Olicanol synthase mutant and application thereof

Abstract

The invention discloses an olive alcohol synthetase mutant and application thereof, and relates to the technical field of biosynthesis. The olive alcohol synthetase mutant provided by the invention has any one of the following mutations on a sequence as shown in SEQ ID NO.1: substitution of isoleucine at the 207 site with alanine, substitution of phenylalanine at the 208 site with alanine, substitution of leucine at the 261 site with alanine, substitution of histidine at the 262 site with alanine, and substitution of glycine at the 299 site with alanine. Compared with wild type olive alcohol synthase, the five olive alcohol synthase mutants have the advantages that the activity is obviously changed, the synthesis of the olive acid OA can be effectively regulated, the synthesis of products such as 3, 5.7-trioxodecanoy1-CoA, the olive acid, cannabinoid phenolic acid, cannabidiol and delta9-tetrahydrocannabinol can be regulated, and a new foundation is laid for the industrial production and application of the olive alcohol synthase mutants. And a technical foundation is laid for adjusting the yield of biosynthesized cannabidiol.

Description

Technical Field

[0001] The invention relates to the technical field of biosynthesis, in particular to an olive alcohol synthase mutant and application thereof. Background Art

[0002] Cannabinoids are a class of secondary metabolites derived from cannabis (Cannabis sativa L.), which are mainly synthesized and accumulated in the secretory glandular hairs of flowers and bracts. 9 -Tetrahydrocannabinol (Δ 9 -tetrahydrocannabinol, Δ 9 -THC), cannabidiol (CBD) and cannabigerolic acid (CBGA) are the main cannabinoids with therapeutic potential that are currently being studied.

[0003] CBD has multiple pharmacological effects such as antibacterial, anti-inflammatory, anti-anxiety, and anti-epileptic, and it does not cause addiction. With the widespread application of CBD drugs and health products, the demand for industrial hemp in the international market continues to grow. At present, CBD mainly relies on direct extraction from hemp. In order to meet the market demand for cannabinoids and reduce preparation costs, the biosynthesis technology of cannabinoids is a hot topic in industry research.

[0004] In the biosynthetic pathway of cannabinoids, the skeleton biosynthesis of cannabinoids includes the fatty acid pathway and the terpene pathway. Among them, the fatty acid pathway is composed of acyl-activating enzyme 1 (AAE1), olivetol synthase (OLS) and olivetolic acid cyclase (OAC). AAE1 converts hexanoic acid into hexanoyl-CoA, and OLS then catalyzes the condensation of hexanoyl-CoA with 3 molecules of malonyl-CoA to form the intermediate 3,5.7-trioxodecanoy1-CoA. This intermediate is further cyclized by OAC to produce olivetolic acid (OA).

[0005] OA is a polyketide nucleating component required for the synthesis of cannabinoids. During the synthesis of OA, the low activity of the wild-type olive alcohol synthase OLS affects the supply of OA, which in turn affects the synthesis of CBGA and CBD. Therefore, it is necessary to develop a highly active OLS enzyme to increase the production of CBGA and CBD. Summary of the invention

[0006] Due to the low activity of olive alcohol synthase OLS, the high yield of CBGA and CBD in biosynthesis is limited. The present invention provides an olive alcohol synthase mutant and its application. Compared with the wild-type OLS (i.e., the amino acid sequence shown in SEQ ID NO.1), the olive alcohol synthase mutant provided by the present invention has higher activity and can significantly promote the synthesis of CBGA and CBD. It is specifically achieved by the following technology.

[0007] In a first aspect of the present invention, a mutant of olive alcohol synthase is provided, wherein the olive alcohol synthase mutant is OLS I207A ,OLS F208A ,OLS L261A ,OLS H262A ,OLS G299A Any of the following;

[0008] Compared with the amino acid sequence shown in SEQ ID NO.1, the OLS I207A The isoleucine at position 207 is replaced by alanine. F208A The phenylalanine at position 208 is replaced by alanine. L261A The 261st leucine is replaced by alanine, and the OLS H262A The 262nd histidine is replaced by alanine, and the OLS G299A It means that the glycine at position 299 is replaced by alanine.

