing the intelligent temperature adaptive system.

[0017] Furthermore, the polycyclic aromatic hydrocarbons-degrading bacteria include Novosphingobium pentaromativorans US6-1.

[0018] Furthermore, the nucleotide sequence of the promoter PJ23119 is shown in SEQ ID NO.7.

[0019] The present invention also provides an application of a recombinant polycyclic aromatic hydrocarbons-degrading bacteria containing an intelligent temperature adaptive system in degrading polycyclic aromatic hydrocarbons. The application is to inoculate the recombinant polycyclic aromatic hydrocarbons-degrading bacteria into a P5Y3 liquid culture medium containing polycyclic aromatic hydrocarbons, and culture under the conditions of 18-42°C and 100-200rpm to achieve degradation of polycyclic aromatic hydrocarbons.

[0020] Furthermore, the concentration of the polycyclic aromatic hydrocarbons in the culture medium is 0.1-1 mg / mL, preferably 0.2 mg / mL.

[0021] Furthermore, the polycyclic aromatic hydrocarbons include phenanthrene.

[0022] Compared with the currently commonly used strain temperature adaptability modification, the beneficial effects of the present invention are mainly reflected in:

[0023] (1) Compared with laboratory directed evolution, the intelligent temperature adaptive system of the present invention has predictable results; in addition, the recombinant bacteria containing the intelligent temperature adaptive system of the present invention have stable traits and are not prone to mutation, which provides great convenience and reliability for laboratory research and application.

[0024] (2) Compared with simply introducing stress-resistant elements, the intelligent temperature adaptive system of the present invention can automatically express the corresponding stress-resistant elements according to the changes in ambient temperature, thereby effectively protecting the cells. There is no need to add additional inducers to induce stress-resistant elements, and the negative impact of stress-resistant elements on cells at room temperature is avoided.

[0025] (3) Compared with the traditional method of simply improving the heat resistance of cells, the intelligent temperature adaptive system of the present invention broadens the working temperature range of cells from both high and low temperature directions, making the working temperature of cells wider and greatly improving the adaptability and application range of cells. (IV) Description of the drawings

[0026] Figure 1 The growth curve of the recombinant bacteria heterologously expressing the heat-resistant gene element grpE (A) and the degradation curve of phenanthrene at 42°C (B).

[0027] Figure 2 The growth curve of the recombinant bacteria heterologously expressing the cold-resistant gene element srmB (A) and the degradation curve of phenanthrene at 18°C ​​(B).

[0028] Figure 3The effect of the temperature-induced element of heat-resistant gene expression on the recombinant bacteria. A is the fluorescence intensity comparison; B is the growth curve at 42°C; C is the degradation curve of phenanthrene at 42°C.

[0029] Figure 4 The effect of the temperature-induced element of cold-resistant gene expression on the recombinant bacteria. A is the fluorescence intensity comparison; B is the growth curve at 18℃; C is the degradation curve of phenanthrene at 18℃.

[0030] Figure 5 The effect of the intelligent temperature adaptation system on the recombinant bacteria. A is the growth curve at 42°C; B is the growth curve at 18°C; C is the growth curve at 30°C; D is a bar graph of the residual phenanthrene after degradation at 18°C, 30°C, and 42°C for 12 hours. (V) Specific implementation methods

[0031] The present invention is further described below in conjunction with specific embodiments, but the protection scope of the present invention is not limited thereto:

[0032] LB liquid medium composition: 10g / L tryptone, 5g / L yeast powder, 10g / L NaCl, solvent is deionized water, pH value is natural. Sterilize at 121℃ for 20min.

[0033] LB solid medium is prepared by adding 20 g / L agar to LB liquid medium.

[0034] P5Y3 liquid medium composition: yeast powder 3g / L, tryptone (LP0137) 5g / L, sea crystal 25g / L, solvent is deionized water, pH value is natural. Sterilize at 121℃ for 20min.

[0035] P5Y3 plate medium is prepared by adding 20 g / L agar to P5Y3 liquid medium.

[0036] The composition of the conjugation plate is: 7.5 g / L tryptone, 4 g / L yeast powder, 5 g / L NaCl, 12.5 g / L sea crystal, the solvent is deionized water, and the pH value is natural.

[0037] Example 1: Heterologous expression and functional verification of temperature adaptation elements in Neosphingobacterium US6-1

[0038] 1. Acquisition of temperature-adaptive components:

[0039] By searching the UniProt protein database and constructing a phylogenetic tree using MEGA software, we analyzed and screened the cold- and heat-resistant elements including grpE, dnaK, dnaJ, degP, deaD, nusA and hfq. Finally, we selected the grpE gene as the heat-resistant gene element and the srmB gene as the cold-resistant gene element.

