Molecular breeding method of 'Suhao * Chong' silkworms with BmNPV and pyrethroid pesticide resistance

Abstract

The invention discloses a molecular breeding method of 'Suhao * Chong' silkworms resistant to BmNPV and pyrethroid pesticides, the molecular breeding method is efficient and practical, firstly, the 'Suhao * Chong' silkworm variety has pyrethroid pesticide resistance through a directional introduction and screening technology, and related molecular markers are dominant homozygous; secondly, a strategy of combining genetic breeding and molecular assisted breeding is adopted, the BmNPV resistance characteristic of the silkworm AN variety is introduced, and meanwhile, the pyrethroid pesticide resistance molecular marker is stably controlled to be a dominant homozygous type; finally, through strict screening and cultivation, a silkworm variety which has remarkable economic advantages and has double resistance to pyrethroid insecticides and BmNPV is obtained.

Description

Technical Field

[0001] The present invention belongs to the field of molecular breeding technology, and relates to the cultivation of the pyrethroid pesticides and BmNPV resistance traits of the economic silkworm variety "Suhao×Zhongye", and specifically is a molecular breeding method for the "Suhao×Zhongye" silkworm that is resistant to both BmNPV and pyrethroid pesticides. Background Art

[0002] The quality of silk cocoons of silkworms is crucial to their economic value. In the process of selecting silkworm varieties, it is necessary to take into account both the quality of silk cocoons and the strength of the silkworm body to ensure that the selected varieties can have stable economic benefits. In the actual production and operation process, silkworm farmers often encounter incidents of silkworms not spinning cocoons due to trace pesticide poisoning. Pyrethroid insecticides have become one of the main culprits of pesticide pollution in mulberry gardens due to their long residual effect, which in turn causes silkworms to not spin cocoons or to spin thin cocoons.

[0003] Bombyx mori Nuclear Polyhedrosis Virus (BmNPV) is the main disease that harms silkworms. The losses caused by pustosis account for more than 50% of the total losses caused by silkworm diseases, and in some places, it is as high as 80%. After silkworms eat mulberry leaves contaminated with trace amounts of pesticides, their physical fitness declines and they are more susceptible to pustosis. The existence of these problems has hindered the development of the sericulture industry. Therefore, screening and cultivating silkworm varieties that are resistant to both blood-type pustosis and pyrethroid insecticides meets the development needs of the sericulture industry.

[0004] Our research group found in the previous study that the silkworm F7 has a very high tolerance to pyrethroid insecticides, which is dominant. Compared with conventional varieties, its tolerance to pyrethroid insecticides can reach 100-120 times, making it an ideal material for breeding pyrethroid-resistant silkworm varieties. The silkworm AN variety is very resistant to BmNPV, and the median lethal concentration of BmNPV for silkworms from the second instar is 10 9 cfu / mL, which is more than 1000 times that of conventional production seeds and is dominantly inherited; the silkworms from the 2nd instar are fed with high-concentration BmNPV virus liquid (1×10 7 cfu / mL), and no purulent disease occurred. Summary of the invention

[0005] Technical problem to be solved: In order to overcome the shortcomings of the prior art, the present invention adopts a strategy of combining genetic breeding with molecular marker-assisted breeding to introduce the pyrethroid insecticide resistance traits of the silkworm F7 variety and the BmNPV resistance characteristics of the silkworm AN variety into the "Suhao × Zhongye" silkworm variety; in view of this, the present invention provides a molecular breeding method for the "Suhao × Zhongye" silkworm that is resistant to both BmNPV and pyrethroid pesticides.

[0006] Technical solution: A molecular breeding method for the "Suhao × Zhongye" silkworm with resistance to BmNPV and pyrethroid pesticides. The method uses the "Suhao × Zhongye" silkworm variety as the female parent, and introduces the pyrethroid pesticide resistance trait of the silkworm F7 variety into the female parent through hybridization. After separation of the first generation, the homozygous second generation is obtained by detection and screening of specific primers for molecular markers of resistance to pyrethroid insecticides; then the BmNPV resistance bloodline of the silkworm AN variety is introduced, and the "Suhao × Zhongye" silkworm variety with resistance to BmNPV and pyrethroid pesticides is obtained through direct and indirect feeding screening of BmNPV.

[0007] Preferably, the method is specifically:

[0008] S1. Using the silkworm variety "Suhao×Zhongye" as the female parent and the silkworm variety F7 as the male parent, hybridize to obtain the G1 generation, then raise normally, self-pollinate the G1 generation to obtain the G2 generation, extract 30-40 silkworm eggs from each moth circle of the G2 generation, extract the genome, use specific primers for molecular markers of resistance to pyrethroid insecticides to detect, screen the moth circles with homozygous molecular markers, and the silkworm eggs in the moth circles obtained by screening are the G2 generation with homozygous molecular markers;

[0009] S2, the G2 generation with homozygous molecular markers were raised normally and crossed with the silkworm AN variety to obtain the G3 generation;

[0010] In the S3 and G3 generations, the resistance genes to pyrethroid pesticides and BmNPV were in heterozygous form. After normal rearing, the male moths were backcrossed with the "Suhao × Zhongye" variety to obtain the G4 generation. In the G4 generation, the resistance genes to pyrethroid pesticides and BmNPV were in heterozygous form in 50% of the individuals, and the other 50% of the individuals were negative homozygous.

