Application of phenylindole compound in treatment of severe fever with thrombocytopenia syndrome virus infection

Abstract

The invention relates to a compound shown in a formula I, geometric isomers thereof, pharmaceutically acceptable salts thereof, solvates thereof or hydrates thereof, and application of the compound, geometric isomers thereof, pharmaceutically acceptable salts thereof, solvates thereof or hydrates thereof in preparation of drugs, and the drugs are used for treating fever with thrombocytopenia syndrome virus infection or diseases caused by fever with thrombocytopenia syndrome virus infection in subjects. Wherein R is a 4-7-membered nitrogen heterocyclic ring. # imgabs0 #

Description

Technical Field

[0001] The present invention relates to the use of a compound represented by formula I, its geometric isomers, its pharmaceutically acceptable salts, its solvates or its hydrates in the preparation of a drug for treating HFTS virus infection or a disease caused by HFTS virus infection in a subject. Background Art

[0002] Severe fever with thrombocytopenia syndrome virus (SFTSV), also known as Dabie bandavirus. SFTSV is a tick-borne virus of the Bunyavirales order, Phenuiviridae family, and Bandavirus genus. It is a segmented negative-strand RNA virus that can cause severe fever with thrombocytopenia syndrome (SFTS) after clinical infection. In 2018, the World Health Organization (WHO) listed SFTSV as one of the emerging infectious diseases that need to be focused on during the annual research and development blueprint for key diseases.

[0003] The main clinical manifestations of SFTS are thrombocytopenia, leukopenia, fever, and general muscle aches. Severe patients can rapidly progress to respiratory failure, systemic disseminated intravascular coagulation, and systemic multiple organ dysfunction, leading to death, with a mortality rate of up to 30%. According to the "Diagnosis and Treatment Program for Fever with Thrombocytopenia Syndrome" (2023 edition) issued by the National Health Commission, symptomatic supportive treatment and treatment for complications are mainly used clinically. As of now, there are no approved SFTSV vaccines or specific antiviral drugs available clinically. Therefore, there is an urgent need to develop new safe, effective, and specific anti-SFTSV candidate compounds. Summary of the invention

[0004] The present invention aims to discover compounds having antiviral activity against SFTSV. The present inventors have found through creative research that the compound represented by formula I, its geometric isomers, its pharmaceutically acceptable salts, its solvates or hydrates thereof, such as bazedoxifene and pipindoxifene, have the function of inhibiting the replication of SFTSV and can be used to treat SFTSV infection or diseases caused by SFTSV infection.

[0005] The present invention provides the use of a compound represented by formula I, a geometric isomer thereof, a pharmaceutically acceptable salt thereof, a solvate thereof or a hydrate thereof in the preparation of a medicament, wherein the medicament is used to treat a fever with thrombocytopenia syndrome virus infection or a disease caused by the fever with thrombocytopenia syndrome virus infection in a subject.

[0006]

[0007] Wherein: R is a 4-7 membered nitrogen heterocyclic group.

[0008] The present invention also provides the use of a pharmaceutical composition in the preparation of a drug, wherein the pharmaceutical composition contains the compound represented by formula I, its geometric isomers, its pharmaceutically acceptable salts, its solvates or hydrates, and a pharmaceutically acceptable carrier, and the drug is used to treat FET virus infection or a disease caused by FET virus infection in a subject.

[0009] The present invention also provides the use of the compound represented by formula I, its geometric isomers, its pharmaceutically acceptable salts, its solvates or its hydrates in the preparation of a drug for inhibiting the replication or reproduction of fever with thrombocytopenia syndrome virus in a subject.

[0010] The present invention also provides the use of a pharmaceutical composition in the preparation of a drug for inhibiting the replication or reproduction of fever with thrombocytopenia syndrome virus in a subject, wherein the pharmaceutical composition contains the compound represented by formula I, its geometric isomers, its pharmaceutically acceptable salts, its solvates or hydrates, and a pharmaceutically acceptable carrier.

[0011] The present invention also provides the use of the compound represented by formula I, its geometric isomers, its pharmaceutically acceptable salts, its solvates or its hydrates in the preparation of drugs as inhibitors of fever with thrombocytopenia syndrome viruses.

