SNP (Single Nucleotide Polymorphism) molecular marker related to attention deficit and hyperactivity disorder as well as detection reagent and application of SNP molecular marker

Abstract

The invention relates to the technical field of molecular markers, in particular to an attention deficit and hyperactivity disorder related SNP molecular marker and a detection reagent and application thereof. According to the invention, the SNP molecular marker having significant correlation with attention deficit and hyperactivity disorder is found, and the SNP molecular marker can be used as a target for attention deficit and hyperactivity disorder detection and disease risk assessment; other SNP molecular markers related to attention deficit and hyperactivity disorder can be combined for detection and disease risk assessment of attention deficit and hyperactivity disorder, and effective means and methods are provided for early prediction and diagnosis of attention deficit and hyperactivity disorder and more accurate genetic detection and analysis.

Description

Technical Field

[0001] The present invention relates to the technical field of molecular markers, and in particular to a SNP molecular marker related to attention deficit hyperactivity disorder and a detection reagent and application thereof. Background Art

[0002] Attention deficit and hyperactivity disorder (ADHD), commonly known as ADHD, refers to a group of syndromes that occur in children and are characterized by obvious difficulty in concentration, short attention span, hyperactivity or impulsivity compared with children of the same age. ADHD often develops in childhood, most of which begin to appear in the preschool period. It is mainly divided into two types: childhood and adolescent ADHD and adult ADHD. The cause of ADHD is not yet clear, but it is generally believed to be the combined influence of multiple factors such as genetics and environment.

[0003] Studies have shown that ADHD is highly heritable. In genetic studies of ADHD, SNPs associated with ADHD have been discovered through methods such as genome-wide association analysis (GWAS). However, the genetic structure of ADHD is complex, involving micro-effect variants of multiple genes. These micro-effect genes are enriched under specific functional categories and may play a significant role in the onset of ADHD. Therefore, it is necessary to develop more SNPs associated with ADHD to facilitate the elucidation of the pathogenesis of ADHD and early prediction and diagnosis. Summary of the invention

[0004] The invention provides a SNP molecular marker related to attention deficit and hyperactivity disorder and a detection reagent and application thereof.

[0005] The present invention found that the SNP molecular marker rs14394 of the ELAVL1 gene is significantly correlated with attention deficit and hyperactivity disorder; rs14394 is located at position 7963660 of human chromosome 19 (reference genome is GRCh38.p14), and the polymorphism is A>G / A>T. The present invention found that the G allele frequency of the SNP molecular marker rs14394 in the attention deficit and hyperactivity disorder population was significantly higher than that in the healthy population by sequencing a large number of SNP molecular markers on a large number of healthy population samples and attention deficit and hyperactivity disorder population samples; compared with the healthy population, the AG genotype frequency of this site was significantly increased in the attention deficit and hyperactivity disorder population. Therefore, the SNP molecular marker rs14394 of the ELAVL1 gene can be used as a target for attention deficit and hyperactivity disorder detection or disease risk assessment.

[0006] Specifically, the present invention provides the technical solution described below.

[0007] In a first aspect, the present invention provides the use of a SNP molecular marker as a target in the preparation of a product for detecting attention deficit and hyperactivity disorder, wherein the SNP molecular marker comprises the SNP molecular marker rs14394 of the ELAVL1 gene.

[0008] In the above application, the product for detecting attention deficit and hyperactivity disorder uses the SNP molecular marker rs14394 of the ELAVL1 gene as the detection target, or the detection target of the product includes the SNP molecular marker rs14394 of the ELAVL1 gene and other SNP molecular markers related to attention deficit and hyperactivity disorder.

[0009] In a second aspect, the present invention provides the use of SNP molecular markers as targets in the preparation of products for assessing the risk of attention deficit and hyperactivity disorder, wherein the SNP molecular markers include the SNP molecular marker rs14394 of the ELAVL1 gene.

[0010] In the present invention, the SNP molecular marker may be only the SNP molecular marker rs14394, or, in addition to the SNP molecular marker rs14394, it also includes other SNP molecular markers related to attention deficit and hyperactivity disorder; wherein, other SNP molecular markers related to attention deficit and hyperactivity disorder may be any currently known SNP molecular marker related to hyperactivity disorder, or may be a newly discovered SNP molecular marker related to hyperactivity disorder.