[0040] Acquisition of target gene fragments: The grpE gene (TthAA229_15450) from Thermus thermophilus AA2-29 and the ribosome assembly factor srmB (CXF81_10810) from Glaciecola sp. 33A were obtained from NCBI and synthesized from scratch, and then appropriate primers (grpE upstream primer 5'TTCACACAGGAGAGAATTCAATGGAGGAGCGGAACCACGA3' and downstream primer 5'GCTTGGATCCTCGAGCTCCACTACTCCAGGTCCGCCTCTT3'; srmB upstream primer 5'TTCACACAGGAGAGAATTCAATGTTTGATCAATTAGATTT3' and downstream primer 5'AAACAGCCAAGCTTGGATCCCTACGCCTCTTTTGATTTAG') were designed to amplify the target fragment. The restriction sites on the primers were added according to the selected vector.

[0041] The PCR system was: 2×Phanta Master Mix 25μL (Vazyme Biotechnology Co., Ltd.), ddH2O20μL, 2μL of each primer and 1μL of template. The annealing temperature and extension time were adjusted according to the length of the primer and gene fragment. The amplification program was 95℃ pre-denaturation for 3min, 95℃ denaturation for 1min, 58℃ annealing for 15s, 72℃ extension for 30s, 35 cycles, and 72℃ extension for another 5min. The PCR products were purified according to the instructions of FastPure Gel DNA Extraction Mini Kit (DC301) of Vazyme Biotechnology Co., Ltd. to obtain PCR fragments, which were grpE gene fragment (nucleotide sequence shown in SEQ ID NO.1) and srmB gene fragment (nucleotide sequence shown in SEQ ID NO.2).

[0042] 2. Obtaining recombinant plasmids pHGE-Ptac-grpE and pHGE-Ptac-srmB:

[0043] (1) Preparation of linearized vector: Select the multiple cloning site of plasmid pHGE-Ptac (nucleotide sequence as shown in SEQ ID NO.6), design primers (forward primer GTCGACGGAGCTCGAATTCG and reverse primer AAGCTTGCGGCCGCACTC) to perform reverse PCR amplification on pHGE-Ptac to obtain a linearized vector with a size of 5938 bp. The PCR system is 2×Phanta MasterMix 25μL, ddH2O 20μL, 10μM forward and reverse primers 2μL each and 10ng / μL plasmid template 1μL. Agarose electrophoresis is used to verify that the band and size of the amplified product are correct.

[0044] (2) DpnI digestion of the amplified product: Since the amplified product of the linearized vector pHGE-Ptac contains a certain concentration of the original plasmid template, false positive transformants will be formed after the transformation of the recombinant product. Therefore, the amplified product needs to be digested with DpnI to remove the methylated template plasmid. The reaction system is DpnI 1 μL and amplified product 50 μL. After mixing, the reaction is kept at 37°C for 1 hour.

[0045] (3) DNA purification and concentration determination of digestion products: Purify the digested plasmid according to the instructions of the PCR product purification kit in step (2), and then use an ND5000 ultra-micro spectrophotometer to determine the concentration of the linearized plasmid vector to be 50 ng / μL.

[0046] (4) According to the concentration of PCR product and linearized plasmid vector, prepare the reaction system on ice: Ⅱ2μL, 5×CEⅡBuffer 4μL, 50ng of PCR fragment obtained in step 1, 15ng of linearized plasmid purified in step (3), and ddH2O were added to 20μL. The recombinant system was briefly centrifuged and placed in a 37℃ metal bath for reaction for 30min to obtain recombinant plasmids pHGE-Ptac-grpE and pHGE-Ptac-srmB, respectively.

[0047] 3. Transformation and conjugation of recombinant bacteria

[0048] (1) Take out the competent cells of E. coli WM3064 and place them on ice for 10 min. Add 10 μL of the recombinant plasmids pHGE-Ptac, pHGE-Ptac-grpE, and pHGE-Ptac-srmB to the cells, mix them, and let them stand for 30 min.

[0049] (2) The mixture of step (1) was heat-shocked at 42°C for 90 seconds, and then allowed to stand at room temperature for 2 minutes. 1 mL of LB medium containing 0.3 mM diaminopimelic acid (DAP) was added, and the mixture was incubated at 37°C and 180 rpm for 1-2 hours.

[0050] (3) After incubation in step (2), the bacterial solution was centrifuged, the supernatant was discarded, the bacteria were resuspended in the remaining culture medium and spread on an LB plate containing 50 μg / mL kanamycin.

[0051] (4) Step (3) Invert the plate and incubate at 37°C for 12-16 hours for activation.

[0052] (5) The activated cultured strain in step (4) was inoculated onto an LB plate containing 50 μg / mL kanamycin and 0.3 mM DAP and cultured at 37°C for 12-16 h. The bacterial cells were scraped and resuspended in LB liquid culture medium, centrifuged and the supernatant was discarded, the resuspension and centrifugation were repeated twice, and the cells were resuspended in 100 μL fresh LB liquid culture medium to serve as donor bacteria.

