Molecular marker for identifying porphyra haitanensis Zhedong No.2 strain

Abstract

The invention provides a molecular marker for identifying a porphyra haitanensis Zhejiang No.2 strain and a method for identifying the porphyra haitanensis Zhejiang No.2 strain established based on the molecular marker. The moral nucleotide sequence of the InDel molecular marker provided by the invention is SEQ ID NO: 1. Compared with a traditional molecular marker, such as SSR or ISSR, the molecular marker is faster and can be directly identified from sequencing data, and tedious laboratory development steps are omitted. The InDel marker provided by the invention can be quickly identified only through simple PCR amplification and gel electrophoresis, and the detection cost is low.

Description

Technical Field

[0001] The invention belongs to the technical field of screening and breeding of aquaculture strains, and particularly relates to a molecular marker for identifying the Zhedong No. 2 strain of Porphyra haitanensis. Background Art

[0002] Pyropia haitanensis is a warm temperate macroalgae with important economic value that is unique to my country. It is mainly cultivated in Zhejiang, Fujian and Guangdong provinces, accounting for about 75% of the national Pyropia production. Initially, most of the Pyropia germplasm used for large-scale cultivation came from wild populations. Since the 21st century, Pyropia haitanensis variety breeding has made significant progress. Many new varieties or new strains with excellent traits have been bred through selective breeding, mutagenesis breeding and hybrid breeding. However, with climate change and the expansion of cultivation scale, different varieties and strains are often mixed, which increases the risk of natural hybridization and variation, resulting in unstable traits, decreased disease resistance, and reduced yield and quality, which in turn leads to serious germplasm degradation. Therefore, it is urgent to breed more new varieties (lines) that are adapted to the current climate and cultivation mode.

[0003] "Zhedong No. 2" is a new strain obtained by using the East China Sea-adapted variety "Zhedong No. 1" as a parent, using 60C-γ ray radiation mutagenesis, and then through continuous selection. Its typical characteristics are well-developed attachment base, strong adhesion, wide algae, appropriate thickness of leaves, good stem ductility, rapid growth, and good high temperature resistance during the filamentous period. Therefore, the strong adhesion of this germplasm is very suitable for raft cultivation, it is not easy to fall off, and has a certain ability to resist wind and waves.

[0004] The leaves of "Zhedong No. 2" are relatively wide and thick, and it is also suitable for cultivation in sea areas with certain turbidity in Jiangsu, Zhejiang, and Fujian. It grows fast in the first and second water, and its protein content, umami amino acids, and nucleotides are higher than its parents; the content of resistance components, such as GSH, isorhodoside, and ascorbic acid is also relatively high. During its filamentous period, especially in the summer when the filaments are swollen, its high temperature resistance is good, which can help it adapt to the high temperature in the nursery pond caused by abnormal climate in recent years. Therefore, in order to promote the new strain of "Zhedong No. 2" into a new variety that can adapt to the needs of large-scale cultivation and production in the new climate environment.

[0005] Although different strains of Porphyra haitanensis show certain differences in body shape and color, these phenotypic characteristics are easily affected by cultivation density and aquatic ecological environment factors, so it is difficult to accurately distinguish strains based on morphological characteristics alone. Although previous studies have attempted to use traditional molecular markers such as interstitial simple sequence repeats (ISSRs), simple sequence repeats (SSRs) and sequence-characterized amplified regions (SCARs) to identify different germplasms of Porphyra haitanensis, the development cycle of these markers is long and the genetic information they provide is limited, resulting in their low efficiency in strain identification. Summary of the invention

[0006] The purpose of the present invention is to provide a molecular marker for identifying the Zhedong No. 2 strain of Porphyra haitanensis, namely an InDel molecular marker and a method for identifying the "Zhedong No. 2" strain of Porphyra haitanensis established based on the molecular marker.

[0007] The present invention firstly provides an InDel molecular marker for identifying the Porphyra haitanensis strain "Zhedong 2", and the nucleotide sequence thereof is SEQ ID NO:1.

[0008] The InDel molecular marker provided by the present invention can be used as a detection site to identify whether a Porphyra haitanensis individual belongs to the Zhedong 2 strain.

[0009] The present invention also provides a molecular marker detection kit for identifying the Porphyra haitanensis strain "Zhedong 2", wherein the kit comprises a primer pair for detecting the InDel molecular marker;

[0010] A specific sequence of the primer pair is SEQ ID NO:2 and SEQ ID NO:3.