[0011] In a third aspect, the present invention provides use of a detection reagent for a SNP molecular marker in the preparation of a product for detecting attention deficit and hyperactivity disorder, wherein the SNP molecular marker comprises the SNP molecular marker rs14394 of the ELAVL1 gene.

[0012] In a fourth aspect, the present invention provides the use of a detection reagent for a SNP molecular marker in the preparation of a product for assessing the risk of attention deficit and hyperactivity disorder, wherein the SNP molecular marker includes the SNP molecular marker rs14394 of the ELAVL1 gene.

[0013] In the above application, the detection reagent can be any specific detection reagent for detecting the SNP molecular marker, including detection primers, detection probes, kits, detection chips, etc.

[0014] Preferably, the detection reagent is a detection primer and / or a probe.

[0015] In some embodiments of the present invention, the detection primers include primers with nucleotide sequences as shown in SEQ ID NO.1-2.

[0016] Genotyping of SNP molecular markers is a routine technology in the art. Those skilled in the art will understand that the primers shown in SEQ ID NO.1-2 are only used as examples, and the detection reagents for SNP molecular markers described in the present invention are not limited to the above primers. All primers, probes and other reagents that can perform genotyping of the SNP molecular markers are within the scope of protection of the present invention.

[0017] In the present invention, the product may be a detection reagent, a detection chip or a detection kit.

[0018] The above-mentioned detection reagent or kit may be a reagent or kit for nucleic acid sequencing (eg, second-generation sequencing or third-generation sequencing).

[0019] In a fifth aspect, the present invention provides a product for detecting attention deficit hyperactivity disorder or assessing the risk of disease, wherein the product comprises a reagent for detecting SNP molecular markers, wherein the SNP molecular markers comprise SNP molecular marker rs14394 of the ELAVL1 gene.

[0020] The above reagents for detecting SNP molecular markers are detection primers and / or probes.

[0021] Preferably, the detection primers include primers whose nucleotide sequences are shown as SEQ ID NO.1-2.

[0022] In a sixth aspect, the present invention provides the use of SNP molecular markers or detection reagents thereof in detecting attention deficit and hyperactivity disorder or assessing the risk of attention deficit and hyperactivity disorder, wherein the SNP molecular markers include the SNP molecular marker rs14394 of the ELAVL1 gene.

[0023] In a seventh aspect, the present invention provides an application of a SNP molecular marker as a drug target in screening drugs for treating attention deficit hyperactivity disorder, wherein the SNP molecular marker comprises the SNP molecular marker rs14394 of the ELAVL1 gene.

[0024] The beneficial effects of the present invention include at least: the present invention discovered a SNP molecular marker that is significantly correlated with attention deficit and hyperactivity disorder, and the SNP molecular marker can be used as a target for attention deficit and hyperactivity disorder detection and disease risk assessment, and can also be combined with other SNP molecular markers related to attention deficit and hyperactivity disorder for attention deficit and hyperactivity disorder detection and disease risk assessment, providing effective means and methods for achieving early prediction and diagnosis of attention deficit and hyperactivity disorder and more accurate genetic detection and analysis. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] In order to more clearly illustrate the technical solutions in the present invention or the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0026] Figure 1 The ELAVL1 gene SNP molecular marker in Example 1 of the present invention is significantly correlated with ADHD; wherein het represents a heterozygous genotype, and hom represents a homozygous genotype.

[0027] Figure 2 The SNP site mutation of the ELAVL1 gene in Example 2 of the present invention leads to a decrease in the expression of ELAVL1; wherein, the upper figure is the qRT-PCR test result, WT is the non-mutated ELAVL1 gene, and rs14394 is the ELAVL1 gene carrying the rs14394 site mutation; the lower figure is the Western blot test result, HIS represents His-ELAVL1, Vinculin represents the actin filament (F-actin) binding protein, and the bottom is marked as the loading amount of His-ELAVL1 (rs14394) and His-ELAVL1 (WT) in each lane.

[0028] Figure 3 Schematic diagram of the sgRNA targeting site constructed for the elavl1a gene knockout zebrafish mutant in Example 3 of the present invention, as well as the PCR amplification and enzyme digestion product electrophoresis detection results and sequencing results of the zebrafish mutant.