[0053] (6) N. pentaromativorans US6-1 (deposited in Japan Collection of Microorganisms, accession number JCM12182) T ) were inoculated onto P5Y3 plates and cultured at 30°C for 36-48h. The cells were scraped and resuspended in P5Y3 liquid medium, centrifuged and the supernatant was discarded, the cells were resuspended and centrifuged twice, and resuspended in 100 μL of fresh P5Y3 liquid medium as the recipient bacteria.

[0054] (7) Take 50 μL of the recipient bacteria and 50 μL of the donor bacteria, mix them and spot-inoculate them on a conjugation plate containing 0.3 mM DAP, and culture at 30°C for 24 h.

[0055] (8) Collect the zygotic lawn, resuspend it in P5Y3 liquid medium, centrifuge it and discard the supernatant, repeat the resuspension and centrifugation twice, and resuspend it in P5Y3 liquid medium.

[0056] (9) Resuspend the cells in step (8), transfer to P5Y3 liquid medium containing 50 μg / mL kanamycin, and culture at 30°C and 180 rpm for 12 h. Spread the bacterial solution on a P5Y3 plate containing 50 μg / mL kanamycin and culture at 30°C until conjugants, i.e., colonies, grow.

[0057] 4. Identification and sequencing of recombinant bacteria

[0058] (1) Colony PCR: Pick 10 colonies from the solid plate (9) in step 3 and perform colony PCR identification. Use a single colony as a template, select the universal sequencing primers on the vector (forward primer GTCGACGGAGCTCGAATTCG and reverse primer AAGCTTGCGGCCGCACTC), refer to the instructions of the selected DNA polymerase, prepare a suitable reaction system, and select the corresponding PCR program for amplification.

[0059] (2) Colonies identified as positive by colony PCR were inoculated into P5Y3 liquid culture medium containing 50 μg / mL kanamycin and cultured at 37°C for 12 h. The plasmids were extracted and sent to Shanghai Bio-Sequencing Co., Ltd. for sequencing verification. The recombinant bacteria US6-1 containing the heat-resistant gene element grpE (denoted as US6-1 / Ptac-grpE) and the recombinant bacteria US6-1 containing the cold-resistant gene element srmB (denoted as US6-1 / Ptac-srmB) were obtained, respectively. At the same time, a control strain containing only an empty plasmid was denoted as US6-1 / Ptac.

[0060] 5. Determination of Growth Curve

[0061] (1) Strain activation: US6-1 / Ptac-grpE, US6-1 / Ptac-srmB, and US6-1 / Ptac were inoculated onto sterile P5Y3 plates containing 50 μg / mL kanamycin, respectively, and incubated in an incubator at 30°C for 36-48 hours. The purpose of inverted culture is to prevent condensed water from dripping onto the colonies and affecting their growth.

[0062] (2) Single colony selection and inoculation: Carefully select single colonies with good growth and clear morphology on the plate. Inoculate the selected single colonies into 5 mL of P5Y3 liquid culture medium containing 50 μg / mL kanamycin.

[0063] (3) Liquid culture medium: Place the inoculated liquid culture medium in a shaker, set the temperature to 30°C, and the speed to 180 r / min. During the culture process, regularly monitor the OD value of the bacterial solution. 600 value (a measure of bacterial concentration) until OD 600 When the value reaches 1.0, it is used as seed solution.

[0064] (4) Transfer to new culture medium: Inoculate the culture medium at a volume concentration of 1% by volume. 600 The 1.0 bacterial suspension was transferred to a new 50 mL P5Y3 liquid culture medium containing 50 μg / mL kanamycin and 0.2 mM IPTG.

[0065] (5) Cultivation and monitoring at high temperature: The culture medium inoculated with US6-1 / Ptac-grpE and US6-1 / Ptac in step (4) was cultured in a shaker at 42°C and 180 r / min. Every 4 h, 200 μL of the bacterial solution was placed in a 96-well plate. The OD of the bacterial solution sampled at each time point was measured using an ELISA reader. 600 Value. 600 The growth curve is drawn with the value as the vertical axis and the culture time as the horizontal axis, which can intuitively show the growth of the strain at different times. The results are shown in Figure 1In Figure A, it was found that the biomass accumulation of the grpE expression strain at 42°C was 2.25 times that of the control strain containing the empty vector.

[0066] (6) Cultivation and monitoring at low temperature: The culture medium inoculated with US6-1 / Ptac-srmB and US6-1 / Ptac in step (4) was cultured in a shaker at 18°C ​​and 180 r / min. Every 4 h, 200 μL of the bacterial solution was placed in a 96-well plate. The OD of the bacterial solution sampled at each time point was measured using an ELISA reader. 600 Value. 600 The value is the ordinate, and the growth curve is drawn with the culture time as the abscissa. The results are shown in Figure 2 In Figure A, it can be seen that the biomass accumulation of the srmB expression strain at 18°C ​​is 1.30 times that of the empty vector control strain.