[0009] Endogenous glycosylase in tobacco can glycosylate OA to generate glycosylated OA (Glucosylated OA, Glc-OA). Therefore, by taking Glc-OA as the detection object and detecting its content in tobacco, the yield of olivetol synthase mutant catalyzed by olivetol synthase mutant can be indirectly obtained, and then the catalytic activity of olivetol synthase mutant can be determined.

[0010] The present invention provides the above five different olive alcohol synthase mutants. When using the five olive alcohol synthase mutants to produce Glc-OA, the yield of Glc-OA has significant changes. I207A ,OLS F208A ,OLS L261A and OLS G299A When the four olive alcohol synthase mutants synthesized Glc-OA, the content of Glc-OA was significantly reduced compared with the wild-type olive alcohol synthase, specifically by 81.89%, 83.94%, 84.53% and 89.40%, respectively. This indicates that the catalytic activity of the four olive alcohol synthase mutants was significantly reduced. H262AWhen Glc-OA was synthesized, the content of Glc-OA was significantly increased compared with the wild-type olive alcohol synthase, specifically increased by 228.12%. This indicates that the olive alcohol synthase mutant OLS H262A Compared with the wild-type olive alcohol synthase, it has significantly stronger catalytic activity and is more conducive to the synthesis of 3,5.7-trioxodecanoy1-CoA, olive acid, cannabinoid acid, cannabidiol, Δ 9 -Synthesis of products such as tetrahydrocannabinol.

[0011] Therefore, the five olive alcohol synthase mutants provided by the present invention can regulate 3,5.7-trioxodecanoy1-CoA, olive acid, cannabinoid acid, cannabidiol, Δ 9 -Synthesis of tetrahydrocannabinol and other products. It plays a very important regulatory role in the laboratory research of reaction mechanisms or in the production process of the above products.

[0012] The second aspect of the present invention provides a nucleic acid molecule for encoding the above-mentioned olive alcohol synthase mutant.

[0013] Based on the amino acid sequences and codon rules of the five olive alcohol synthase mutants provided above, those skilled in the art can obtain the nucleotide sequences of nucleic acid molecules encoding the above olive alcohol synthase mutants. Based on the degeneracy of codons, the nucleotide sequences of the above nucleic acid molecules are not unique, but all nucleic acid molecules capable of encoding olive alcohol synthase mutants are within the protection scope of the present invention.

[0014] Furthermore, the nucleotide sequence encoding the olive alcohol synthase mutant is shown in SEQ ID NO.2-6. I207A The nucleotide sequence is shown in SEQ ID NO.2; encoding the olive alcohol synthase mutant OLS F208A The nucleotide sequence is shown in SEQ ID NO.3; encoding the olive alcohol synthase mutant OLS L261A The nucleotide sequence is shown in SEQ ID NO.4; encoding the olive alcohol synthase mutant OLS H262A The nucleotide sequence is shown in SEQ ID NO.5; encoding the olive alcohol synthase mutant OLS G299A The nucleotide sequence is shown in SEQ ID NO.6.

[0015] The third aspect of the present invention provides a biological material, comprising any one of the above-mentioned nucleic acid molecules, or used to express the olive alcohol synthase mutant; the biological material is an expression cassette, a vector or a host cell.

[0016] In some biological materials provided by the present invention, the expression cassette containing the nucleic acid molecule is obtained by operably connecting a promoter and the nucleic acid molecule. Depending on the expression requirements and the differences in the upstream and downstream sequences of the expression cassette, the expression cassette may also contain other transcription and translation regulatory elements such as terminators and enhancers.