[0011] After the S4 and G4 generations were raised normally until the second-instar silkworms, they were fed with high-concentration BmNPV virus liquid. The resistance gene of BmNPV in the surviving individuals was heterozygous, and the negative homozygous individuals died of purulent disease; the surviving male moths were backcrossed with the "Suhao×Zhongye" silkworm variety, and the male and female moths were crossed one by one. When the moths were separated and laid eggs, the male and female moths were numbered; the genome of the male moth was extracted, and the specific primers of the molecular marker of resistance to pyrethroid insecticides were used for detection, and the male moths with heterozygous molecular markers were selected for seed preservation to obtain the G5 generation; in the G5 generation, the resistance gene of pyrethroid pesticides existed in a heterozygous form, and the resistance gene of BmNPV existed in 50% of the individuals in a heterozygous form and 50% in a negative homozygous form;

[0012] After the S5 and G5 generations were raised normally until the second-instar silkworms, they were fed with high-concentration BmNPV virus liquid. The surviving individuals were heterozygous for the BmNPV resistance gene, and the negative homozygous individuals died of purulent disease; the surviving male moths were backcrossed with the "Suhao×Zhongye" silkworm variety, and the male and female moths were crossed one by one. When the pairs were separated and the moths were laid eggs, the male and female moths were numbered; the male moth genome was extracted, and the specific primers for the molecular markers of resistance to pyrethroid insecticides were used for detection, and the male moths with heterozygous molecular markers were selected for seed preservation, and the G6 generation was obtained; in the G6 generation, the presence of pyrethroid pesticide and BmNPV resistance genes was consistent with that of the G5 generation;

[0013] After the S6 and G6 generations were raised normally until the second-year silkworms, they were fed with high-concentration BmNPV virus liquid. The BmNPV resistance gene in the surviving individuals was heterozygous. They were self-pollinated for seed production and succession. 30-40 silkworm eggs were taken from each moth circle, marked accordingly, and the silkworm egg genome was extracted. The specific primers for the molecular marker of resistance to pyrethroid insecticides were used for detection, and the moth circles with dominant homozygous resistance genes to pyrethroid pesticides were screened out to obtain the G7 generation. In the G7 generation, the BmNPV resistance gene existed in the form of dominant homozygous: heterozygous: recessive homozygous = 1:2:1.

[0014] S7, raising single moths of the G7 generation to the second instar, feeding them with high-concentration BmNPV virus solution, investigating the survival rate, selecting moth areas that are fully resistant to BmNPV, self-pollinating and sub-generation, establishing sub-lines, and obtaining the G8 generation; in the G8 generation sub-lines, the pyrethroid pesticide resistance gene exists in a homozygous form, and the BmNPV resistance gene exists in three forms: (1) all are dominant homozygous; (2) dominant homozygous: heterozygous = 1:1; (3) dominant homozygous: heterozygous: recessive homozygous 1:2:1;

[0015] 16-18 moths of each subline of S8 and G8 generations were collected and raised to 2-year-old silkworms, and high-concentration BmNPV virus liquid was added to feed them. The survival rate was investigated. Among the sublines, those with a survival rate of less than 80% were eliminated, and the sublines with a survival rate of more than 95% in the remaining moth area were selected. After checking the economic traits, only the moth area showing full resistance to BmNPV was retained. The sublines were self-pollinated for seed production and succession, and the G9 generation was obtained.

[0016] 16-18 single moths of each subline of S9 and G9 generations were collected and raised to the second-instar silkworms. They were fed with high-concentration BmNPV virus solution and the survival rate was investigated. In each subline, those with a survival rate less than 80% were eliminated, and the sublines with a survival rate greater than 95% were selected and raised normally to the third-instar silkworms. They were fed with 0.1 mg / L cypermethrin and their resistance to pyrethroid pesticides was evaluated. Moth groups with resistance to both BmNPV and pyrethroid pesticides were obtained. The moth groups were crossed to produce seeds and continue the generation, and the G10 generation was obtained, completing the molecular breeding of the "Suhao×Zhongye" silkworm with resistance to both BmNPV and pyrethroid pesticides.

[0017] Furthermore, the pyrethroid insecticide resistance molecular marker is SEQ ID NO: 1, and its specific amplification primers are SEQ ID NO: 2-3. Among them, the pyrethroid insecticide resistance molecular marker is the upstream regulatory sequence of the BmCarE-6 gene, and SEQ ID NO: 1 is specifically:

[0018] TCCATGCACTAATCATAACCACAAGTACCACACGTGGAATCAACTAGTTCTCTATAGCA

[0019] AATAATTTTATTAAATACTAGCTGACCCGGCAGACTTCGTAGTGCCTTAATCTATAAAT

[0020] AAAATACCGAAACTTTTGTACAAAATAAACTTAAAACAAACAAAAGGAATCCGTCCGA

[0021] CGTCCGGGGACACATCAAAGGAAAAACAAAATTGTTATTTTTATTTAATTCCGAGCATT

[0022] TTCATATTTATCTACCTTTTAAACCTTCTCTGGACTTCCACAAATAATTCAAGACCAAA

[0023] ATTAGCCAAATCGGTCCAGCCGTTCTCGAGTTTTAACGAGACTAACGAACAGCAATTC

[0024] ATTTTTATATAGACATTGTTGAATTTTGTTAAAATTTGCACAGTTGTCCAGAGAATA

[0025] TTGAAAAACTGTGTGCTTCGTACGAATTTTTTTTTTTTTACGTTTTCGATAATATATAAG

[0026] TTAGCTGAAATTTGTATGGAGTTGGAACGTTTTCCTACGTTTGCGCTGGGGGTGCTGTT

[0027] CCAACTTTTACATTATCGAGAACTTAAAAAAACTCGCGCTAAGCACACTGGAGACTTG

[0028] AGCATTCGGTTGTTGTTAATGTCTACAATGTCTTTTATAAATCTATCCGAAATATTTTGT

[0029] CTTTCAACGGCCGTCTGGTGTAGTGGTAAGTGACATTGTCACTACCTAAGGGGGTCGCG

[0030] GGTTCGAATCCCGCCAAGGGAAGATATTTGTATGATAAATTAATATAAAATGTCTTTTC

[0031] CAGGGTTATGGATGTATATTAATATATTATGTATGTGTATAATAAAAATCTTACATTT

[0032] ATTTCCGTTATCCGGTACCTTTAACACAAGTTCTTTACGATATTATCACGGATCAGTT

[0033] AACGTGGCGTGATTGTTAGTAAATATTTATTTATTATTTATTTTACTCTTATCTTTCACA

[0034] CTGAGACGCAGTCCGTTCTAGAATAACTTAGTCATCCGTGACCATGAAACTTGTAATGC

[0035] ATTCGAACCGTCGGAAAAAAGAAAAAAATGGACGTGATATTAAACAGTAAAATGAATTT

[0036] TATTCGATTATAAATTATGAACGCGAATCCGTATGAACGTCGAAAAATAGAACAATTA

[0037] CGAAACTAAAATTCTTAATTACAAATTAAATTAAAACTCCTTAGACTTATCAAGAAATT

[0038] AGAAACATCATTTGAATTAGTTAATTAGAAAATAAACGGAACACGGCATTTTAATTCTT

[0039] AAACATTTCAGTGACATTGCTATAAATATATATATCGACACTTGAAAGGCAAAAGTGA

[0040] CTAAGCGGCAATAACTGATTTGTACATAAATGATAGGCAATAACCATATTAGATGCGC

[0041] AAAAAAATATATTTCTAGGTCTATTAAAATCATTTCAATCCTACAGCTACACTAGAATCTA.

[0042] SEQ ID NO: 2 is a forward primer for amplifying the sequence of SEQ ID NO: 1, specifically: 5'-TCCATGCACTAATCATAACCA-3'; SEQ ID NO: 3 is a reverse primer for amplifying the sequence of SEQ ID NO: 1, specifically: 5'-TAGATTCTAGTGTAGCTGTAGGA-3'.

[0043] Furthermore, the pyrethroid insecticide resistance molecular marker is SEQ ID NO: 4, and its specific amplification primers are SEQ ID NO: 5-6. Among them, the pyrethroid insecticide resistance molecular marker is the upstream regulatory sequence of the BmGST-2 gene, and SEQ ID NO: 4 is specifically:

[0044] GTGTAGAACAAGGATTCCCCAAGGTGATTGTCCAGAGATCAACTTAATCGAAAATTGA

[0045] TTTTGTGTGTCGACGAGGTCTAAAAATCTGAGGTATCAAATTATTTTGGAAAAGGAGTC

[0046] TTTTACCCAAAATGATTTGGGAATCCCTGATGTCGATTCTACAGACTTTTGGAATTGCT

[0047] TGTGTAGGCTTTAATATTACTGTGCAATGCAGAAACTGACGAACATGTAAATTTGACCA

[0048] TATCATCGTAACGTAGTGTTTATATACATTCTATTTAACTCTCTCGCTTGTTTTACAGAA

[0049] CCGCTGGCTCCAAGTACGTCAATAAAGATTCATTCAGTCAATCAAAATGGAACGTGTA

[0050] GACCGAACGTAGAACATTAAAAATATGTGAAGAAGTGAACCTCACCACTCCAAGATGA

[0051] ATGAACAATAAGAGCAAATTAAAATTACATGTCATAGATAATAAATACATGTATTTTA

[0052] TTTATTGAATGCGTAGATATGTAACGAAATTTTAATAAAAACATGATAACTTCCACTGTAAGTCTGGCCATGCACCTAATATATTCGTCGTTTCAAGGTGTTCGAGTTATCAGTC.

[0053] SEQ ID NO:5 is a forward primer for amplifying the sequence of SEQ ID NO:4, specifically: 5'-GTGTAGAACAAGGATTCCCC-3'; SEQ ID NO:6 is a reverse primer for amplifying the sequence of SEQ ID NO:4, specifically: 5'-GACTGATAACTCGAACACCTT-3'.

[0054] Furthermore, the pyrethroid insecticide resistance molecular marker is SEQ ID NO: 7, and its specific amplification primers are SEQ ID NO: 8-9. Among them, the pyrethroid insecticide resistance molecular marker is the upstream regulatory sequence of the BmCXE-26 gene, and SEQ ID NO: 7 is specifically:

[0055] GAAAGAAAACGGAGCTCTAACCTGGGACGATGCTAACACTAGCCCTAGCAAGAGCAG

[0056] CGCTTCTCAGATGAGAACAAAGATACACTGAAAGGCTTTATATACGAATTGCGCTAAC

[0057] AAAATTATGACTAAACATAATCTTCAGCTGTGAAGGCCGGGACAAGAAATGCAGTAAA

[0058] AAAGTACTTAACGCAAAATTGTAAACAGCTTGTATTACAAATTAAAGTTAACCTAAGG

[0059] ATTTTAAATATGCTTGAAGGTCAGTGTAGTAATTAGAACTAAAACGCGAGAAGTAGAC

[0060] GTGTGTGTAATATTGTGTAAAACTATAAAAAATAAAGAAACTTATCAGACATTGTCCG

[0061] AGACTAGGTAAAAGTAACGTTATCTATATATAAATTATCGTGACCTTCGTTTGTATCAA

[0062] CGTGACTAAATTGATCGCTTGACTTTTAAATGCGAGTTAAGTTCATTGCATTTCAAATG

[0063] CAAAGTACCTTAATTGTTTTGTAATAATTACATATTTTTACTGTTTTTTTATTGCTTAGA

[0064] TGAGTGGATGAGCTCACAGCCCACCTGGTGTTAAGTGGTCACTGGAGGCCCATAGACAT

[0065] CTACAACATAAATGCGCCACCCCACCCACCATCAATGTTCATTTGCATTTTTCCTTGTTTG

[0066] TCCTCTGCTTTGTGAGGACTCTCGGTTGGATTTAAAAGAAAGGGTTTAACATAGTACCA

[0067] TCAACTGATGACGCGCGAGTACTTTGAAGAAATCGATGTTTTTCTTACGATTAGCGTTG

[0068] ATCTTATCGGAGTGAGGATCTCACTATTTTTTTTATATTATACATAAACAATAAACTAG

[0069] ATAAAAAACGTCTATCACCCTACATTTATAATATTTGGTAGCCAATACTTTTAAGAGTC

[0070] AGACTTTGTTCAGGTGCACATTTTTAATGAAGTACCTTAACGTCATATTGTTTTATAATT

[0071] TACTATCTACTTCGGTTCCGGTCCAAAGAGTAATACAAAAGCTATTGAGTATATCTTAT

[0072] ACCTCAAGGTGGAAAATAGTACTCACGGTACATTAACAAAAAAATATTTCATATTTGA

[0073] TTCGTTTATCCGTTGTTCTTAAAATTTAACAAAACTGTCTCAGAACATATTGGCCAACTT

[0074] GATCTGAGACCTTGATCAACATTACGTTACAACGAACTAGTATCTTCTGCTAAATTTGG

[0075] CAGATATTACCAACATGTCATTTACAATTTTACAATGTCAAGATCAAGAAACTACCGTTTGGCAAATAACCAATTGATCAAAATCCAGTACACCGTTTGAAAAGCGAATC.

[0076] SEQ ID NO: 8 is a forward primer for amplifying the sequence of SEQ ID NO: 7, specifically: 5'-GAAAGAAAACGGAGCTCTAAC-3'; SEQ ID NO: 9 is a reverse primer for amplifying the sequence of SEQ ID NO: 7, specifically: 5'-GATTCGCTTTTCAAACGGTG-3'.

[0077] Furthermore, the pyrethroid insecticide resistance molecular marker is SEQ ID NO: 10, and its specific amplification primers are SEQ ID NO: 11-12. Wherein, the pyrethroid insecticide resistance molecular marker is the upstream regulatory sequence of the BmCYP4C1 gene, and SEQ ID NO: 10 is specifically:

[0078] TTAACAGTTTCACAGGCGATGTACAGGCCTTTAGTCTTAACAGTAAGCCTCTGATACGC

[0079] CCTTTCGGTTGCCACTTGGAGGTTGCATCGCCGACTCTTAGGGCCCGCGTTCAGTCAG

[0080] CGGGTGCTCAATGGTTTCATCAGTGCTTTCAACTGCAAGTCGAGGGCGCTCGTCACCCA

[0081] GCTGGAGGACCGGGTCGGGCGAGGGCCTTTCGACCACGTCCCCTACCTGTCCTTCAAT

[0082] AACTTGGAAACTATATGTCGTGAGTATTCATGTTTTTTTTTATTGCTTAGATGAGCGTTC

[0083] AAGCTCATAGCTCACCTGGTGTTAAGTGGTTACTGGAGCCCATAGACATTTACAACGTA

[0084] CCACCCACCTTGAGATGTAAGTTGTAAGGTCTCAGTATAGTTACAACGGCTGCCCCACC

[0085] CTTCGAACCGAAACGCATTACTGCTTCACGGCAGAAACAGGCATGGTGGTGGTACCCA

[0086] CCCGCGCGGACTCACATGAGGTCCCACCACCATGCGCGGCGCTCTCTCGCAGCTTTTTC

[0087] AATTCAGTGCAGTATTGCAGCTATGTTCGTTCGCGTTAAGAATGCAGTTAATTATCATT

[0088] GTTCGCCGCCTCCTAACCAATCAAATCTTTTCAAATTACAAGGTCAAGTTCACAGTGAC

[0089] CAGTTGAAAGCACAGCTTCGAACGCGACGGTTGTGTCCTATAATTGTGTTAACTGATTT

[0090] ATATTTAAAAAAATGAATACCTCACCAATTCGTAAAAATAAAAGTGGTTCGTAATTCA

[0091] CAGTGGGGCAGAAAAGTTACAATGTTTTAAAGTATTTTAAACAGTCTGATTTAAATGTG

[0092] ACTGTGGACAGCATAGGACAAATATTTTATAACGCAATTTGGTTAGCGCTGATCGATG

[0093] GAAGAAATGCCGCGAACCACGTCTTGCAAGAAGAAAATACCATGTGGTGTTTAGATGA

[0094] TGTCATGGAACTCGCTAGTCGGCATCGATGCGCATTTCGACAAAGCGGCACGACACG

[0095] AGAGCCCTTCCATCGTGGCCGTCGGTAACTACATTCCCGATCCTACGGACAGAATGGA

[0096] AAGCAGTCGATGTCGCCCAAAACACGTCATTTCGGATCCTCCCGATCCAATAACGGGG

[0097] CTTTTAGGTACCTCAAGCACCGGTTACCGTTCTCGTCGAACCCGTGCCTTGCGACGAAG

[0098] GGCTCGACGAGTAAATTAACCCTCAGACACAGCCCACTGCGTTTCTCGCCGGATCTTTCT

[0099] CAGTGGGTCGCGTTGCCGGTCCAGTGGTAGATTCTGCGAAGCACTGCTCTTGCTAGGGT

[0100] TCGTGTTAGCAACGTCATCAGGTTTGAGCCCCGCGAGCTCACCTACTAGTTAAGGTTCC

[0101] GCTGGTATAGCCTCTCAAGGCTATCAGCTTAGGTAGGAAAAAAAAGAAAAACTCTTGTG

[0102] CAGAAAATTAATTTATTATAAATACTAACGAGGACACTTTAAGCTCATTAAACTTAATC

[0103] TTTAAGAATATAATTGTTTCAATGTTCACACCACTGTGAAAACACCTTTACCCTTCAGTTGC。

[0104] SEQ ID NO: 11 is a forward primer for amplifying the sequence of SEQ ID NO: 10, specifically: 5'-TTAACAGTTTCACAGGCGAT-3'; SEQ ID NO: 12 is a reverse primer for amplifying the sequence of SEQ ID NO: 10, specifically: 5'-GCAACTGAAGGGTAAAGGTG-3'.

[0105] Furthermore, in the high concentration BmNPV virus solution, the concentration of BmNPV virus is 10 7 cfu / mL or above.