[0029] Figure 4 This is the detection result of the elavl1a protein level in the elavl1a gene knockout zebrafish mutant in Example 4 of the present invention.

[0030] Figure 5 and Figure 6 This is the result of detecting the hyperactive phenotype of the elavl1a gene knockout zebrafish mutant fry in Example 5 of the present invention.

[0031] Figure 7 This is the treatment result of methylphenidate on the hyperactive behavior phenotype of elavl1a gene knockout zebrafish mutant fry in Example 6 of the present invention.

[0032] Figure 8 This is the result of treating wild-type zebrafish fry with dihydrotanshinone in Example 7 of the present invention. DETAILED DESCRIPTION

[0033] In order to make the purpose, technical solution and advantages of the present invention clearer, the technical solution of the present invention will be clearly and completely described below in conjunction with the drawings of the present invention. Obviously, the described embodiments are part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0034] Example 1 The SNP molecular marker rs14394 of the ELAVL1 gene is significantly associated with ADHD

[0035] This example detects the association between the SNP molecular marker of the human ELAVL1 gene (amino acid sequence as shown in SEQ ID NO.13, accession number NP_001410.2) and ADHD. The specific method and results are as follows.

[0036] 1. Collect blood samples using EDTA anticoagulant tubes and store at 4°C to ensure no contamination during the collection process.

[0037] 2. To obtain reliable test results, blood samples should be centrifuged at 3000 g for 15 minutes within 3 hours to separate plasma, white blood cells and red blood cells, and frozen at -80°C.

[0038] 3. Extract genomic DNA from white blood cells, use specific primers for PCR amplification, use Sanger sequencing to obtain the nucleic acid sequence of the target area, and compare the SNP molecular markers to determine whether there is a mutation site.

[0039] Specifically, genomic DNA was extracted from the whole blood sample of the subject with reference to the SE Blood DNA Kit instructions of OMEGA Company, and the specific steps are as follows.

[0040] a. Take a sterile 1.5mL centrifuge tube, add 300μL of blood to be tested, and then add 900μL of cell lysis buffer.

[0041] b. Incubate at room temperature for 10 minutes (invert the tube 2-3 times to mix) to lyse red blood cells; then centrifuge at 13,000-16,000 × g for 20 seconds at room temperature.

[0042] c. Discard the supernatant as much as possible and do not stir the white precipitate; about 10-20μL of liquid will remain in the 1.5mL centrifuge tube (300μL blood sample).

[0043] d. Repeat adding cell lysis buffer, incubate at room temperature, centrifuge, and discard the supernatant.

[0044] e. Vortex vigorously until the leukocytes are resuspended (10-15 seconds).

[0045] f. Add 300 μL of nuclear lysis solution to the resuspended cell solution; use the pipette tip to aspirate and release the solution 5-6 times to lyse the white blood cells; the solution should become very viscous at this point. If cell clumps are visible after mixing, incubate the solution at 37°C until the clumps disappear.

[0046] g. Add 2 μL RNase A solution, mix well, and react at room temperature for 10 minutes.

[0047] h. Add 250 μL Buffer BL and place in a 65°C water bath for 10 minutes, shaking 3 times.

[0048] i. Add 250 μL of anhydrous ethanol and vortex.

[0049] j. Transfer the above liquid to the HiBind DNA tube provided with the kit, and then centrifuge at 8000×g at room temperature for 1 minute.

[0050] k. Add 500 μL HB buffer, centrifuge at 8000×g for 1 minute at room temperature, and discard the liquid.

[0051] l. Add 650 μL DNA Wash buffer, centrifuge at 8000×g for 1 minute at room temperature, and discard the solution.

[0052] m. Repeat l.

[0053] n. Centrifuge at 13,000 × g for 2 minutes at room temperature.

[0054] o. Place the HiBind DNA tube into a new EP tube and add 50 μL of 65°C Elution buffer; react at 65°C for 5 minutes and centrifuge at 10,000×g for 1 minute at room temperature.

[0055] p. Add 50 μL of 65℃ Elution buffer. Incubate at 65℃ for 5 minutes and centrifuge at 10,000×g for 1 minute at room temperature.

[0056] q. Finally, the EP tube contains the extracted genomic DNA.