[0067] 6. Determination of PAHs degradation curve

[0068] (1) Degradation of PAHs by thermotolerant strains: OD was prepared by the method of step 3 600 The seed solution of US6-1 / Ptac-grpE and US6-1 / Ptac with a concentration of 1.0 was transferred to 50 mL of P5Y3 liquid medium containing 0.2 mg / mL phenanthrene (a typical polycyclic aromatic hydrocarbon), 50 μg / mL kanamycin and 0.2 mM IPTG. The culture was carried out in a shaker at 42°C and 180 r / min. Samples were taken every 12 hours to determine the residual amount of phenanthrene and a degradation curve was drawn. The results are shown in the figure. Figure 1 In B, the residual amount of phenanthrene after degradation by the grpE expression strain at 42°C was 65.9% of that of the empty vector control strain.

[0069] (2) The reaction of low-temperature resistant strains to degrade PAHs:

[0070] Prepare OD using the method in step 3 600 The seed solution of US6-1 / Ptac-srmB and US6-1 / Ptac with a concentration of 1.0 was transferred to 50 mL of P5Y3 liquid medium containing 0.2 mg / mL phenanthrene, 50 μg / mL kanamycin and 0.2 mM IPTG. The culture was cultured in a shaker at 18°C ​​and 180 r / min. The culture solution was sampled every 12 hours to determine the content of phenanthrene and draw a degradation curve. The results are shown in the figure. Figure 2 In B, at 18°C, the residual amount of phenanthrene degradation by the srmB expression strain was 42.8% of that of the empty vector control strain.

[0071] (3) Detection of phenanthrene content by high performance liquid chromatography

[0072] ① Extraction and stratification: Take 1 mL of the culture solution each time and transfer it to a 5 mL centrifuge tube. Add 2 mL of ethyl acetate to the centrifuge tube. Mix the two by vortexing for 5 minutes to promote the extraction of the target substance. Let the mixture stand for 5 minutes and wait for it to stratify naturally.

[0073] ② Concentration and dissolution: Take 1 mL of the liquid from the upper layer of ethyl acetate in step ① and transfer it to a 1.5 mL EP tube. Use a centrifugal concentrator to centrifuge and concentrate the liquid in the EP tube at 50°C for 30 minutes until the ethyl acetate is completely evaporated. Add 1 mL of methanol to the EP tube and shake to dissolve the remaining phenanthrene as the sample to be tested.

[0074] ③ Filtration and high performance liquid chromatography (HPLC) analysis: The sample to be tested in step ② was filtered through an organic filter head with a pore size of 0.45 μm. The filtrate was transferred to a 2 mL chromatography bottle and the content of phenanthrene was analyzed by high performance liquid chromatography.

[0075] ShimNex S-C18-PAH column was used as the chromatographic column. A volume ratio of 60:40 of acetonitrile and aqueous solution was selected as the mobile phase. The flow rate was set to 1.5 mL / min. The injection volume was 5 μL. The column temperature was maintained at 25 °C. 254 nm was selected as the detection wavelength.

[0076] Example 2: Functional verification of temperature-induced switching element

[0077] A sfGFP reporter system was constructed to detect whether the temperature-inducible switch would activate the expression of the target gene under corresponding temperature conditions.

[0078] 1. Acquisition of relevant fragments

[0079] (1) Acquisition of heat-induced switch element: The RNAT sequence (BBa_K115001) published on iGEM was referred to and the sequence was obtained by de novo synthesis. Primers with 20 bp homology arms to the linearized vector pHGE-Ptac were designed (upstream primer 5'AATCATCGGCTCGTATAATGTACTAGAGGCCGCGACAAGC3' and downstream primer 5'TCGTGGTTCCGCTCCTCCATCTAGTAATCCTCCAAGGAGC3'). The synthesized gene sequence was used as a template and the amplification steps were the same as in Example 1 to obtain the RNAT fragment. The nucleotide sequence is shown in SEQ ID NO.4.

[0080] SEQ ID NO.4

[0081] TACTAGAGGCCGCGACAAGCGGTCCGGGCGCCCTAGGGGCCCGGCGGAGA CGGGCGCCGGAGGTGTCCGACGCCTGCTCGTCAAGTTCTTGCTCCTTGGAGGAT TACTAG.

[0082] (2) Obtaining the cold-induced switch element: Based on the RNase E sequence, the RNase E cleavage sequence (RC) and its complementary base sequence (ARC) were first separated separately; then the Two State Melting Hybridization function of DINAMelt (http: / / www.unafold.org / ) was used to ensure that the Tm value (melting point temperature) was about 30°C based on the given melting temperature, so that they could form a stable hairpin structure at low temperatures (below 30°C). The cold-induced switch element was designed and named coldRNAT. The nucleotide sequence is shown in SEQ ID NO.5.