[0106] Beneficial effects: The molecular breeding method of the present invention is efficient and practical. Firstly, through targeted introduction and screening technology, the "Suhao×Zhongye" silkworm variety has the performance of resistance to pyrethroid pesticides, and the relevant molecular markers are all dominant homozygous; secondly, a strategy combining genetic breeding and molecular assisted breeding is adopted to introduce the BmNPV resistance characteristics of the silkworm AN variety, and at the same time, the pyrethroid pesticide resistance molecular markers are stably controlled to be dominant homozygous; finally, after strict screening and cultivation, a silkworm variety with significant economic advantages and dual resistance to pyrethroid insecticides and BmNPV is obtained. BRIEF DESCRIPTION OF THE DRAWINGS

[0107] Figure 1 It is a flow chart of the molecular breeding method of the "Suhao×Zhongye" silkworm resistant to BmNPV and pyrethroid pesticides described in the present invention.

[0108] Figure 2 It is an electrophoretic diagram of the presence of the pyrethroid-resistant insecticide molecular marker SEQ ID NO: 1 in the silkworm F7 variety and the Dazao variety; wherein M is DL2000 Marker, 1 is F7, and 2 is Dazao.

[0109] Figure 3 This is an electrophoresis diagram of the presence form of the pyrethroid-resistant insecticide molecular marker SEQ ID NO: 1 after the "Su Hao × Zhong Ye" variety was introduced into the F7 lineage; wherein, M is DL2000 Marker, 1 is F7, 2 is the Chinese mother strain 1 of the "Su Hao × Zhong Ye" introduced into the F7 lineage, 3 is the Chinese mother strain 2 of the "Su Hao × Zhong Ye" introduced into the F7 lineage, 4 is the Japanese mother strain 1 of the "Su Hao × Zhong Ye" introduced into the F7 lineage, and 5 is the Japanese mother strain 2 of the "Su Hao × Zhong Ye" introduced into the F7 lineage.

[0110] Figure 4It is an electrophoresis diagram of the existence form of the pyrethroid-resistant insecticide molecular marker SEQ ID NO: 1 in F7, "Suhao×Zhongye" and AN pure breeds; wherein, M is DL2000 Marker, 1 is F7, 2 is "Suhao×Zhongye" Chinese mother breed 1, 3 is "Suhao×Zhongye" Chinese mother breed 2, 4 is "Suhao×Zhongye" Japanese mother breed 1, 5 is "Suhao×Zhongye" Japanese mother breed 2, and 6 is the silkworm AN pure breed.

[0111] Figure 5 This is the screening result of the G2 generation molecular marker SEQ ID NO:1; the red marked part is the dominant homozygous progeny.

[0112] Figure 6 This is the screening result of the G6 generation molecular marker SEQ ID NO:1; the red marked part is the dominant homozygous progeny.

[0113] Figure 7 It is an electrophoretic diagram of the presence of the pyrethroid-resistant insecticide molecular marker SEQ ID NO: 4 in the silkworm F7 variety and the Dazao variety; wherein M is DL2000 Marker, 1 is F7, and 2 is Dazao.

[0114] Figure 8 This is an electrophoresis diagram of the presence form of the pyrethroid-resistant insecticide molecular marker SEQ ID NO: 4 after the "Su Hao × Zhong Ye" variety was introduced into the F7 pedigree; wherein, M is DL2000 Marker, 1 is F7, 2 is the Chinese mother strain 1 of the "Su Hao × Zhong Ye" introduced into the F7 pedigree, 3 is the Chinese mother strain 2 of the "Su Hao × Zhong Ye" introduced into the F7 pedigree, 4 is the Japanese mother strain 1 of the "Su Hao × Zhong Ye" introduced into the F7 pedigree, and 5 is the Japanese mother strain 2 of the "Su Hao × Zhong Ye" introduced into the F7 pedigree.

[0115] Fig. 9 It is an electrophoretic diagram of the presence of the pyrethroid-resistant insecticide molecular marker SEQ ID NO: 7 in the silkworm F7 variety and the Dazao variety; wherein M is DL2000 Marker, 1 is F7, and 2 is Dazao.

[0116] Fig.10 This is an electrophoresis diagram of the presence form of the pyrethroid-resistant insecticide molecular marker SEQ ID NO: 7 after the "Su Hao × Zhong Ye" variety was introduced into the F7 pedigree; wherein, M is DL2000 Marker, 1 is F7, 2 is the Chinese mother strain 1 of the "Su Hao × Zhong Ye" introduced into the F7 pedigree, 3 is the Chinese mother strain 2 of the "Su Hao × Zhong Ye" introduced into the F7 pedigree, 4 is the Japanese mother strain 1 of the "Su Hao × Zhong Ye" introduced into the F7 pedigree, and 5 is the Japanese mother strain 2 of the "Su Hao × Zhong Ye" introduced into the F7 pedigree.

[0117] Fig.11It is an electrophoretic diagram of the presence of the pyrethroid-resistant insecticide molecular marker SEQ ID NO: 10 in the silkworm F7 variety and the Dazao variety; wherein M is DL2000 Marker, 1 is F7, and 2 is Dazao.

[0118] Fig.12 This is an electrophoresis diagram of the presence form of the pyrethroid-resistant insecticide molecular marker SEQ ID NO: 10 after the "Su Hao × Zhong Ye" variety was introduced into the F7 pedigree; wherein, M is DL2000 Marker, 1 is F7, 2 is the Chinese mother strain 1 of the "Su Hao × Zhong Ye" introduced into the F7 pedigree, 3 is the Chinese mother strain 2 of the "Su Hao × Zhong Ye" introduced into the F7 pedigree, 4 is the Japanese mother strain 1 of the "Su Hao × Zhong Ye" introduced into the F7 pedigree, and 5 is the Japanese mother strain 2 of the "Su Hao × Zhong Ye" introduced into the F7 pedigree. DETAILED DESCRIPTION

[0119] The following examples further illustrate the content of the present invention, but should not be construed as limiting the present invention. Without departing from the spirit and essence of the present invention, modifications and substitutions made to the method, steps or conditions of the present invention all belong to the scope of the present invention. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art.

