Thermomyces lanuginosus lipase mutant and application thereof

Abstract

The invention discloses a thermomyces lanuginosus lipase mutant and application of the thermomyces lanuginosus lipase mutant. The amino acid sequence of the mutant is shown as SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4 or SEQ ID NO.5, the mutant is obtained when proline at the 256th position of thermomyces lanuginosus wild type lipase is mutated into alanine, isoleucine, lysine or glutamic acid, compared with the wild type lipase, the optimum temperature of the mutant is remarkably increased, besides the lipase mutant mutated into glutamic acid, the optimum temperature of the mutant is increased, and the optimum temperature of the mutant is increased. The relative enzyme activity of the mutant after heat tolerance is also improved, which indicates that the obtained mutant has ideal heat resistance, the heat stability is obviously improved, a foundation is identified for industrial application, and the mutant has obvious application value.

Description

Technical Field

[0001] The invention relates to the technical field of gene engineering and enzyme engineering, and in particular to a Thermomyces lanuginosus lipase mutant and a preparation method and application thereof. Background Art

[0002] Lipase (EC3.1.1.3) has the function of hydrolyzing triglycerides into free fatty acids and glycerol, and can also catalyze reactions such as ester synthesis, transesterification, acidolysis, aminolysis and alcoholysis. The diversity of its functions determines that lipase is widely used in food processing, feed, organic synthesis, fine chemicals and biodiesel. Due to the needs of industrial application environments, the requirements for the high temperature resistance of lipase are getting higher and higher, but the high temperature resistance of conventional lipases is relatively weak. Therefore, it is necessary to design a lipase with excellent high temperature resistance to meet the needs of industrial applications.

[0003] Thermomyces lanuginosus is a fungus with a high growth temperature limit and thermophilicity, which is widely found in nature. The lipase contained in it also has relatively good heat resistance and is widely used in various industrial fields. However, at present, the high temperature resistance of the lipase from T. lanuginosus is still difficult to fully meet the needs of industrial applications. Summary of the invention

[0004] The purpose of the present invention is to provide a mutant of Thermomyces lanuginosus lipase, so as to solve the problem of poor high temperature tolerance of wild-type lipase, make up for the limitations of existing Thermomyces lanuginosus lipase in industrial production applications, and provide a basis for the industrial application of lipase.

[0005] In order to achieve the above object, the present invention provides a Thermomyces lanuginosus lipase mutant, the amino acid sequence of the mutant is shown in SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4 or SEQ ID NO.5, and the specific sequences are as follows:

[0006] Among them, the lipase mutant P256A with an amino acid sequence as SEQ ID NO.2 is obtained by mutating the proline (P) at position 256 in the wild-type Thermomyces lanuginosus lipase with an amino acid sequence as SEQ ID NO.1 to alanine (A), and the nucleotide sequence of the mutant is shown in SEQ ID NO.7. Its optimum temperature is 10°C higher than that of the wild-type lipase, and its relative residual enzyme activity at 80°C for 60 minutes is 59.98%;

[0007] The lipase mutant P256I with an amino acid sequence as shown in SEQ ID NO.3 is obtained by mutating the proline (P) at position 256 in the wild-type Thermomyces lanuginosus lipase with an amino acid sequence as shown in SEQ ID NO.1 to alanine (I). The nucleotide sequence of the mutant is shown in SEQ ID NO.8. The optimum temperature of the mutant is 5°C higher than that of the wild-type lipase, and the relative residual enzyme activity of the mutant at 80°C for 60 minutes is 64.25%;

[0008] The lipase mutant P256K with an amino acid sequence as shown in SEQ ID NO.4 is obtained by mutating the proline (P) at position 256 in the wild-type Thermomyces lanuginosus lipase with an amino acid sequence as shown in SEQ ID NO.1 to alanine (K). The nucleotide sequence of the mutant is shown in SEQ ID NO.9. The optimum temperature of the mutant is 10°C higher than that of the wild-type lipase, and the relative residual enzyme activity of the mutant at 80°C for 60 minutes is 55.69%;