[0083] SEQ ID NO.5

[0084] AATTAATCATCGGCTCGTATAATGTGTGTTGAATGAGTTCGGTTAAGAAAAA TATAAATCTTCCGCTCTCCGGAATTGTGAGCGGATAACAATTTCAC.

[0085] (3) Obtaining the sfgfp gene fragment: Using the plasmid psfGFP as a template, primers were designed (upstream primer 5'TTGCGGCCGCGATATTTCCTTTGTGCTAGTT3' and downstream primer 5'CCGCTCGAGTTATTCTTTACGAACATAAT3'), and the amplification steps were the same as in Example 1 to obtain a sfgfp fragment of 751 bp in size, the nucleotide sequence of which is shown in SEQ ID NO.3;

[0086] 2. Construction of the thermostable temperature switch plasmid pHGE-PJ23119-RNAT-sfgfp

[0087] (1) Preparation of linearized vector: Select the promoter site of plasmid pHGE-Ptac, design primers (forward primer ATGGAGGAGCGGAACCACGA and reverse primer CATTATACGAGCCGATGATT) to perform inverse PCR amplification on pHGE-Ptac to obtain the linearized vector. The PCR system, digestion and purification steps are the same as in Example 1.

[0088] (2) The linearized vector purified in step (1) and the heat-inducible switch element RNAT fragment obtained in step 1 are connected by a one-step cloning method to obtain a heat-resistant temperature switch plasmid pHGE-Ptac-RNAT-sfgfp.

[0089] In the same way, the linearized vector purified in step (1) and the sfgfp fragment obtained in step 1 were connected to obtain pHGE-Ptac-sfgfp.

[0090] (3) Replacement of vector promoter: Select the promoter site of plasmid pHGE-Ptac-RNAT-sfgfp, design primers (forward primer GCTCAGTCCTAGGTATAATGCTAGCTACTAGAGGCCGCGACAAGC and reverse primer TACCTAGGACTGAGCTAGCTGTCAATTATTGACTACCGGAAGCAG) to perform overlapping PCR amplification on pHGE-Ptac-RNAT-sfgfp to replace the vector promoter Ptac with PJ23119 (nucleotide sequence as shown in SEQ ID NO.7), and construct the heat-resistant temperature switch plasmid pHGE-PJ23119-RNAT-sfgfp. The PCR system is the same as step 1 of Example 1. In the same way, pHGE-PJ23119-sfgfp is constructed.

[0091] 3. Construction of the cold-resistant temperature switch plasmid pHGE-PJ23119-coldRNAT-sfgfp

[0092] Using pHGE-PJ23119-sfgfp as template, primers were designed (upstream primer 5'GTCCTAGGTATAATGCTAGCCCGCTCTTCCGGAATTGTGAGCGGATAACA3' and downstream primer

[0093] 5'TTATATTTTTCTTAACCGAACTCATTCAACACACATTATACGAGCCGATG3') and insert the cold-induced switch fragment in step 1 into the plasmid to construct the plasmid

[0094] pHGE-PJ23119-coldRNAT-sfgfp. The amplification step is the same as step 1 of Example 1.

[0095] 4. Construction of recombinant bacteria

[0096] The method of step 3 of Example 1 was used to transform the plasmids pHGE-Ptac-sfgfp, pHGE-PJ23119-RNAT-sfgfp, and pHGE-PJ23119-coldRNAT-sfgfp into the N. pentaromativorans US6-1 strain, and colony PCR was used to verify and screen the correct conjugants. Recombinant bacteria US6-1 / Ptac-sfgfp, US6-1 / PJ23119-RNAT-sfgfp, and US6-1 / PJ23119-coldRNAT-sfgfp were obtained, respectively.

[0097] The above recombinant bacteria were mixed with 30% glycerol at a ratio of 1:1 and stored at -80°C.

[0098] 5. Determination of fluorescence intensity of recombinant bacteria at different temperatures

[0099] (1) Fluorescence intensity of the thermostable recombinant bacteria

[0100] The recombinant bacteria US6-1 / Ptac-sfgfp and US6-1 / PJ23119-RNAT-sfgfp prepared in step 4 were activated and seed solution was prepared by the method of step 5 of Example 1. The seed solution was inoculated into 5 mL of P5Y3 liquid medium containing 50 μg / mL kanamycin (0.2 mM IPTG was added to the recombinant bacteria US6-1 / Ptac-sfgfp) at an inoculum concentration of 1% by volume, and cultured at 30°C and 180 r / min for 12 h, 42°C and 180 r / min for 12 h, and then cultured at 30°C and 180 r / min for 12 h. Samples were taken after each temperature culture, and OD was detected using an ELISA instrument 600 The excitation wavelength of sfGFP was set to 488 nm and the emission wavelength was set to 520 nm. The RFU / OD 600 (RelativeFluorescence Units / OD 600nm Define a fluorescence intensity unit) to evaluate promoter activity, and the results are shown in Figure 3 In Figure A, the relative fluorescence intensity of the recombinant strain containing PJ23119-RNAT-sfgfp after 12 hours of induction at 42°C was 1520.15, which was closest to the relative fluorescence intensity of the control strain containing Ptac-sfgfp after 12 hours of induction with 0.2 mM IPTG (1769.33). Therefore, it was selected as a heat-induced switch to control the expression of the heat-resistant element.