[0012] The present invention also provides the use of a pharmaceutical composition in the preparation of a drug used as a viral inhibitor for fever with thrombocytopenia syndrome, wherein the pharmaceutical composition contains the compound represented by formula I, its geometric isomers, its pharmaceutically acceptable salts, its solvates or hydrates, and a pharmaceutically acceptable carrier.

[0013] The present invention also provides a pharmaceutical composition for treating FETV infection or a disease caused by FETV infection in a subject, wherein the pharmaceutical composition contains the compound represented by Formula I, its geometric isomers, its pharmaceutically acceptable salts, its solvates or its hydrates.

[0014] The present invention also provides a pharmaceutical composition for inhibiting the replication or reproduction of fever with thrombocytopenia syndrome virus in a subject, wherein the pharmaceutical composition contains the compound represented by formula I, its geometric isomers, its pharmaceutically acceptable salts, its solvates or its hydrates.

[0015] The present invention also provides a pharmaceutical composition as a viral inhibitor of fever with thrombocytopenia syndrome, wherein the pharmaceutical composition contains the compound represented by formula I, its geometric isomers, its pharmaceutically acceptable salts, its solvates or its hydrates.

[0016] The present invention also provides a method for treating FETV infection or a disease caused by FETV infection in a subject, comprising administering to a subject in need thereof an effective amount of the compound represented by Formula I, its geometric isomers, its pharmaceutically acceptable salts, its solvates or its hydrates.

[0017] The present invention also provides a method for inhibiting the activity of fever with thrombocytopenia syndrome virus in a subject, comprising: contacting the subject with the compound represented by formula I, its geometric isomers, its pharmaceutically acceptable salts, its solvates or its hydrates, or delivering it to the subject.

[0018] The present invention also provides a method for inhibiting the activity of fever with thrombocytopenia syndrome virus in vivo or in vitro, which comprises: contacting the compound represented by formula I, its geometric isomers, its pharmaceutically acceptable salts, its solvates or its hydrates with the cells.

[0019] The present invention also provides the compound represented by Formula I, its geometric isomers, its pharmaceutically acceptable salts, its solvates or its hydrates, which are used to treat FET virus infection or diseases caused by FET virus infection in subjects.

[0020] The present invention also provides the compound represented by formula I, its geometric isomers, its pharmaceutically acceptable salts, its solvates or its hydrates, which are used to inhibit the replication or reproduction of fever with thrombocytopenia syndrome virus in a subject.

[0021] The present invention also provides the compound represented by formula I, its geometric isomers, its pharmaceutically acceptable salts, its solvates or its hydrates, which are used as inhibitors of fever with thrombocytopenia syndrome virus.

[0022] In some embodiments, the compound represented by Formula I, its geometric isomer, its pharmaceutically acceptable salt, its solvate or its hydrate is used in a subject:

[0023] (1) Reduce viremia in the body,

[0024] (2) Reduce the viral nucleic acid load level of SFTSV-infected cells,

[0025] (3) reduce the production of progeny infectious virus particles, and / or

[0026] (4) Prolong survival time.

[0027] In some embodiments, in the pharmaceutical composition, the compound represented by Formula I, its geometric isomers, its pharmaceutically acceptable salts, its solvates or its hydrates are present in an effective amount.

[0028] In some embodiments, the disease caused by FET virus infection is FET.

[0029] In some embodiments, the disease caused by FET virus infection is selected from acute fever, cough, fatigue, gastrointestinal symptoms, leukopenia and / or thrombocytopenia, multi-organ hemorrhage, disseminated intravascular coagulation (DIC), and viral encephalitis.

[0030] In some embodiments, R in Formula I is a 5-7 membered nitrogen heterocyclyl.

[0031] In some embodiments, R in Formula I is a 6-7 membered nitrogen heterocyclyl.

[0032] In some embodiments, R in Formula I is pyrrolidinyl, piperidinyl, or azepanyl.

[0033] In some embodiments, the compound of Formula I is bazedoxifene or pipindoxifene.

[0034] In some embodiments, the subject is a mammal, such as bovine, equine, ovine, porcine, canine, feline, rodent, primate, preferably human, cat, dog or pig. In some embodiments, the subject suffers from FTTS virus infection.