[0009] The lipase mutant P256E with an amino acid sequence as shown in SEQ ID NO.5 is obtained by mutating the proline (P) at position 256 in the wild-type Thermomyces lanuginosus lipase with an amino acid sequence as shown in SEQ ID NO.1 to alanine (E). The nucleotide sequence of the mutant is shown in SEQ ID NO.10. The optimum temperature of the mutant is 10°C higher than that of the wild-type lipase, and the relative residual enzyme activity of the mutant at 80°C for 60 minutes is 42.24%;

[0010] The optimum temperature of the wild-type lipase is 40°C, and its relative residual enzyme activity is 43.28% when it is subjected to 80°C for 60 min.

[0011] The present invention also provides a recombinant vector comprising the coding gene of the lipase mutant.

[0012] The present invention also provides an expression bacterium comprising the coding gene of the lipase mutant.

[0013] The present invention also provides a method for preparing the above lipase mutant, comprising the following steps:

[0014] S1. Connecting the wild-type lipase encoding gene with the nucleotide sequence shown in SEQ ID NO.6 to an expression vector to obtain a recombinant vector containing the wild-type lipase encoding gene;

[0015] S2. Using the recombinant vector obtained in S1 as a template, four pairs of site mutation primers with nucleotide sequences such as SEQ ID NO.11-12, SEQ ID NO.13-14, SEQ ID NO.15-16 or SEQ ID NO.17-18 are used for mutation amplification to obtain a recombinant expression plasmid containing a gene encoding a lipase mutant;

[0016] S3. The recombinant expression plasmid obtained in S2 is transferred into the expression bacteria, expressed and purified to obtain the lipase mutant.

[0017] Preferably, the expression vector in the above preparation method is pPIC9K.

[0018] Preferably, the expression bacteria in the above preparation method is GS115 yeast.

[0019] The preparation method provided by the present invention can be applied to the preparation of lipase mutants.

[0020] The lipase mutant provided by the present invention can be applied in the field of food processing, especially in food fermentation.

[0021] The Thermomyces lanuginosus lipase mutant and its application provided by the present invention solve the problem of poor high temperature tolerance of wild-type lipase and have the following advantages:

[0022] The lipase mutation site provided by the present invention, the lipase mutants P256A, P256I, P256K, P256E mutated at the site and the wild-type lipase are tolerant to high temperatures. The optimum temperature after mutation is higher than that of the wild-type, and the relative residual enzyme activity after mutation is higher than that of the wild-type. The optimum temperatures of the mutants P256A, P256I, P256K, and P256E are 50°C, 45°C, 50°C, and 50°C, which are 10°C, 5°C, 10°C, and 10°C higher than the optimum temperature of the wild-type lipase, respectively. The Tm values ​​of the mutants P256A, P256I, P256K, and P256E were measured to be 94.23°C, 95.66°C, 95.45°C, and 95.84°C, respectively. After the mutants P256A, P256I, P256K, and P256E were subjected to 80°C for 60 min, the relative enzyme activities of the mutants P256A, P256I, P256K, and P256E remained 59.98%, 64.25%, 55.69%, and 42.24%, respectively. Compared with the wild-type lipase, the relative enzyme activities of P256A, P256I, and P256K increased by 16.70%, 20.97%, and 12.41% after being subjected to 80°C for 60 min, respectively, while the relative enzyme activity of P256E after being subjected to 80°C for 60 min was less different from that of the wild-type lipase (reduced by 1.04%). This indicates that after the optimum temperature is increased, the thermal stability of the lipase mutants P256A, P256I, P256K, and P256E has achieved an unexpected effect compared with the wild-type, filling the limitations of lipase in industrial production applications and providing a multi-layer guarantee foundation for the industrial application of lipase. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 This is a graph showing the optimum temperatures for the wild-type lipase of the present invention and its mutant P256A.