[0017] In some biological materials provided by the present invention, the vector containing the nucleic acid molecule may be a plasmid vector, which includes replicative vectors and non-replicative vectors; of course, it is not limited to plasmid vectors, and may also be in the form of bacteriophage, virus and other vectors.

[0018] In some biological materials provided by the present invention, the host cell may be Escherichia coli, but is not limited to Escherichia coli, and may also be any microbial cell or animal cell that can be used for protein expression.

[0019] The fourth aspect of the present invention provides an engineered bacterium for expressing the olive alcohol synthase mutant.

[0020] The above-mentioned expression of the olivetol synthase mutant can be achieved by any one or both of the following two methods: the first method is to introduce an expression plasmid containing the coding gene of the olivetol synthase mutant into Escherichia coli; the second method is to insert one or more copies of the coding gene of the olivetol synthase mutant into the genome of Escherichia coli.

[0021] In a fifth aspect, the present invention provides an olive alcohol synthase mutant, or any of the above nucleic acid molecules, or the above biological materials, or the use of the above engineered bacteria, specifically for regulating the synthesis of metabolites in plants, or for regulating the yield of in vitro synthesized metabolites; the metabolites are 3,5.7-trioxodecanoy1-CoA, olive acid, cannabinoid acid, cannabidiol, Δ 9 -At least one of tetrahydrocannabinol.

[0022] In the above application provided by the present invention, according to Δ 9 -Tetrahydrocannabinol (Δ 9 -tetrahydrocannabinol, Δ 9 -THC), cannabidiol (Cannabidiol, CBD) and cannabigerolic acid (Cannabigerolic acid, CBGA) and other products in plants, as long as it is a downstream synthesis pathway involving olivetol synthase, the synthesis of the corresponding products (including intermediates) can be regulated by the five olivetol synthase mutants provided by the present invention.

[0023] The sixth aspect of the present invention provides a method for synthesizing an olivetol synthase mutant, wherein the olivetol synthase mutant is synthesized using the above-mentioned biological material; or, the olivetol synthase mutant is obtained by culturing the above-mentioned engineered bacteria.

[0024] In a seventh aspect, the present invention provides a method for producing cannabinoid acid and / or cannabidiol, comprising: H262A contacting with a substrate to obtain cannabigerolic acid and / or cannabidiol;

[0025] Alternatively, the olivetol synthase mutant OLS is expressed H262A The engineered bacteria are transfected into plants, the plants are cultured and cannabinoid acid and / or cannabidiol are extracted.

[0026] In an eighth aspect of the present invention, a method for detecting the catalytic activity of olivetol synthase or olivetol synthase mutant is provided, comprising the following steps:

[0027] Constructing recombinant expression vectors of the genes AAE1, OAC, and OLS required for olivetate synthesis, and a recombinant expression vector containing a gene sequence encoding the olivetol synthase mutant;

[0028] The four recombinant expression plasmids are respectively transformed into competent cells, cultured, and four corresponding cell suspensions are obtained respectively; the four cell suspensions are mixed and injected into the leaves of the plant, cultured, and caproic acid is injected into the same position of the leaves of the plant;

[0029] Continue to cultivate the plants and take samples for compound detection and analysis.

[0030] Compared with the prior art, the present invention is beneficial in that the activity of the olivetol synthase mutant provided by the present invention is significantly changed compared with the wild-type olivetol synthase. I207A ,OLS F208A ,OLS L261A and OLS G299A The activity of OLS was significantly weakened. H262A The activity of olive alcohol synthase was significantly enhanced. These different olive alcohol synthase mutants can effectively regulate the synthesis of olive acid OA, thereby regulating 3,5.7-trioxodecanoy1-CoA, olive acid, cannabidiol, cannabinoid acid, cannabidiol, Δ 9 -The synthesis of tetrahydrocannabinol and other products has laid a technical foundation for the industrial production and application of olive alcohol synthase mutants and for regulating the production of biosynthetic cannabidiol. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] Figure 1This is a diagram of the synthetic pathway of cannabinoids. Multiple arrows represent multi-step reactions involving multiple enzymes, the blue box represents the fatty acid pathway, and the green box represents the terpene pathway.