[0057] Specifically, the PCR amplification and SNP molecular marker genotype detection methods are as follows: primers are designed according to the SNP molecular markers, and the genomic DNA extracted above is used as a template to perform polymerase chain reaction. The reaction system volume is 20 μL, and the reaction conditions are: 96℃ pretreatment for 5min, 96℃ denaturation for 30s, annealing temperature of 55℃, annealing time of 30s, 72℃ extension for 30s, a total of 35 cycles (96℃ high temperature dissociates double-stranded DNA into single strands, annealing at 55℃ allows primers to bind to the complementary region of template DNA, and medium temperature of 72℃ allows DNA polymerase to catalyze the DNA chain extension reaction with primers as the starting point), and finally 72℃ extension for 5min. PCR products are detected by 1.5% agarose gel electrophoresis (100V). The products obtained by PCR amplification are submitted to the biological company for sequence determination and analysis.

[0058] The information of some SNP molecular markers detected and the sequences of their amplification primers are as follows.

[0059] rs14394, the SNP molecular marker is located at position 7963660 of human chromosome 19 (reference genome is GRCh38.p14), and the polymorphism is A>G / A>T. The sequences of the two detection primers (5'-3') of the SNP molecular marker are: gcggatcactttcacattgg (SEQ ID NO.1); gccccaggttgtagatgaaa (SEQ ID NO.2).

[0060] rs2042920, the SNP molecular marker is located at position 7959800 of human chromosome 19 (reference genome is GRCh38.p14), and the polymorphism is A>C. The sequences of the two detection primers (5'-3') of the SNP molecular marker are: ttgcgaagtttggggacag (SEQ ID NO.3); agtaggtgaggtaggtctg (SEQ ID NO.4).

[0061] rs12983784, this SNP molecular marker is located at position 7960607 of human chromosome 19 (the reference genome is GRCh38.p14), the polymorphism is T>A / T>C, and the sequences of the two detection primers (5'-3') of this SNP molecular marker are: acactgaaaacgaaataatggc (SEQ ID NO.5); ggaagttacacacgggtcaa (SEQ ID NO.6).

[0062] rs10402477, this SNP molecular marker is located at position 7961562 of human chromosome 19 (the reference genome is GRCh38.p14), the polymorphism is C>T, and the sequences of the two detection primers (5'-3') of this SNP molecular marker are: gagcagggaccctctttt (SEQ ID NO.7); tctgggattctgtgggag (SEQ ID NO.8).

[0063] rs74369359, this SNP molecular marker is located at position 7962719 of human chromosome 19 (the reference genome is GRCh38.p14), the polymorphism is G>A / G>T, and the sequences of the two detection primers (5'-3') of this SNP molecular marker are: ttatcgtgaacaacagtatcc (SEQ ID NO.9); ctgactctggaatatactgga (SEQ ID NO.10).

[0064] In this example, 204 blood samples from healthy people and 314 blood samples from ADHD patients were tested, and the results were as follows: Figure 1 It shows that the ELAVL1 gene is correlated with ADHD, and its SNP molecular marker rs14394 shows a significant correlation with ADHD.

[0065] Example 2 Mutation of the SNP site rs14394 of the ELAVL1 gene can cause changes in the expression level of ELAVL1

[0066] This example detects the effect of the mutation of the SNP site rs14394 of the ELAVL1 gene on the expression level of ELAVL1. The specific method and results are as follows.

[0067] 1. Design and synthesize the ELAVL1 expression vector His-ELAVL1(WT) and the ELAVL1 mutant expression vector His-ELAVL1(rs14394).

[0068] 2. Transfect the plasmids into cells respectively, and collect the cells after expression. Use RIPA method to extract protein and Trizol method to extract RNA.

[0069] 3. Detection of ELAVL1 RNA expression level by qRT-PCR: First, RNA was reverse transcribed into cDNA by a one-step method. The reaction mixture was prepared according to the manufacturer's protocol using a QuantStudio™ Dx real-time fluorescence quantitative PCR instrument and ChamQ Universal SYBR qPCR Master Mix. Each sample was repeated three times to detect the expression level of the ELAVL1 gene by q-PCR.

[0070] 4. Western blot was used to detect the expression level of ELAVL1 protein (refer to Example 2 for the method).