[0024] Figure 2 This is a temperature tolerance measurement chart of the wild-type lipase of the present invention and its mutant P256A.

[0025] Figure 3 This is a graph showing the optimum temperatures for the wild-type lipase of the present invention and its mutant P256I.

[0026] Figure 4 This is a temperature tolerance measurement chart of the wild-type lipase of the present invention and its mutant P256I.

[0027] Figure 5 This is a graph showing the optimum temperatures of the wild-type lipase and its mutant P256K of the present invention.

[0028] Figure 6 This is a temperature tolerance measurement chart of the wild-type lipase of the present invention and its mutant P256K.

[0029] Figure 7 This is a graph showing the optimum temperatures for the wild-type lipase of the present invention and its mutant P256E.

[0030] Figure 8 This is a temperature tolerance measurement chart of the wild-type lipase of the present invention and its mutant P256E. DETAILED DESCRIPTION

[0031] The technical solutions in the embodiments of the present invention are described clearly and completely below. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0032] The experimental materials and reagents used in the experimental examples of the present invention are as follows:

[0033] 1. Strains and vectors: The recombinant strain containing wild-type Thermomyces lanuginosus lipase and the GS115 yeast expression strain were provided by the Key Laboratory of Enzyme Engineering of Yunnan Normal University. The gene of the wild-type lipase was connected to the plasmid pPIC9K, and the recombinant strain was transferred with the recombinant vector of the connected gene; the pPIC9K expression vector was purchased from Invitrogen, USA; the DMT cloning strain was purchased from Beijing Quanshijin Biotechnology Co., Ltd.

[0034] 2. Main reagents: site-directed mutagenesis kit Fast Mutagenesis System (purchased from Beijing Quanshijin Biological Company); plasmid extraction kit Plasmid Mini Kit I (purchased from Omega Company, USA).

[0035] 3. Main culture medium:

[0036] LB medium: 0.5% yeast powder, 1% peptone, 1% NaCl, natural pH (about 7), solid medium plus 2% (w / v) agar.

[0037] Note: The molecular biology experimental methods not specifically described in the following examples are all carried out with reference to the specific methods listed in the book Molecular Cloning Experiment Guide (3rd Edition) by J. Sambrook, or according to the kits and product instructions.

[0038] Experimental Example 1 Preparation of lipase mutants

[0039] (1) A recombinant plasmid pPIC9K containing a wild-type lipase gene was extracted from a recombinant strain containing a wild-type Thermomyces lanuginosus lipase using a plasmid extraction kit PlasmidMini Kit I. Four pairs of mutation primers were designed according to the wild-type lipase gene sequence as shown in SEQ ID NO.6. The four pairs of mutation primers were used to perform site-directed mutagenesis amplification on the extracted recombinant plasmid pPIC9K using a site-directed mutagenesis kit Fast Mutagenesis System. The amino acid sequence corresponding to the wild-type lipase gene as shown in SEQ ID NO.6 is shown in SEQ ID NO.1.

[0040] The sequences of the above four pairs of mutation primers are as follows (all 5'→3'):

[0041] F-P256A (SEQ ID NO.11):

[0042] CCTAACATTCCTGATATCGCTGCCCACCTATG;

[0043] R-P256A (SEQ ID NO.12):

[0044] AGCGATATCAGGAATGTTAGGCTGGTTGTTTCC;

[0045] F-P256I (SEQ ID NO.13):

[0046] CCTAACATTCCTGATATCATTGCCCACCTATG;

[0047] R-P256I (SEQ ID NO.14):

[0048] AATGATATCAGGAATGTTAGGCTGGTTGTTTCC;

[0049] F-P256K (SEQ ID NO.15):

[0050] CCTAACATTCCTGATATCAAGGCCCACCTATG;