[0032] Figure 2 The secondary spectrum of Glc-OA in the sample detected by LC-MS.

[0033] Figure 3 The figure shows the comparison of the yield of the mutants with significant yield difference screened in the example with that of the wild-type OLS; wherein WT is the wild-type and the others are OLS point mutants. DETAILED DESCRIPTION

[0034] The technical solution of the present invention will be described clearly and completely below. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0035] The terms used in the present invention are as follows.

[0036] Mutant: refers to a polypeptide having OLS activity, comprising an alteration (i.e., substitution, insertion and / or deletion) at one or more (e.g., several) positions. Substitution means replacing the amino acid occupying a position with a different amino acid; deletion means removing the amino acid occupying a position; and insertion means adding an amino acid adjacent to and immediately following the amino acid occupying a position.

[0037] Coding sequence, means a polynucleotide that directly specifies the amino acid sequence of OLS or OLS mutant. The boundaries of the coding sequence are usually determined by an open reading frame, which begins with a start codon (e.g., ATG, GTG, or TTG) and ends with a stop codon (e.g., TAA, TAG, or TGA). The coding sequence can be genomic DNA, cDNA, synthetic DNA, or a combination thereof.

[0038] Expression: The term "expression" includes any step involved in the production of OLS or an OLS mutant including, but not limited to, transcription, post-transcriptional modification, translation, post-translational modification, and secretion.

[0039] The reagents and consumables used in the following specific implementations are shown in Table 1, and the instruments and equipment are shown in Table 2.

[0040] Table 1

[0041] name Manufacturer 2×BioRun Magic PCR Mix(#RAA00) Biorun 2×Biorun Pfu PCR Mix (#RBC00) Biorun BioRun Seamless Cloning Kit(#RDA01) Biorun Competent cells Biorun Magic Ruler DNA marker(#RBA00) Biorun BsmBI(#RCA01) Biorun BsaI(#RCA02) Biorun BbsI(#RCA03) Biorun EcorV NEB DNA Gel Recovery Kit Axygen NaCl Sigma Yeast Extract Sigma Tryptone Sigma

[0042] Table 2

[0043]

[0044]

[0045] like Figure 1 The synthetic pathway diagram of cannabinoids shown, the blue box represents the fatty acid pathway and the green box represents the terpene pathway. Figure 1 In the process, AAE1 converts hexanoic acid into hexanoyl-CoA, and OLS catalyzes the condensation of one molecule of hexanoyl-CoA and three molecules of malonyl-CoA to form the intermediate 3,5.7-trioxodecanoy1-CoA, which is cyclized by OAC to produce olivetate OA. Subsequently, OA reacts with GPP under the action of PT4 to produce cannabinoid acid CBGA. CBGA produces Δ 9 -Tetrahydrocannabinol, or CBGA, produces cannabidiol CBD under the action of CBDAS and ΔT respectively.

[0046] In addition, endogenous glycosylases in tobacco can glycosylate OA to generate glycosylated OA (Glucosylated OA, Glc-OA). Therefore, in a specific embodiment of the present invention, the catalytic activity of the wild-type olive alcohol synthase or olive alcohol synthase mutant can be ultimately obtained by detecting the content of Glc-OA in tobacco.

[0047] The olive alcohol synthase mutant provided by the present invention is OLS I207A ,OLS F208A ,OLS L261A ,OLS H262A ,OLS G299A Any of the following;

[0048] Compared with the sequence shown in SEQ ID NO.1, the OLS I207A The isoleucine at position 207 is replaced by alanine. F208A The phenylalanine at position 208 is replaced by alanine. L261A The 261st leucine is replaced by alanine, and the OLS H262A The 262nd histidine is replaced by alanine, and the OLS G299A It means that the glycine at position 299 is replaced by alanine.