[0071] The results show that ( Figure 2 ), mutation of SNP site rs14394 of ELAVL1 gene will cause decreased expression of ELAVL1.

[0072] Example 3 Knockout of the elavl1a gene in zebrafish

[0073] In this example, a zebrafish mutant with elavl1a gene knockout was constructed, and the specific method is as follows: 1. Analyze the elavl1a gene and design gene knockout sites

[0074] The zebrafish elavl1a gene sequence was obtained through the NCBI and ensembl online databases. The amino acid sequence of the protein encoded by the elavl1a gene is shown in SEQ ID NO.11 (accession number is NP_571527.1). In order to ensure that the knockout has a significant effect on the gene function and its specificity, the gene knockout site was designed in the exon region avoiding the presence of multiple homologous genes or homologous sequences. Based on the analysis results of the elavl1a gene sequence, the knockout site was designed on the third exon of the elavl1a gene.

[0075] 2. Design and synthesize sgRNA for the elavl1a gene

[0076] The sgRNA (single-guide RNA) targeting the target sequence can guide the Cas9 protein to bind to a specific gene site for cutting. The sgRNA targeting site designed in the present invention is located in the third exon of the elavl1a gene and contains the PAM region (NGG). The sgRNA targeting site sequence is as follows: TCTTCAGCAGCATTGG (SEQ ID NO.12), and is confirmed and verified by the NCBI online tool.

[0077] 3. Microinjection

[0078] (1) Transcription and purification to obtain sgRNA and Cas9 mRNA: Linearize the plasmid containing the above sgRNA site sequence as template DNA. After purifying the template DNA with phenol-chloroform, prepare the transcription reaction system as follows: 1 μL NTP (10 mM), 2 μL 10× reaction buffer, 0.2-1 μg template DNA, 2 μL T7 RNA Polymerase-Plus™ Enzyme Mix, 1 μL RNaseinhibitor, add DEPC water to 20 μL, and react at 37°C for 3 hours. After the reaction is completed, precipitate and purify sgRNA and Cas9 mRNA. After the concentration is detected, dilute with DECP water and store in aliquots at -80°C.

[0079] (2) Microinjection: The sgRNA and Cas9 mRNA obtained by transcription were diluted to 100 ng / μL and 150 ng / μL, respectively. Microinjection of sgRNA and Cas9 mRNA was performed when zebrafish embryos were in the single-cell stage, and the injection volume for each embryo was 2 nL. After injection, embryo culture medium was used to culture in an incubator at 28.5°C. On the fourth day, 10 embryos were randomly selected for lysis, and PCR amplification was performed using the upstream and downstream primers of the elavl1a gene gRNA to amplify the target sequence. The PCR reaction conditions were: 95°C, 30 seconds; 95°C, 30 seconds, 55°C, 20 seconds, 72°C, 20 seconds, 35 cycles; 72°C, 5 minutes; 4°C storage. 2% agarose gel electrophoresis for 30 minutes to observe the PCR results. The PCR amplification product was sent to a biological company for sequencing. The working condition of sgRNA and the microinjection results were analyzed according to the sequencing peak graph, and corresponding adjustments were made. After screening, heterozygous zebrafish larvae with elavl1a gene knockout were obtained.

[0080] 4. Screening and confirmation of homozygous mutants of elavl1a gene knockout in zebrafish

[0081] (1) Breed the elavl1a gene knockout heterozygous zebrafish fry obtained above (it takes about 2 months for the body shape to be identifiable) and record them as the F0 generation.

[0082] (2) The tail fins of 2-month-old F0 generation zebrafish were cut to lyse the genomic DNA, and the upstream and downstream primers of the elavl1a gene were used for PCR amplification and then sent to a biological company for sequencing. Zebrafish with better knockout effects were selected based on the sequencing peak graph and tested with wild-type AB strain zebrafish to obtain the F1 generation. The F1 generation was screened by sequencing to identify zebrafish with the same mutation site and self-crossed to obtain the F2 generation. The F2 generation was also screened by sequencing or using NEBcutter to query the restriction site (http: / / nc2.neb.com / NEBcutter2 / ).

[0083] (3) The above screening resulted in the F2 generation of zebrafish homozygous mutants with elavl1a gene knockout. The homozygous mutants were amplified by PCR using the upstream and downstream primers of the elavl1a gene gRNA to obtain the PCR products and the gel electrophoresis results of the products digested by MFeI as well as the sequencing results as shown in the following figure: Figure 3 shown.