[0051] R-P256K (SEQ ID NO.16):

[0052] CTTGATATCAGGAATGTTAGGCTGGTTGTTTCC;

[0053] F-P256E (SEQ ID NO.17):

[0054] CCTAACATTCCTGATATCGAGGCCCACCTATG;

[0055] R-P256E (SEQ ID NO.18):

[0056] CTCGATATCAGGAATGTTAGGCTGGTTGTTTCC;

[0057] The PCR reaction system is as follows:

[0058]

[0059] The PCR reaction parameters are as follows:

[0060] Pre-denaturation at 94°C for 5 min, denaturation at 94°C for 30 sec, annealing at 55°C for 30 sec, extension at 72°C for 1.5 min, and after 30 cycles, incubation at 72°C for 10 min.

[0061] Among them, the primer pair F-P256A and R-P256A can mutate the wild-type lipase gene with a nucleotide sequence as shown in SEQ ID NO.6 into a lipase mutant gene with a nucleotide sequence as shown in SEQ ID NO.7 through amplification.

[0062] The primer pair F-P256I and R-P256I can mutate the wild-type lipase gene with a nucleotide sequence as shown in SEQ ID NO.6 into a lipase mutant gene with a nucleotide sequence as shown in SEQ ID NO.8 through amplification.

[0063] The primer pair F-P256K and R-P256K can mutate the wild-type lipase gene with a nucleotide sequence as shown in SEQ ID NO.6 into a lipase mutant gene with a nucleotide sequence as shown in SEQ ID NO.9 through amplification.

[0064] The primer pair F-P256E and R-P256E can mutate the wild-type lipase gene with a nucleotide sequence as shown in SEQ ID NO.6 into a lipase mutant gene with a nucleotide sequence as shown in SEQ ID NO.10 through amplification.

[0065] (2) After the four pairs of primers were amplified, the amplified products were transferred into the DMT competent cells by heat shock method, spread on LB culture plates with resistance, and cultured in a 37°C incubator overnight.

[0066] (3) The next day, single colonies were randomly picked from the plates, marked and sent for sequencing, and the colonies that were successfully sequenced were selected as the single colonies with successful mutations, thus obtaining strains that could express the above four lipase mutants.

[0067] (4) The above four lipase mutant strains were routinely cultured, their recombinant plasmids were extracted, the recombinant plasmids were electrotransformed into the host bacteria GS115 for heterologous expression, and the lipase mutants were purified. The amino acid sequence of the lipase mutant P256A is shown in SEQ ID NO.2, the amino acid sequence of the lipase mutant P256I is shown in SEQ ID NO.3, the amino acid sequence of the lipase mutant P256K is shown in SEQ ID NO.4, and the amino acid sequence of the lipase mutant P256E is shown in SEQ ID NO.5.

[0068] Experimental Example 2 Determination of the Optimal Temperature of Lipase

[0069] The optimal temperatures of the wild-type lipase (TLL) and the four lipase mutants (P256A, P256I, P256K, and P256E) obtained in Experimental Example 1 were determined according to the lipase activity assay method. Under the optimal pH conditions, the reaction system was placed at different temperatures (30°C, 40°C, 45°C, 50°C, 55°C, 60°C, 70°C, and 80°C) for reaction.

[0070] The optimum temperature of the enzymatic reaction of the lipase mutant is Figure 1 , Figure 3 , Figure 5 , Figure 7 As shown, the optimum temperatures of the Thermomyces lanuginosus lipase mutants P256A, P256I, P256K, and P256E are 50°C, 45°C, 50°C, and 50°C, respectively, which are 10°C, 5°C, 10°C, and 10°C higher than that of the wild-type lipase. The Tm values ​​of the mutants P256A, P256I, P256K, and P256E were measured to be 94.23°C, 95.66°C, 95.45°C, and 95.84°C, respectively. The difference is small or even larger than that of the wild-type lipase Tm value.