[0049] OLS H262A For the object, OLS is performed H262A The construction of and the experiment of using it to synthesize Glc-OA.

[0050] Example 1: Olivine alcohol synthase mutant OLSH262A Construction of recombinant expression plasmid

[0051] Homologous recombination was used to construct a plasmid expressing olivetol synthase mutant OLS using pBWA(V)BS-CsOLS-HotShockT as a template and pBWA(V)BS-ccdB-HotShockT as a base vector. H262A The recombinant expression plasmid pBWA(V)BS-35S-OLSH262A-HotShockT has a nucleotide sequence as shown in SEQ ID NO. 7. The specific method is as follows.

[0052] 1. OLSH262A cloning

[0053] OLSH262A amplification primers are as follows:

[0054] 11487-1(C+): ggagagaacacgggggactttgcaacatgaatcatcttcgtgctgaggg, as shown in SEQ ID NO.8.

[0055] 11487-1(C-): aggcacatccttagctaaatcaaatatc, as shown in SEQ ID NO.9

[0056] 11487-2(C+): gatatttgatttagctaaggatgtgcct, as shown in SEQ ID NO.10

[0057] 11487-2(C-):cagtactgaagacagagctagttacattaatatttgatgggaacactacgcacg, as shown in SEQ ID NO.11

[0058] The PCR system is shown in Table 1 below.

[0059] Table 1

[0060] Element volume Nuclease-free Water 20μL Biorun Pfu PCR Mix 25μL Primer(+)(100uM) 2μL Primer(-)(100uM) 2μL Template 1μL Total volume 50μL

[0061] The PCR reaction program is shown in Table 2 below.

[0062] Table 2

[0063]

[0064] Use 1% agarose gel electrophoresis at 5V / cm for 20min. Cut out the electrophoretic fragments of the target size band under ultraviolet light and place them in a system for sol recovery. The recovery procedure is specified in the manufacturer's kit instructions. Use a total volume of 40uL of water to dissolve and recover the DNA. After testing, recombinate with the vector.

[0065] 2. Vector digestion: The digestion and ligation system is shown in Table 3. The reaction conditions are incubation at 37°C for 1 hour. The vector digestion product is purified using a PCR purification kit and used for the recombination reaction.

[0066] Table 3

[0067] Element volume Nuclease-free Water 13μL 10×Buffer 2μL Eco31I 1μL pBWA(V)BS-ccdB HotShockT 4μL Total 20μL

[0068] 3. Recombination reaction: The reaction system is shown in Table 4. The reaction conditions are incubation at 37°C for 30 min.

[0069] Table 4

[0070] Element volume Biorun 2×EasyClone Mix 10uL rDNAO1 5uL pBWA(V)BS-ccdB-HotShockT 5uL Total 20uL

[0071] 4. Transformation: Transform 5-10 μL of the incubated ligation product into competent E. coli and transform into a Kanamycin-resistant plate; culture at 37°C for 12 h.

[0072] 5. Plaque PCR identification: Pick 10 plaques and perform 1.5mL EP tube inoculation and PCR identification at the same time.

[0073] Amplification primer 35S-seq: ttcatttggagagaacacgggggac, as shown in SEQ ID NO.12.

[0074] Amplified D11487 (579C): catcaccaaagatagcttgtcc, as shown in SEQ ID NO.13.

[0075] PCR system: 10 25 μL PCR reactions were performed. The reaction system and reaction procedure are shown in Tables 5 and 6 below.

[0076] Table 5

[0077] Element volume Nuclease-free Water 9.5μL Biorun Magic PCR Mix 12.5μL 35S-seq (100uM) 1μL D11487(579C)(100uM) 1μL Template 1μL Total volume 25μL

[0078] Table 6

[0079]

[0080] Randomly take 1-3 positive bands corresponding to the bacterial solution, take 100μL sample for sequencing, and inoculate the remaining 400μL bacterial solution into 5-10ml Kanamycin resistant LB, and shake the test tube. After the sequencing results come out, take a tube of bacterial solution with correct sequencing, extract the plasmid, and name the plasmid pBWA(V)BS-35S-OLS H262A -HotShockT, the nucleotide sequence is shown in SEQ ID NO.7).