[0120] Example 1 Identification and application of the pyrethroid insecticide resistance molecular marker SEQ ID NO: 1 of silkworm F7 variety

[0121] The silkworm F7 variety, supplemented with 0.1 mg / L deltamethrin (dry leaf method), induced the BmCarE-6 gene to be significantly upregulated. Therefore, the upstream regulatory sequence (SEQ ID NO: 1) of the BmCarE-6 gene of the silkworm F7 variety was cloned and analyzed, and the specific amplification primers were: SEQ ID NO: 2-3. The silkworm F7 silkworm egg genome was used as the amplification template, and the PCR reaction conditions were: 94℃ pre-denaturation for 4 minutes, then 94℃ denaturation for 40 seconds, 58℃ annealing for 40 seconds, 72℃ extension for 1min40s, a total of 35 cycles, and finally 72℃ extension for 10 minutes; according to the TA cloning method, the PCR product was recovered and connected to the pMD19-T vector, and then the DH5α competent cells were transformed according to the steps, and the positive clones verified by bacterial liquid PCR were sent to Zhejiang Shangya Biotechnology Co., Ltd. for sequencing. The upstream regulatory sequence (1414bp) of the silkworm F7 variety BmCarE-6 was obtained by sequencing. Bioinformatics analysis showed that the upstream regulatory sequence of the silkworm F7 variety BmCarE-6 had a continuous large fragment deletion of 683 bp in size compared with the large variety ( Figure 2). Through the analysis of the tolerance mechanism of pyrethroid insecticides in silkworm F7, it was found that silkworm F7 forms pyrethroid insecticide resistance by up-regulating the expression of detoxification enzyme genes, and the resistance of silkworm F7 is dominant. Therefore, the upstream regulatory sequence of silkworm F7 variety BmCarE-6 is suitable as a molecular marker for resistance breeding.

[0122] By hybridization, the resistance to pyrethroid insecticides of the silkworm F7 variety was introduced into the female parent of the economic silkworm variety "Suhao × Zhongye". The molecular biological detection results of silkworm eggs after hybridization showed that the genomic molecular markers were all present in a heterozygous form (that is, there were complete large fragments and missing small fragments) ( Figure 3 ), which exists in the form of complete large fragments in the female parent of "Suhao×Zhongye" and AN varieties ( Figure 4 ).

[0123] Example 2 Molecular breeding of "Suhao × Zhongye" silkworms with resistance to BmNPV and pyrethroid pesticides

[0124] like Figure 1 As shown, the method comprises the following steps:

[0125] S1. Using the silkworm variety "Suhao×Zhongye" as the female parent and the silkworm variety F7 as the male parent, hybridize to obtain the G1 generation, then raise normally, self-pollinate the G1 generation to obtain the G2 generation, extract 30-40 silkworm eggs from each moth circle of the G2 generation, extract the genome, use specific primers for molecular markers of resistance to pyrethroid insecticides to detect, screen the moth circles with homozygous molecular markers, and the silkworm eggs in the moth circles obtained by screening are the G2 generation with homozygous molecular markers;

[0126] S2, the G2 generation with homozygous molecular markers were raised normally and crossed with the silkworm AN variety to obtain the G3 generation;

[0127] In the S3 and G3 generations, the resistance genes to pyrethroid pesticides and BmNPV were in heterozygous form. After normal rearing, the male moths were backcrossed with the "Suhao × Zhongye" variety to obtain the G4 generation. In the G4 generation, the resistance genes to pyrethroid pesticides and BmNPV were in heterozygous form in 50% of the individuals, and the other 50% of the individuals were negative homozygous.

[0128] After the S4 and G4 generations were raised normally until the second-instar silkworms, they were fed with high-concentration BmNPV virus liquid. The resistance gene of BmNPV in the surviving individuals was heterozygous, and the negative homozygous individuals died of purulent disease; the surviving male moths were backcrossed with the "Suhao×Zhongye" silkworm variety, and the male and female moths were crossed one by one. When the moths were separated and laid eggs, the male and female moths were numbered; the genome of the male moth was extracted, and the specific primers of the molecular marker of resistance to pyrethroid insecticides were used for detection, and the male moths with heterozygous molecular markers were selected for seed preservation to obtain the G5 generation; in the G5 generation, the resistance gene of pyrethroid pesticides existed in a heterozygous form, and the resistance gene of BmNPV existed in 50% of the individuals in a heterozygous form and 50% in a negative homozygous form;

[0129] After the S5 and G5 generations were raised normally until the second-instar silkworms, they were fed with high-concentration BmNPV virus liquid. The surviving individuals were heterozygous for the BmNPV resistance gene, and the negative homozygous individuals died of purulent disease; the surviving male moths were backcrossed with the "Suhao×Zhongye" silkworm variety, and the male and female moths were crossed one by one. When the pairs were separated and the moths were laid eggs, the male and female moths were numbered; the male moth genome was extracted, and the specific primers for the molecular markers of resistance to pyrethroid insecticides were used for detection, and the male moths with heterozygous molecular markers were selected for seed preservation, and the G6 generation was obtained; in the G6 generation, the presence of pyrethroid pesticide and BmNPV resistance genes was consistent with that of the G5 generation;

[0130] After the S6 and G6 generations were raised normally until the second-year silkworms, they were fed with high-concentration BmNPV virus liquid. The BmNPV resistance gene in the surviving individuals was heterozygous. They were self-pollinated for seed production and succession. 30-40 silkworm eggs were taken from each moth circle, marked accordingly, and the silkworm egg genome was extracted. The specific primers for the molecular marker of resistance to pyrethroid insecticides were used for detection, and the moth circles with dominant homozygous resistance genes to pyrethroid pesticides were screened out to obtain the G7 generation. In the G7 generation, the BmNPV resistance gene existed in the form of dominant homozygous: heterozygous: recessive homozygous = 1:2:1.