[0084] Example 4 Detection of ELAVL1 protein levels in elavl1a gene knockout zebrafish mutants

[0085] The elavl1a protein level in the elavl1a gene knockout zebrafish mutant was detected by the following method: 1. Protein sample preparation

[0086] (1) Take the wild type of elavl1a gene (elavl1a + / + ) and the elavl1a gene knockout heterozygous type (elavl1a + / - ) and elavl1a knockout homozygous mutant (elavl1a - / - ) Adult zebrafish fins were added to RIPA lysis buffer (containing PMSF) and ground and lysed on ice for 30 minutes.

[0087] (2) Centrifuge at 15,000 rpm in a 4°C precooled centrifuge for 30 minutes and collect the supernatant.

[0088] (3) The protein concentration was detected by the BCA method. After adding an appropriate amount of loading buffer, the protein sample was denatured at 95°C for 5 minutes to obtain the protein sample.

[0089] 2. Western blot detection

[0090] (1) Use 5% stacking gel and 10% separating gel SDS-PAGE electrophoresis to separate the proteins in the sample.

[0091] (2) Perform electrophoresis at a constant current of 200 mA for 90 min and transfer the protein to a PVDF membrane by wet transfer.

[0092] (3) Use specific primary and secondary antibodies to identify and detect elavl1a protein.

[0093] (4) Finally, the relative expression level of elavl1a protein was analyzed by DAB colorimetry.

[0094] The results are as follows Figure 4 As shown, targeted mutation of the elavl1a gene significantly reduced the expression level of ELAVL1 protein in mutant zebrafish.

[0095] Example 5 Detection of hyperactive phenotype of elavl1a gene knockout zebrafish mutant

[0096] The phenotype of the elavl1a gene knockout zebrafish mutant was detected as follows: 1. Wild-type zebrafish embryos and elavl1a knockout homozygous mutant zebrafish embryos were cultured in embryo culture medium (E3: 0.5 mM NaCl, 0.17 mM KCl, 0.33 mM CaCl, 0.33 mM MgCl) at 28.5°C.

[0097] 2. 5 dpf zebrafish larvae were selected for behavioral testing using a high-throughput monitoring system (behavioral instrument, ViewPoint Life Sciences Lissieu, Calvados, Lower Normandy, France).

[0098] 3. Place 5 dpf fry in a 96-well plate and add 300 μL embryo culture medium to each well.

[0099] 4. Before the experiment begins, place the fry in the behavior instrument to adapt to the environment for 20 minutes.

[0100] 5. Perform behavioral monitoring according to the set program and record data every 30 seconds; the set program is as follows: 2 hours of darkness, 20 minutes of light stimulation (1 minute of light, 1 minute of darkness, 10 cycles), 2 hours of darkness, 20 minutes of sound stimulation (1 minute of sound, 1 minute of keystroke, 10 cycles), 2 hours of darkness, 7 hours and 20 minutes of light, 10 hours of darkness, all light intensity settings that require light are 100% (8000 Lux), and the sound stimulation intensity is 440Hz.

[0101] The results are as follows Figure 5 and Figure 6 As shown, elavl1a + / - ,elavl1a - / - With elavl1a + / + Compared with juvenile fish, the swimming distance increased, and the swimming distance increased under light conditions, dark conditions, and stimulation conditions (light stimulation, sound stimulation), indicating that the elavl1a gene knockout zebrafish mutant showed a hyperactive phenotype.

[0102] Example 6 MPH treatment of elavl1a gene knockout zebrafish larvae can rescue the hyperactive phenotype

[0103] The elavl1a gene knockout zebrafish larvae were treated with methylphenidate (MPH), a current clinical drug for the treatment of ADHD, as follows: 1. Select zebrafish embryos at 6 hours post fertilization (6 hpf) and place 30 per well in a 6-well plate.

[0104] 2. The control group was immersed in E3 culture medium containing DMSO, and the treated group was immersed in E3 culture medium containing 20 μM MPH (dissolved in DMSO).

[0105] 3. Replace the culture medium every 24 hours.