[0011] The present invention also provides a method for identifying the Porphyra haitanensis strain "Zhedong 2", which is identified by detecting whether the above-mentioned InDel molecular marker exists.

[0012] The method described comprises the following steps:

[0013] 1) extracting genomic DNA from the conidia or thallus of Porphyra haitanensis;

[0014] 2) PCR amplification using primers;

[0015] 3) Detect the amplified product by agarose gel electrophoresis;

[0016] If a specific band with a length of 709 bp can be detected, the Porphyra haitanensis is judged to be the "Zhedong No. 2" variety.

[0017] The present invention is faster than traditional molecular markers (such as SSR or ISSR) and can be directly identified from sequencing data, eliminating cumbersome laboratory development steps. The InDel marker provided by the present invention can be quickly identified with simple PCR amplification and gel electrophoresis, and the detection cost is low. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 The figure is the electrophoresis result of the thallus amplification products of various strains of Porphyra haitanensis using InDel primers, where M is a 2000bp DNA ladder marker; lanes 1 to 3 are individuals of the "Zhedong No. 2" strain; lanes 4 to 21 are individuals of other strains of Porphyra haitanensis.

[0019] Figure 2 The electrophoresis results of the amplification products of the filaments and thallus of each generation of the "Zhedong 2" strain of Porphyra haitanensis using InDel primers, where M is a 2000bp DNA ladder marker; lanes 1 to 3 are individuals of the "Zhedong 2" strain; lanes 4 to 21 are thallus of the F1-F6 generations of Porphyra haitanensis DETAILED DESCRIPTION

[0020] The molecular marker used in the present invention is the whole genome insertion / deletion molecular marker InDel. The InDel marker screened and obtained by the present invention can not only improve the accuracy of strain identification, but also accelerate the screening process of excellent strains, thereby promoting the sustainable development of the Porphyra haitanensis cultivation industry.

[0021] The present invention is described in detail below in conjunction with embodiments and drawings.

[0022] Example 1: Screening of INDEL molecular markers specific to Porphyra haitanensis “Zhedong 2”

[0023] Whole genome resequencing was performed on the thallus of seven strains of Porphyra hainanensis, including "Zhedong 2", and the InDel site information of each sample was obtained by comparing it to the reference genome using bioinformatics software. Then, a script was used to screen out the InDel site unique to "Zhedong 2", which is located at position 4,655,835bp on chromosome 1, with a deletion length of 137bp.

[0024] The nucleotide sequence of the deleted fragment is as follows:

[0025] ACGGCCCCGACCTACCGCCAGCACGGCTCCGACCCATCGCCGCCGCCGGCACGGCTCCGACCCACCGCCGGCACGG CTTTGACCCACCGCTGGCACAGCTCCGACCCACCGCCGGTCCGGCTCCGACCCACCGCCGC (SEQ ID NO: 1).

[0026] The sequence containing the above InDel site was extracted from the Porphyra haitanensis reference genome using TBtools software (500 bp on each side), and then primers were designed using Primer5 software. The sequence information of one primer sequence pair is as follows:

[0027] (F)sense primer:5′-GTCTGGCTGGCGATTGA-3′(SEQ ID NO:2),

[0028] (R) Anti-sense primer: 5′-CGACGATGTTGGCACCT-3′ (SEQ ID NO: 3).

[0029] Subsequently, PCR amplification and verification were performed using samples of Zhedong No. 2 and other strains of Porphyra haitanensis.

[0030] Example 2: Detection of the effect of INDEL molecular markers

[0031] The primer sequences of SEQ ID NO: 2 and SEQ ID NO: 3 were used to perform PCR amplification on samples of different Porphyra haitanensis strains including Zhedong No. 2 and detected by gel electrophoresis. If a specific band with a length of 709 bp was detected, the Porphyra haitanensis was judged to be the "Zhedong No. 2" strain.

[0032] The specific method includes the following steps:

[0033] 1. Extraction of genomic DNA from the individual Porphyra haitanensis to be tested

[0034] The filaments and thallus of Zhedong No. 2 and thallus of other strains were selected for DNA extraction. The specific steps are as follows:

[0035] 1. Grind the laver thallus sample treated with liquid nitrogen into powder and transfer 50 mg of the frozen sample into a centrifuge tube.