[0131] S7, raising single moths of the G7 generation to the second instar, feeding them with high-concentration BmNPV virus solution, investigating the survival rate, selecting moth areas that are fully resistant to BmNPV, self-pollinating and sub-generation, establishing sub-lines, and obtaining the G8 generation; in the G8 generation sub-lines, the pyrethroid pesticide resistance gene exists in a homozygous form, and the BmNPV resistance gene exists in three forms: (1) all are dominant homozygous; (2) dominant homozygous: heterozygous = 1:1; (3) dominant homozygous: heterozygous: recessive homozygous 1:2:1;

[0132] 16-18 moths of each subline of S8 and G8 generations were collected and raised to 2-year-old silkworms, and high-concentration BmNPV virus liquid was added to feed them. The survival rate was investigated. Among the sublines, those with a survival rate of less than 80% were eliminated, and the sublines with a survival rate of more than 95% in the remaining moth area were selected. After checking the economic traits, only the moth area showing full resistance to BmNPV was retained. The sublines were self-pollinated for seed production and succession, and the G9 generation was obtained.

[0133] 16-18 single moths of each subline of S9 and G9 generations were collected and raised to the second-instar silkworms. They were fed with high-concentration BmNPV virus solution and the survival rate was investigated. In each subline, those with a survival rate less than 80% were eliminated, and the sublines with a survival rate greater than 95% were selected and raised normally to the third-instar silkworms. They were fed with 0.1 mg / L cypermethrin and their resistance to pyrethroid pesticides was evaluated. Moth groups with resistance to both BmNPV and pyrethroid pesticides were obtained. The moth groups were crossed to produce seeds and continue the generation, and the G10 generation was obtained, completing the molecular breeding of the "Suhao×Zhongye" silkworm with resistance to both BmNPV and pyrethroid pesticides.

[0134] The anti-pyrethroid insecticide molecular marker is SEQ ID NO: 1, and its specific amplification primers are SEQ ID NO: 2-3.

[0135] In the high concentration BmNPV virus solution, the concentration of BmNPV virus is 10 7 cfu / mL.

[0136] Example 3 Identification and application of the pyrethroid insecticide resistance molecular marker SEQ ID NO: 4 of silkworm F7 variety

[0137] The difference from Example 1 is that the pyrethroid-resistant insecticide molecule marker is the upstream regulatory sequence of the BmGST-2 gene (SEQ ID NO: 4), and the specific primers for amplifying the upstream regulatory sequence are SEQ ID NO: 5-6. Figure 7-8 shown.

[0138] Example 4

[0139] The difference from Example 2 is that the anti-pyrethroid insecticide molecular marker is SEQ ID NO: 4, and its specific amplification primers are SEQ ID NO: 5-6.

[0140] Example 5 Identification and application of the pyrethroid insecticide-resistant molecular marker SEQ ID NO: 7 of silkworm F7 variety

[0141] The difference from Example 1 is that the pyrethroid-resistant insecticide molecule marker is the upstream regulatory sequence of the BmCXE-26 gene (SEQ ID NO: 7), and the specific primers for amplifying the upstream regulatory sequence are SEQ ID NO: 8-9. Figure 9-10 shown.

[0142] Example 6

[0143] The difference from Example 2 is that the anti-pyrethroid insecticide molecular marker is SEQ ID NO: 7, and its specific amplification primers are SEQ ID NO: 8-9.

[0144] Example 7 Identification and application of the pyrethroid insecticide-resistant molecular marker SEQ ID NO: 10 of silkworm F7 variety

[0145] The difference from Example 1 is that the pyrethroid-resistant insecticide molecule marker is the upstream regulatory sequence of the BmCYP4C1 gene (SEQ ID NO: 10), and the specific primers for amplifying the upstream regulatory sequence are SEQ ID NO: 11-12. Figure 11-12 shown.

[0146] Example 8

[0147] The difference from Example 2 is that the anti-pyrethroid insecticide molecular marker is SEQ ID NO: 10, and its specific amplification primers are SEQ ID NOs: 11-12.

[0148] Example 9

[0149] After the G10 generation was raised, its resistance to pyrethroid pesticides, resistance to BmNPV, and practical economic traits were investigated. F7 and "Su Hao × Zhong Ye" were used as the control group. The results are shown in Tables 1-3.

[0150] Table 1 Survey results of economic traits of G10 generation

[0151]

[0152] Table 2 Results of the survey on resistance to G10 deltamethrin pesticide

[0153]

[0154] Table 3 Results of the BmNPV resistance survey in the G10 generation

[0155]

Claims

1. A molecular breeding method for silkworms "Suhao × Zhongye" with resistance to BmNPV and pyrethroid pesticides, characterized in that: The method uses the silkworm variety "Su Hao × Zhong Ye" as the female parent, introduces the pyrethroid pesticide resistance trait of the silkworm F7 variety into the female parent through hybridization, and after separation of the first generation, the homozygous second generation is obtained by detection and screening of specific primers for molecular markers of resistance to pyrethroid insecticides; then the BmNPV resistance bloodline of the silkworm AN variety is introduced, and the "Su Hao × Zhong Ye" silkworm variety that is resistant to both BmNPV and pyrethroid pesticides is obtained through direct and indirect feeding screening of BmNPV.