[0101] (2) Fluorescence intensity of cold-resistant temperature switch recombinant bacteria

[0102] The recombinant bacteria US6-1 / PJ23119-RNAT-sfgfp in step (1) was replaced with US6-1 / PJ23119-coldRNAT-sfgfp, and the temperature was changed from 42°C to 18°C. Other operations were the same. The results are shown in Figure 4 In Figure A, after 12 hours of 18°C ​​induction, the relative fluorescence intensity controlled by PJ23119-coldRNAT-sfgfp was 2482.74, which was closest to the relative fluorescence intensity of 2327.66 of the Ptac promoter after 12 hours of 0.2 mM IPTG induction. Based on this, coldRNAT was selected as the cold-inducible switch to control the expression of cold-tolerant elements.

[0103] Example 3: Assembly and evaluation of intelligent temperature adaptive system

[0104] 1. Construction and evaluation of heat-resistant gene recombinant bacteria:

[0105] (1) Construction of heat-resistant gene recombinant bacteria

[0106] Using pHGE-PJ23119-RNAT-sfgfp constructed in Example 2 as a template, primers (upstream primer 5'GATCCAAGCTTGGCTGTTT3' and downstream primer 5'TCGTGGTTCCGCTCCTCCATCTAGTAATCCTCCAAGGAGC3') were designed to linearize the plasmid, and then connected with the grpE gene fragment obtained by the method of Example 1 by one-step cloning to construct the heat-resistant gene plasmid pHGE-PJ23119-RNAT-grpE.

[0107] The method of step 3 of Example 1 was used to transform the plasmid pHGE-PJ23119-RNAT-grpE into the N. pentaromativorans US6-1 strain, and colony PCR was used to verify and screen the correct conjugants to obtain the recombinant bacteria US6-1 / PJ23119-RNAT-grpE.

[0108] (2) Growth curve of heat-resistant gene recombinant bacteria

[0109] The recombinant bacteria US6-1 / Ptac, US6-1 / Ptac-grpE and US6-1 / PJ23119-RNAT-grpE constructed by the method of Example 1 were prepared according to the method of Example 1. 600The seed solution was 1.0, and the seed solution was inoculated into 50 mL of P5Y3 liquid medium containing 50 μg / mL kanamycin (recombinant bacteria US6-1 / Ptac-grpE was supplemented with 0.2 mM IPTG) at a volume concentration of 1%, and cultured at 42°C and 180 r / min. Every 4 hours, 200 μL of bacterial solution was placed in a 96-well plate. The OD of the bacterial solution sampled at each time point was measured using an ELISA instrument. 600 Value. 600 The value is the ordinate, and the growth curve is drawn with the culture time as the abscissa. The results are shown in Figure 3 B, biomass (OD) of the strain US6-1 / PJ233119-RNAT-grpE integrated with the heat-resistant gene circuit after cultivation at 42°C for 24 h 600 ) was 2.43 times that of the empty vector control strain.

[0110] (3) Degradation rate of phenanthrene by heat-resistant gene recombinant bacteria

[0111] The seed solution from step (2) was inoculated into 50 mL of P5Y3 liquid culture medium containing 0.2 mg / mL phenanthrene (0.2 mM IPTG was also added to the recombinant strain US6-1 / Ptac-grpE) at a volume concentration of 1%. The culture was cultured in a shaker at 42°C and 180 r / min. The culture solution was sampled every 12 h. The phenanthrene content was determined by the method of Example 1. A degradation curve was plotted. The results are shown in Table 1. Figure 3 In Figure C, after degradation at 42°C for 12 h, the residual phenanthrene content of strain US6-1 / PJ233119-RNAT-grpE was only 73.7% of that of the empty vector control strain.

[0112] 2. Construction of cold-resistant gene recombinant bacteria:

[0113] Using pHGE-PJ23119-coldRNAT-sfgfp constructed in Example 2 as a template, primers (upstream primer 5'GTCGACGGAGCTCGAATTCG' and downstream primer 5'TCGTGGTTCCGCTCCTCCATCTAGTAATCCTCCAAGGAGC3') were designed to linearize the plasmid, and then connected with the srmB gene fragment obtained by the method of Example 1 by one-step cloning to construct the cold-resistant gene plasmid pHGE-PJ23119-coldRNAT-srmB.