[0036] 2. Immediately add 700 μl of Buffer PAL preheated to 65°C to the sample, vortex vigorously to fully disperse the sample, and place in a 65°C water bath for 20 minutes, mixing 2-3 times during the period.

[0037] 3. Add 700 μl of Buffer BDP to the sample and vortex for 10 seconds.

[0038] 4. Centrifuge at 12,000 x g for 5 minutes at room temperature and carefully transfer the supernatant to a new centrifuge tube.

[0039] 5. Add 700 μl of Buffer GWP to the supernatant and mix by inversion 10-15 times.

[0040] 6. Place the DNA column in a collection tube and transfer half of the mixture to the column. Centrifuge at 12,000 g for 60 seconds.

[0041] 7. Discard the filtrate and put the column back into the collection tube, transfer the remaining mixed solution to the column. Centrifuge at 12,000g for 60 seconds.

[0042] 8. Discard the filtrate and put the column back into the collection tube. Add 500 μl Buffer PW1 to the column and centrifuge at 12,000 g for 60 seconds.

[0043] 9. Discard the filtrate and put the column back into the collection tube. Add 500 μl Buffer PW2 to the column and centrifuge at 12,000 g for 60 seconds.

[0044] 10. Discard the filtrate and put the column back into the collection tube. Add 300ul Buffer PW2 to the column. Centrifuge at 12,000g for 2 minutes.

[0045] 11. Transfer the column to a new 1.5 ml centrifuge tube and add 40 μl of Buffer AE preheated to 65°C to the center of the column membrane. Let stand at room temperature for 2 minutes and centrifuge at 12,000 g for 1 minute.

[0046] 12. Add 40 μl of Buffer AE preheated to 65°C to the center of the column membrane. Leave for 2 minutes. Centrifuge at 12,000 x g for 1 minute. Discard the DNA binding column and store the DNA at -20°C.

[0047] 2. PCR amplification and agarose gel electrophoresis detection

[0048] The purified DNA was diluted to 5 ng / uL as a template for PCR amplification. The 25 μL reaction system included: Mix 12.5 μL, ddH20 7.5 μL, DNA template 2 μL, and forward and reverse primers (10 μmol / L) 2 μL each.

[0049] Reaction procedure: The reaction was carried out in a BIOER PCR instrument, with pre-denaturation at 94°C for 5 min, followed by 30 cycles of annealing for 30 s at 54.8°C and extension at 72°C for 30 s, and extension at 72°C for 10 min after the cycle.

[0050] After the reaction was completed, 5 μl of the amplified product was taken and subjected to electrophoresis in 1.0% agarose gel. The electrophoresis buffer was 50×TAE and the voltage was 120 V. The electrophoresis was stopped after 30 min and the results were recorded by taking photos using a gel imaging system.

[0051] The results showed that the primer pair of SEQ ID NO: 2 and SEQ ID NO: 3 could amplify a 709 bp specific band in the filaments and thallus of each generation of Zhedong 2, while a 846 bp band was amplified in the thallus of other strains. Figure 1 and Figure 2 shown.

[0052] The 709 bp specific band amplified from the filaments and thallus of each generation of Zhedong 2 was recovered and sequenced, and the sequence results are as follows:

[0053] GTCTGGCTGGCGATTGACGGCCAGCTCAAGATGTTTGGCATTGACAAAGTCAAACCGCACGTGGTCGCCAGGCCTGATGGGACGACCCCGGATGCC

[0054] GGTGATACGGTGGCCGCTGGTGCGCCGCCTCCAATGCCGGGCCGACGGCGTCGCTGACGCCGCTCCCACGCCCGCGGCGCCCCCCGCCGCCG

[0055] GGACCTGAGCGCCCGGCCACGGGTCTTCCCCCTCTGCCGGGCCGAGCGCCGGGCCGGCCGAGCCGACCAGCAGTGGGAGCACCGCAGGTGGACGCG

[0056] CCGCCGGCGGGCCCAGACGACCCCAGCGACCTGCCCACCGATGCGGCAGGCAATCCGGACTACGGGTCAATGTTAGACACGGTCCTAGCAGGCGAG

[0057] CACTTCATGTCGACACTATACGCTGCCTCGACCGCTTTCGTGTCTGAACGTTCTCAGGTGGTGACCACGGACCCACGGTGCGGCAAGGCGACGCGG

[0058] GGGCGACGATCGTCGCGGTCAGCCACAACTGCAGCCGCTGCGTCCGCCGCACCCTCTGGGTCGACGCCGGCCAAGACCTACATCACCGTAGTGGTA

[0059] CCGCCGGGTGACCCGCGCCTCAGCACCACCCGTTTCCGAGCCGCCGCCGCCAAAGAGGCCGATGGCCTCTAGGAGCGCGGTACGTTCAAAAGGGTCAAGGAGAGCGACGTCCCCAAAGGTGCCAACATCGTCG(SEQ ID NO:4)。