[0106] 4. After 5 days of treatment, the behavior of the zebrafish fry was monitored (refer to Example 3 for the method).

[0107] The results are as follows Figure 7 It shows that the control group (containing DMSO) elavl1a - / - Zebrafish larvae swim farther than elavl1a + / + The expression of elavl1a in zebrafish larvae increased significantly, indicating that DMSO did not affect the original phenotype of zebrafish larvae, while after MPH treatment, - / - The swimming distance of zebrafish larvae was significantly shortened, indicating that MPH could alleviate the hyperactive behavior caused by elavl1a deficiency.

[0108] Example 7 Treatment of zebrafish larvae with dihydrotanshinone can induce a hyperactive phenotype

[0109] Dihydrotanshinone I (DHT), a known inhibitor of ELAVL1 protein expression, was used to treat wild-type zebrafish (AB) embryos to reduce the level of ELAVL1 as described below.

[0110] 1. Select zebrafish larvae 5 days after fertilization and place 25 per well in a 6-well plate; 2. The control group was immersed in E3 culture medium containing DMSO, and the treatment group was immersed in E3 culture medium containing gradient concentrations of DHT (dissolved in DMSO, 10 nM, 100 nM, 1000 nM); 3. After immersion for 5 minutes, the behavior of the zebrafish fry was monitored (the method is as in Example 3).

[0111] The results are as follows Figure 8 As shown in the figure, the swimming distance of wild-type zebrafish larvae increased after DHT treatment, and significantly increased at a concentration of 1000 nM, further proving that reduced ELAVL1 protein expression will lead to a hyperactive phenotype in zebrafish larvae.

[0112] Example 8 Construction of ADHD zebrafish model

[0113] This embodiment provides a method for constructing an ADHD zebrafish model, and the steps are as follows: 1. When the zebrafish embryo is in the single-cell stage, the sgRNA targeting the elavl1a gene (the targeting site sequence is as follows: TCTTCAGCAGCATTGG) and Cas9 mRNA are microinjected, and the heterozygous zebrafish fry with elavl1a gene knockout are obtained through cultivation and screening. The fry obtained above are cultivated to obtain the F0 generation.

[0114] 2. The heterozygous F0 generation zebrafish with elavl1a gene knockout were test-crossed with wild-type zebrafish to obtain the F1 generation, and the F1 generation was self-crossed to obtain the F2 generation. After screening, the homozygous mutant of the F2 generation zebrafish with elavl1a gene knockout was obtained, which is the ADHD zebrafish model.

[0115] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent replacements for some of the technical features therein. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. Application of SNP molecular markers as targets in the preparation of products for detecting attention deficit and hyperactivity disorder, wherein: The SNP molecular marker includes the SNP molecular marker rs14394 of the ELAVL1 gene.

2. Application of SNP molecular markers as targets in the preparation of products for assessing the risk of attention deficit and hyperactivity disorder, wherein: The SNP molecular marker includes the SNP molecular marker rs14394 of the ELAVL1 gene.

3. Application of a SNP molecular marker detection reagent in the preparation of a product for detecting attention deficit and hyperactivity disorder, wherein: The SNP molecular marker includes the SNP molecular marker rs14394 of the ELAVL1 gene.

4. Use of a SNP molecular marker detection reagent in the preparation of a product for assessing the risk of attention deficit and hyperactivity disorder, wherein: The SNP molecular marker includes the SNP molecular marker rs14394 of the ELAVL1 gene.

5. The use according to claim 3 or 4, characterized in that: The detection reagent is a detection primer and / or a probe.

6. The use according to claim 5, characterized in that: The detection primers include primers whose nucleotide sequences are shown as SEQ ID NO.1-2.

7. The use according to any one of claims 1 to 6, characterized in that: The product is a detection reagent, a detection chip or a detection kit.

8. A product for detecting or assessing the risk of attention deficit and hyperactivity disorder, characterized in that: The product comprises a reagent for detecting a SNP molecular marker, and the SNP molecular marker comprises the SNP molecular marker rs14394 of the ELAVL1 gene.

9. The product according to claim 8, characterized in that The reagents used to detect SNP molecular markers are detection primers and / or probes.

10. The product according to claim 9, characterized in that The detection primers include primers whose nucleotide sequences are shown as SEQ ID NO.1-2.

Images