[0114] The plasmid pHGE-PJ23119-coldRNAT-srmB was transformed into the N. pentaromativorans US6-1 strain by the method of step 3 of Example 1, and the correct conjugates were screened by colony PCR to obtain the recombinant bacteria US6-1 / PJ23119-coldRNAT-srmB.

[0115] (2) Growth curve of cold-resistant gene recombinant bacteria

[0116] The recombinant bacteria US6-1 / Ptac, US6-1 / Ptac-srmB and US6-1 / PJ23119-coldRNAT-srmB constructed by the method of Example 1 were prepared according to the method of Example 1. 600 The seed solution was 1.0, and the seed solution was inoculated into 50 mL of P5Y3 liquid medium containing 50 μg / mL kanamycin (recombinant strain US6-1 / Ptac-srmB was supplemented with 0.2 mM IPTG) at a volume concentration of 1%, and cultured at 18°C ​​and 180 r / min. 200 μL of bacterial solution was taken every 4 hours and placed in a 96-well plate. The OD of the bacterial solution sampled at each time point was measured using an ELISA reader. 600 Value. 600 The value is the ordinate, and the growth curve is drawn with the culture time as the abscissa. The results are shown in Figure 4 B, biomass (OD) of strain US6-1 / PJ23119-coldRNAT-srmB integrated with cold-tolerant gene circuit cultured at 18°C 600 ) was 1.31 times that of the empty vector control strain.

[0117] (3) Degradation rate of phenanthrene by cold-resistant gene recombinant bacteria

[0118] The seed solution from step (2) was inoculated into 50 mL of P5Y3 liquid culture medium containing 0.2 mg / mL phenanthrene (0.2 mM IPTG was added to the recombinant strain US6-1 / Ptac-srmB) at a volume concentration of 1%. The culture was cultured in a shaker at 18°C ​​and 180 r / min. The culture solution was taken as a sample every 12 h. The phenanthrene content was determined by the method of Example 1, the degradation rate was calculated, and the degradation curve was plotted. The results are shown in Table 1. Figure 4 C, after degradation at 18°C ​​for 12 h, the residual phenanthrene content of strain US6-1 / PJ23119-coldRNAT2-srmB was only 41.4% of that of the empty vector control strain.

[0119] 3. Assembly and evaluation of intelligent temperature adaptive system:

[0120] (1) Construction of recombinant bacteria

[0121] Using the heat-resistant gene plasmid pHGE-PJ23119-RNAT-grpE as a template, primers were designed (upstream primer 5'GGTTTACCGGTGTGGTGAATTCAGGCATTTGAGAAGCACA3' and downstream primer 5'TTGTCGGTGAACGCACCGGTATGCCTGGCAGTTCCCTACT3'), and the heat-resistant gene fragment was obtained using the PCR system and procedure of step 1 of Example 1.

[0122] Using pHGE-PJ23119-coldRNAT-srmB as a template, primers (upstream primer 5'ATTCACCACACCGGTAAACC3' and downstream primer 5'ACCGGTGCGTTCACCGACAA3') were designed to linearize the plasmid, and then the linearized plasmid was connected to the heat-resistant gene fragment to obtain the intelligent temperature adaptability system plasmid PJ23119-RNAT-grpE-PJ23119-coldRNAT-srmB. The method of step 3 of Example 1 was used to transform the plasmid into the N. pentaromativorans US6-1 strain, and colony PCR was used to verify and screen the correct conjugants to obtain the recombinant bacteria US6-1 / PJ23119-RNAT-grpE-PJ23119-coldRNAT-srmB.

[0123] (2) Growth curves under different temperature cultures

[0124] The recombinant bacteria US6-1 / Ptac, US6-1 / Ptac-grpE, US6-1 / Ptac-srmB, US6-1 / PJ23119-RNAT-grpE, US6-1 / PJ23119-coldRNAT-srmB, and US6-1 / PJ23119-RNAT-grpE-PJ23119-coldRNAT-srmB were prepared according to the method of Example 1. 600 The seed solution was 1.0, and the seed solution was inoculated into 50 mL of P5Y3 liquid medium containing 50 μg / mL kanamycin (recombinant bacteria US6-1 / Ptac-grpE and US6-1 / Ptac-srmB were additionally supplemented with 0.2 mM IPTG) at a volume concentration of 1%, and cultured at 42°C, 18°C, 30°C, and 180 r / min. 200 μL of bacterial solution was taken every 4 hours and placed in a 96-well plate. The OD of the bacterial solution sampled at each time point was measured using an ELISA instrument. 600 Value. 600 The value is the ordinate, and the growth curve is drawn with the culture time as the abscissa. The results are shown in Figure 5A (42℃), B (18℃), C (30℃), strain US6-1 / PJ23119-RNAT-grpE-PJ23119-coldRNAT-srmB integrated with cold and heat tolerant gene circuits cultured at 42℃ (OD 600 ) is 2.68 times that of the control strain containing no vector ( Figure 5 A); the biomass when cultured at 18°C ​​was 1.29 times that of the control strain containing no vector ( Figure 5 B), while at 30°C, the negative effects of the cold and heat resistant components were avoided and the growth was similar to that of the control strain containing no vector ( Figure 5 Middle C).