[0060] The nucleotide sequence of the 846bp band amplified from the filaments of non-Zhedong No. 2 and the thalli of each generation is as follows:

[0061] GTCTGGCTGGCGATTGACGGCCAGCTCAAGATGTTTGGCATTGACAAAGTCAAACCGCACGTGGTCGCCAGGCCTGATGGGACGACCCCGGATGCC

[0062] GGTGATACGGTGGCCGCTGGTGCGCCGCCTCCAATGCCGGGCGCCGACGGCGTCGCTGACGCCGCTCCCACGCCCGCGGCGCCCCCCCCGCCGCCG

[0063] GGACCTGAGCGCCCGGCCACGGGTGCTTCCCCCTCTGCCGGGCCGAGCGCCGGGCCGGCCGAGCCGACCAGCAGTGGGAGCACGCAGGTGGACGCG

[0064] CCGCCGGCGGGCCCAGACGACCCCAGCGACCTGCCCACCGATGCGGCAGGCAATCCGGACTACGGGTCAATGTTAGACACGGTCCTAGCAGGCGAG

[0065] CACTTCATGTCGACACTATACGCTGCCTCGACCGCTTTCGTGTCTGAACGTTCTCAGGTGGTGACCACGGACCCACGGTGCGGCAAGGCGACGCGG

[0066] GGGCGACGATCGTCGCGGTCAGCCACAACTGCAGCCGACGGCCCCGACCTACCGCCAGCACGGGCTCCGACCCATCGCCGCCGCCGGCACGGCTCCG

[0067] ACCCACCGCCGGCACGGCTTTGACCCACCGCTGGCACAGCTCCGACCCACCGCCGGTCCGGCTCCGACCCACCGCCGCCTGCGTCCGCCGCACCCT

[0068] CTGGGTCGACGCCGGCCAAGACCTACATCACCGTAGTGGTACCGCCGGGTGACCCGCGCCTCAGCACCACCCGTTTCCGAGCCGCCGCCGCCAAAG

[0069] AGGCCGATGGCCTCTAGGAGCGCGGTACGTTCAAAAGGGTCAAGGAGAGCGACGTCCCCAAAGGTGCCAACATCGTCG (SEQ ID NO: 5).

[0070] That is, the amplified 846 bp band contains a 137 bp InDel marker.

[0071] In summary, the InDel markers provided by the present invention have good genetic stability, good performance consistency between different generations, and are not affected by environmental factors, which is conducive to long-term tracking and monitoring of strain changes.

Claims

1. An InDel molecular marker for identifying the Porphyra haitanensis strain "Zhedong 2", characterized in that: The nucleotide sequence of the InDel molecular marker is SEQ ID NO:

1.

2. Use of the InDel molecular marker according to claim 1 as a detection site in identifying whether an individual of Porphyra haitanensis belongs to the Zhedong No. 2 strain.

3. A molecular marker detection kit for identifying the Porphyra haitanensis strain "Zhedong 2", characterized in that: The kit comprises a primer pair for detecting the InDel molecular marker according to claim 1.

4. The molecular marker detection kit according to claim 3, wherein the primer pair has the sequences of SEQ ID NO: 2 and SEQ ID NO:

3.

5. A method for identifying the strain of Porphyra haitanensis "Zhedong No. 2", characterized in that: The method is to identify by detecting whether the InDel molecular marker according to claim 1 exists.

6. The method according to claim 5, characterized in that The method is to use the kit described in claim 4 for identification.

7. The method according to claim 5, characterized in that The method comprises the following steps: 1) extracting genomic DNA from the conidia or thallus of Porphyra haitanensis; 2) PCR amplification using primers; 3) Detect the amplified product by agarose gel electrophoresis; If a specific band with a length of 709 bp can be detected, the Porphyra haitanensis is judged to be the "Zhedong No. 2" strain.

Images