[0081] Example 2: Olivine alcohol synthase mutant OLS H262A Transient expression of tobacco to synthesize Glc-OA

[0082] In this example, Glc-OA was used as the detection object. By detecting the production of Glc-OA, the olive alcohol synthase mutant OLS was indirectly tested and verified. H262A The specific steps are as follows.

[0083] 1. Tobacco cultivation: sow some tobacco seeds, cultivate them under 12 hours of light, and they can be used in experiments after one month of cultivation.

[0084] 2. Agrobacterium culture: The constructed expression plasmids AAE1, OAC, and OLSH262A were transferred into Agrobacterium GV3101 by electroporation and cultured at 30°C for 2 days.

[0085] 3. Suspended Agrobacterium: Use an inoculation loop to scrape the Agrobacterium from the solid culture dish, inoculate it into 10 mL YEB liquid culture medium, and culture it at 170 rpm / min for 1 hour.

[0086] 4. Collect bacteria: centrifuge at 4000 rpm / min for 4 min and remove the supernatant.

[0087] 5. Resuspension: Resuspend the cells with 10 mM MgCl2 (containing 120 μM AS) suspension and adjust the OD600 to about 0.2.

[0088] 6. Agrobacterium injection: Before injection, the AAE1, OAC, and OLS H262A The suspension of expression plasmid was mixed in a ratio of 1:1:1. Select tobacco plants with good growth conditions, inject from the lower epidermis of tobacco leaves with a 1 mL syringe without a pipette tip, and mark them.

[0089] 7. Substrate injection: The injected tobacco plants were cultured under weak light for 2 days, injected with 1 mM caproic acid, and samples were taken and weighed after 24 hours.

[0090] 8. Compound extraction: Add 500 μL of 70% methanol to every 100 mg of leaves, add steel beads at 60 Hz, grind twice for 30 seconds. After sufficient grinding, ultrasonicate for 20 minutes at low temperature, and then centrifuge at 4°C, 12000 rpm for 10 minutes. Take the supernatant and filter it with a 0.22 μM filter, take the supernatant and put it into a sample bottle, freeze it in a -80°C refrigerator until detection.

[0091] 9. The Glc-OA content in the extract was analyzed by LC-MS detection method. The HPLC detection method is shown in Tables 7 and 8 below.

[0092] Table 7

[0093] instrument Orbitrap Exploris 120 Analytical columns Thermo hypersil gold C18(1.9μm, 2.1×10mm) Column temperature 40℃ Mobile phase A 5 mM ammonium acetate water Mobile phase B Acetonitrile Injection volume 2uL Flow rate 0.3mL / min

[0094] Table 8

[0095] Time / min Mobile phase A / % Mobile phase B / % 0 95 5 6 72 28 11 0 100 13 0 100 13.1 95 5 15 95 5

[0096] The Glc-OA content in the OLS mutant samples was analyzed by LC-MS.

[0097] Figure 2 It is the secondary spectrum of Glc-OA.

[0098] The present invention also uses the same method to construct an expression of olive alcohol synthase mutant OLS I207A ,OLS F208A ,OLS L261A and OLS G299A The recombinant expression plasmids were used to express Glc-OA in tobacco by the same method using the four olive alcohol synthase mutants. The wild type olive alcohol synthase OLS was used as a control.