[0071] Experimental Example 3 Lipase Temperature Tolerance Determination

[0072] The enzyme solution was diluted to the corresponding multiples, and then placed at 80°C for 1min, 3min, 5min, 7min, 10min, 15min, 20min, 25min, 30min, 45min, and 60min. After that, it was reacted at the optimal pH and optimal temperature according to the lipase activity assay method to determine the tolerance of the wild-type lipase (TLL) and four lipase mutants (P256A, P256I, P256K, and P256E).

[0073] Temperature tolerance of lipase at high temperature Figure 2 , Figure 4 , Figure 6 , Figure 8 As shown, the relative enzyme activity of lipase gradually decreased with the increase of time. The relative enzyme activities of mutants P256A, P256I, P256K and P256E remained 59.98%, 64.25%, 55.69% and 42.24% respectively after being tolerated at 80℃ for 60min. Compared with the wild-type lipase, the relative enzyme activities of mutants P256A, P256I and P256K increased by 16.70%, 20.97% and 12.41% respectively after being tolerated at 80℃ for 60min, and the relative enzyme activity of P256E decreased by 1.04% after being tolerated at 80℃ for 60min. It shows that after the optimum temperature is raised, the thermal stability of the lipase mutants P256A, P256I, and P256K reaches an unexpected result compared with the wild type, and this lipase mutant with improved thermal stability can be used in industrial production, including food fermentation, organic synthesis, etc., and has great application value.

[0074] Although the content of the present invention has been described in detail through the above preferred embodiments, it should be appreciated that the above description should not be considered as a limitation of the present invention. After reading the above content, it will be apparent to those skilled in the art that various modifications and substitutions of the present invention will occur. Therefore, the protection scope of the present invention should be limited by the appended claims.

Claims

1. A mutant of Thermomyces lanuginosus lipase, characterized in that: The amino acid sequence of the mutant is shown in SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4 or SEQ ID NO.

5.

2. The gene encoding the lipase mutant according to claim 1, characterized in that: The mutant whose amino acid sequence is shown as SEQ ID NO.2, and the nucleotide sequence of its encoding gene is shown as SEQ ID NO.7; the mutant whose amino acid sequence is shown as SEQ ID NO.3, and the nucleotide sequence of its encoding gene is shown as SEQ ID NO.8; the mutant whose amino acid sequence is shown as SEQ ID NO.4, and the nucleotide sequence of its encoding gene is shown as SEQ ID NO.9; the mutant whose amino acid sequence is shown as SEQ ID NO.5, and the nucleotide sequence of its encoding gene is shown as SEQ ID NO.

10.

3. A recombinant vector comprising the coding gene as claimed in claim 2.

4. An expression bacterium comprising the coding gene as claimed in claim 2.

5. A method for preparing the lipase mutant according to claim 1, characterized in that: The following steps are included: S1. Connecting the wild-type lipase encoding gene with the nucleotide sequence shown in SEQ ID NO.6 to an expression vector to obtain a recombinant vector containing the wild-type lipase encoding gene; S2. Using the recombinant vector obtained in step S1 as a template, four pairs of site mutation primers with nucleotide sequences such as SEQ ID NO.11-12, SEQ ID NO.13-14, SEQ ID NO.15-16 or SEQ ID NO.17-18 are used to perform mutation amplification respectively to obtain a recombinant expression plasmid containing a mutant encoding gene; S3. The recombinant expression plasmid obtained in S2 is transferred into the expression bacteria, expressed and purified to obtain the lipase mutant as described in claim 1.

6. The preparation method according to claim 5, characterized in that: The expression vector is pPIC9K.

7. The preparation method according to claim 5, characterized in that: The expression bacteria is GS115 yeast.

8. Use of the lipase mutant as claimed in claim 1 in the field of food processing.

9. The use according to claim 8, characterized in that: The food processing includes food fermentation.

Images