[0125] (3) Degradation rate of phenanthrene at different temperatures

[0126] The seed solution of step (2) was inoculated into 50 mL of P5Y3 liquid culture medium containing 0.2 mg / mL phenanthrene (0.2 mM IPTG was added to the recombinant bacteria US6-1 / Ptac-grpE and US6-1 / Ptac-srmB) at a volume concentration of 1%. The culture was respectively cultured at 18°C, 30°C, 42°C, and 180 r / min in a shaker. The culture solution was taken as a sample every 12 hours. The content of phenanthrene was determined by the method of Example 1, the degradation rate was calculated, and the degradation curve was drawn. The results are shown in Figure 5 In D, after degradation at 18°C ​​for 12 h, the residual phenanthrene content of strain US6-1 / PJ23119-RNAT-grpE-PJ23119-coldRNAT-srmB was 50.5% of that of the empty-load control strain; after degradation at 42°C for 12 h, the residual phenanthrene content of strain US6-1 / PJ23119-RNAT-grpE-PJ23119-coldRNAT-srmB was 73.9% of that of the empty-load control strain.

Claims

1. An intelligent temperature adaptive system for expanding the temperature range of polycyclic aromatic hydrocarbons-degrading bacteria, characterized in that: The system includes a heat-resistant gene element, a cold-resistant gene element, a temperature-inducing element expressed by the heat-resistant gene element, and a temperature-inducing element expressed by the cold-resistant gene element; the heat-resistant gene element includes a heat shock protein grpE gene; the cold-resistant gene element includes a ribosome assembly factor srmB; the temperature-inducing element expressed by the heat-resistant gene element includes an RNA thermometer, the nucleotide sequence of which is shown in SEQ ID NO.4; the temperature-inducing element expressed by the cold-resistant gene element includes an RNA thermal inhibition thermometer, the nucleotide sequence of which is shown in SEQ ID NO.

5.

2. The intelligent temperature adaptive system according to claim 1, characterized in that: The nucleotide sequence of the grpE gene is shown in SEQ ID NO.1, and the nucleotide sequence of the ribosome assembly factor srmB is shown in SEQ ID NO.

2.

3. A recombinant polycyclic aromatic hydrocarbons-degrading bacterium comprising the intelligent temperature adaptive system according to claim 1.

4. The recombinant polycyclic aromatic hydrocarbons-degrading bacteria according to claim 3, characterized in that The degradation bacteria are constructed according to the following method: (1) connecting the heat-resistant gene element and the temperature-induced element expressed by the heat-resistant gene element to the multiple cloning site of the pHGE-Ptac vector, and replacing the vector promoter Ptac with the promoter PJ23119; (2) connecting the cold-resistant gene element and the temperature-induced element expressed by the cold-resistant gene element to the multiple cloning site of the pHGE-Ptac vector, and replacing Ptac with the promoter PJ23119; (3) expressing the plasmids constructed in step (1) in E. coli WM3064 respectively; (4) incubating the bacterial solution of step (3) with polycyclic aromatic hydrocarbon degrading bacteria, and screening for recombinant bacteria containing the heat-resistant gene element and the temperature-induced element expressed by the heat-resistant gene element; (5) expressing the plasmid of step (2) in E. coli WM3064 and incubating it with the strain of step (4) to screen for recombinant polycyclic aromatic hydrocarbon degrading bacteria containing an intelligent temperature adaptive system.

5. The recombinant polycyclic aromatic hydrocarbons-degrading bacteria according to claim 4, characterized in that The polycyclic aromatic hydrocarbons-degrading bacteria include Novosphingobium pentaromativorans US6-1.

6. The recombinant polycyclic aromatic hydrocarbons-degrading bacteria according to claim 4, characterized in that The nucleotide sequence of the promoter PJ23119 is shown in SEQ ID NO.

7.

7. Use of a recombinant polycyclic aromatic hydrocarbons-degrading bacterium comprising the intelligent temperature adaptive system according to claim 1 in degrading polycyclic aromatic hydrocarbons.

8. The use according to claim 7, characterized in that The application is to inoculate the recombinant polycyclic aromatic hydrocarbons-degrading bacteria into a P5Y3 liquid culture medium containing polycyclic aromatic hydrocarbons, and culture under the conditions of 18-42° C. and 100-200 rpm to achieve degradation of the polycyclic aromatic hydrocarbons.

9. The use according to claim 8, characterized in that The concentration of the polycyclic aromatic hydrocarbons in the culture medium is 0.1-1 mg / mL.

10. The use according to claim 8, characterized in that The polycyclic aromatic hydrocarbons include phenanthrene.

Images