2. The molecular breeding method of "Suhao×Zhongye" silkworms with resistance to BmNPV and pyrethroid pesticides according to claim 1, characterized in that: The method is specifically as follows: S1. Using the silkworm variety "Suhao×Zhongye" as the female parent and the silkworm variety F7 as the male parent, hybridize to obtain the G1 generation, then raise normally, self-pollinate the G1 generation to obtain the G2 generation, extract 30-40 silkworm eggs from each moth circle of the G2 generation, extract the genome, use specific primers for molecular markers of resistance to pyrethroid insecticides to detect, screen the moth circles with homozygous molecular markers, and the silkworm eggs in the moth circles obtained by screening are the G2 generation with homozygous molecular markers; S2, the G2 generation with homozygous molecular markers were raised normally and crossed with the silkworm AN variety to obtain the G3 generation; In the S3 and G3 generations, the resistance genes to pyrethroid pesticides and BmNPV were in heterozygous form. After normal feeding, the male moths were backcrossed with the "Suhao×Zhongye" variety to obtain the G4 generation. In the G4 generation, 50% of the individuals had the resistance genes to pyrethroid pesticides and BmNPV in heterozygous form, and the other 50% were homozygous negative. After the S4 and G4 generations were raised normally until the second instar, they were fed with high-concentration BmNPV virus liquid. The resistance gene of BmNPV in the surviving individuals was heterozygous, and the negative homozygous individuals died of purulent disease; the surviving male moths were backcrossed with the "Suhao×Zhongye" silkworm variety, and the male and female were crossed one by one. When the pairs were separated and the moths were laid eggs, the crossed male and female were numbered; the genome of the male moth was extracted, and the specific primers of the molecular marker of resistance to pyrethroid insecticides were used for detection, and the male moths with heterozygous molecular markers were selected for seed preservation to obtain the G5 generation; in the G5 generation, the resistance gene of pyrethroid pesticides existed in a heterozygous form, and the resistance gene of BmNPV existed in 50% of the individuals in a heterozygous form, and 50% in a negative homozygous form; After the S5 and G5 generations were raised normally until the second instar, they were fed with high-concentration BmNPV virus liquid. The surviving individuals were heterozygous for the BmNPV resistance gene, and the negative homozygous individuals died of purulent disease; the surviving male moths were backcrossed with the "Suhao×Zhongye" silkworm variety, and the male and female pairs were crossed one by one. When the pairs were separated and the moths were laid eggs, the male and female pairs were numbered; the male moth genome was extracted, and the specific primers for the molecular markers of resistance to pyrethroid insecticides were used for detection, and the male moths with heterozygous molecular markers were selected for seed preservation, and the G6 generation was obtained; in the G6 generation, the presence of pyrethroid pesticide and BmNPV resistance genes was consistent with that of the G5 generation; After the S6 and G6 generations were raised normally until the second-year silkworms, they were fed with high-concentration BmNPV virus liquid. The BmNPV resistance gene in the surviving individuals was heterozygous. They were self-pollinated for seed production and succession. 30-40 silkworm eggs were taken from each moth circle, marked accordingly, and the silkworm egg genome was extracted. The specific primers for the molecular marker of resistance to pyrethroid insecticides were used for detection, and the moth circles with dominant homozygous resistance genes to pyrethroid pesticides were screened out to obtain the G7 generation. In the G7 generation, the BmNPV resistance gene existed in the form of dominant homozygous: heterozygous: recessive homozygous = 1:2:

1. S7, raising single moths of the G7 generation to the second instar, feeding them with high-concentration BmNPV virus solution, investigating the survival rate, selecting moth areas that are fully resistant to BmNPV, self-pollinating to produce seeds, establishing sublines, and obtaining the G8 generation; in the G8 generation sublines, the pyrethroid pesticide resistance genes all exist in homozygous form, and the existence forms of the BmNPV resistance genes are divided into three types: (1) all are dominant homozygous; (2) dominant homozygous: heterozygous = 1:1; (3) dominant homozygous: heterozygous: recessive homozygous 1:2:1; 16-18 moths of each subline of S8 and G8 generations were collected and raised to 2-year-old silkworms, and high-concentration BmNPV virus liquid was added to feed them. The survival rate was investigated. Among the sublines, those with a survival rate of less than 80% were eliminated, and the sublines with a survival rate of more than 95% in the remaining moth area were selected. After checking the economic traits, only the moth area showing full resistance to BmNPV was retained. The sublines were self-pollinated for seed production and succession, and the G9 generation was obtained. 16-18 single moths of each subline of S9 and G9 generations were collected and raised to the second-instar silkworms. They were fed with high-concentration BmNPV virus solution and the survival rate was investigated. In each subline, those with a survival rate less than 80% were eliminated, and the sublines with a survival rate greater than 95% were selected and raised normally to the third-instar silkworms. They were fed with 0.1 mg / L cypermethrin and their resistance to pyrethroid pesticides was evaluated. Moth groups with resistance to both BmNPV and pyrethroid pesticides were obtained. The moth groups were crossed to produce seeds and continue the generation, and the G10 generation was obtained, completing the molecular breeding of "Suhao×Zhongye" silkworms with resistance to both BmNPV and pyrethroid pesticides.

3. The molecular breeding method of "Suhao×Zhongye" silkworms with resistance to BmNPV and pyrethroid pesticides according to claim 2, characterized in that: The anti-pyrethroid insecticide molecular marker is SEQ ID NO: 1, and its specific amplification primers are SEQ ID NO: 2-3.

4. The molecular breeding method of "Suhao×Zhongye" silkworms with resistance to BmNPV and pyrethroid pesticides according to claim 2, characterized in that: The anti-pyrethroid insecticide molecular marker is SEQ ID NO: 4, and its specific amplification primers are SEQ ID NO: 5-6.

5. The molecular breeding method of "Suhao×Zhongye" silkworms with resistance to BmNPV and pyrethroid pesticides according to claim 2, characterized in that: The anti-pyrethroid insecticide molecular marker is SEQ ID NO: 7, and its specific amplification primers are SEQ ID NO: 8-9.

6. The molecular breeding method of "Suhao×Zhongye" silkworms with resistance to BmNPV and pyrethroid pesticides according to claim 2, characterized in that: The anti-pyrethroid insecticide molecular marker is SEQ ID NO: 10, and its specific amplification primers are SEQ ID NOs: 11-12.

7. The molecular breeding method of "Suhao×Zhongye" silkworms with resistance to BmNPV and pyrethroid pesticides according to claim 2, characterized in that: In the high concentration BmNPV virus solution, the concentration of BmNPV virus is 10 7 cfu / mL or above.

Images