[0099] Test results such as Figure 3 As shown in Figure 2, it can be seen that when the five olive alcohol synthase mutants produced Glc-OA, the yield of Glc-OA changed significantly, among which OLS H262A The content of Glc-OA generated by catalysis increased by 228.12%. I207A ,OLS F208A ,OLS L261A and OLS G299A The contents of Glc-OA generated by catalysis decreased by 81.89%, 83.94%, 84.53% and 89.40% respectively. It can be seen that the five olive alcohol synthase mutants with different catalytic activities provided by the present invention can effectively regulate the synthesis of olivetide OA, and then regulate the synthesis of 3,5.7-trioxodecanoy1-CoA, olivetide, cannabinoid acid, cannabidiol, Δ 9 -Synthesis of products such as tetrahydrocannabinol.

[0100] The above specific embodiments describe the implementation of the present invention in detail, but the present invention is not limited to the specific details in the above embodiments. Within the scope of the claims and technical concept of the present invention, the technical solution of the present invention can be modified and changed in many simple ways, and these simple modifications all belong to the protection scope of the present invention.

Claims

1. An olive alcohol synthase mutant, It is characterized in that The olive alcohol synthase mutant is OLS I207A ,OLS F208A ,OLS L261A ,OLS H262A ,OLS G299A Any of the following: Compared with the amino acid sequence shown in SEQ ID NO.1, the OLS I207A The isoleucine at position 207 is replaced by alanine. F208A The phenylalanine at position 208 is replaced by alanine. L261A The 261st leucine is replaced by alanine, and the OLS H262A The 262nd histidine is replaced by alanine, and the OLS G299A It means that the glycine at position 299 is replaced by alanine.

2. A nucleic acid molecule, It is characterized in that The nucleic acid molecule is used to encode the olive alcohol synthase mutant according to claim 1.

3. The nucleic acid molecule according to claim 2, It is characterized in that The nucleotide sequence encoding the olive alcohol synthase mutant is shown in SEQ ID NO.2-6.

4. A biomaterial, It is characterized in that The biological material comprises the nucleic acid molecule according to any one of claims 2 to 3, or is used to express the olive alcohol synthase mutant according to claim 1; the biological material is an expression cassette, a vector or a host cell.

5. An engineered bacterium, It is characterized in that The engineered bacteria is used to express the olive alcohol synthase mutant described in claim 1.

6. An application of the olivetol synthase mutant according to claim 1, or the nucleic acid molecule according to any one of claims 2-3, or the biomaterial according to claim 4, or the engineered bacteria according to claim 5, It is characterized in that Used to regulate the synthesis of metabolites in plants, or to regulate the yield of in vitro synthesized metabolites; the metabolites are 3,5.7-trioxodecanoy1-CoA, olive acid, cannabidiol, cannabinoid acid, 9 -At least one of tetrahydrocannabinol.

7. A method for synthesizing an olivetol synthase mutant, It is characterized in that The olivetol synthase mutant is synthesized by using the biological material described in claim 4; or the engineered bacteria described in claim 5 are cultured to obtain the olivetol synthase mutant.

8. A method for producing cannabigerolic acid and / or cannabidiol, It is characterized in that The olivetol synthase mutant OLS of claim 1 H262A contacting with a substrate to obtain cannabigerolic acid and / or cannabidiol; Alternatively, the olivetol synthase mutant OLS is expressed H262A The engineered bacteria are transfected into plants, the plants are cultured and cannabinoid acid and / or cannabidiol are extracted.

9. A method for detecting the catalytic activity of olivetol synthase or olivetol synthase mutant, It is characterized in that The following steps are involved: Constructing recombinant expression vectors of the genes AAE1, OAC, and OLS required for olivetate synthesis, and a recombinant expression vector containing a gene sequence encoding the olivetol synthase mutant according to claim 1; The four recombinant expression plasmids are respectively transformed into competent cells, cultured, and four corresponding cell suspensions are obtained respectively; the four cell suspensions are mixed and injected into the leaves of the plant, cultured, and caproic acid is injected into the same position of the leaves of the plant; Continue to cultivate the plants and take samples for compound detection and analysis.

Images