[0035] The pharmaceutical composition of the present invention can be formulated into any dosage form known in the medical field, for example, tablets, pills, suspensions, emulsions, solutions, gels, capsules, powders, granules, elixirs, lozenges, suppositories, injections (including injections, sterile powders for injection and concentrated solutions for injection), inhalants, sprays, etc. The preferred dosage form depends on the intended mode of administration and therapeutic use. The pharmaceutical composition of the present invention should be sterile and stable under production and storage conditions. A preferred dosage form is an injection. Such injections can be sterile injection solutions. For example, sterile injection solutions can be prepared by the following method: the pharmaceutical composition of the present invention is mixed with a necessary dose in an appropriate solvent, and optionally, other desired ingredients (including but not limited to, pH regulators, surfactants, adjuvants, ionic strength enhancers, isotonic agents, preservatives, diluents, or any combination thereof) are mixed at the same time, followed by filtration and sterilization. In addition, sterile injection solutions can be prepared as sterile lyophilized powders (for example, by vacuum drying or freeze drying) for easy storage and use. Such sterile lyophilized powders can be dispersed in a suitable vehicle, such as sterile pyrogen-free water, before use.

[0036] In addition, the compound represented by formula I, its geometric isomers, its pharmaceutically acceptable salts, its solvates or hydrates thereof, of the present invention may be present in a pharmaceutical composition in the form of a unit dosage for easy administration.

[0037] Pharmaceutical composition of the present invention can be used by any suitable method known in the art, including but not limited to, oral, oral, sublingual, eyeball, local, parenteral, rectal, leaf sheath, endocytoplasmic reticulum groove, groin, bladder, local (such as, powder, ointment or drops), or nasal route. But, for many therapeutic uses, preferred route of administration / mode is parenteral administration (such as intravenous injection, subcutaneous injection, intraperitoneal injection, intramuscular injection, intratumor injection). Technicians should understand that route of administration and / or mode will change according to the intended purpose. In part preferred embodiments, pharmaceutical composition of the present invention is given by intravenous infusion or injection.

[0038] The pharmaceutical composition of the present invention may include a "therapeutically effective amount" of the compound of formula I, its geometric isomers, its pharmaceutically acceptable salts, its solvates or its hydrates. "Therapeutically effective amount" refers to an amount sufficient to cure or at least partially prevent the disease and its complications in patients who have already suffered from the disease. The therapeutically effective amount of the compound of formula I, its geometric isomers, its pharmaceutically acceptable salts, its solvates or its hydrates of the present invention may vary according to the following factors: the severity of the disease to be treated, the overall state of the patient's own immune system, the patient's general condition such as age, weight and sex, the mode of administration of the drug, and other treatments administered simultaneously, etc. The preferred dosage here is between 0.001-1000 mg / kg body weight / day.

[0039] In the present application, the dosage regimen can be adjusted to obtain the best intended response (e.g., treatment or prevention response). For example, a single dose can be administered, multiple doses can be administered over a period of time, or the dosage can be proportionally reduced or increased according to the urgency of the treatment situation.

[0040] Definition of terms

[0041] In this application, unless otherwise specified, the scientific and technical terms used herein have the meanings commonly understood by those skilled in the art. In addition, the virology, biochemistry, and immunology laboratory operation procedures used herein are conventional procedures widely used in the corresponding fields. At the same time, in order to better understand this application, the definitions and explanations of relevant terms are provided below.

[0042] When the terms "for example," "such as," "including," "comprising," or variations thereof are used herein, these terms will not be considered as limiting terms, but will be interpreted to mean "but not limited to" or "not limited to."

[0043] The terms "a" and "an" and "the" and similar referents in the context of describing the application (especially in the context of the following claims) should be construed to cover both the singular and the plural, unless otherwise indicated herein or clearly contradicted by context.

[0044] As used herein, the term "and / or" should be considered as a specific disclosure of each of two or more specified features or elements, as well as any combination of two or more features or elements. Thus, the term "and / or" used in phrases such as "A and / or B" is intended to include "A and B", "A or B", "A" (alone), and "B" (alone).

[0045] As used herein, the term "4-7 yuan azacyclic group" refers to a saturated cyclic group having at least one nitrogen atom in its ring, and other ring members are groups of carbon atoms. The 4-7 yuan azacyclic group can be connected to the rest of the molecule by any one of the carbon atoms or a nitrogen atom. For example, as used herein, the term 4-7 yuan azacyclic group, 5-7 yuan azacyclic group or 6-7 yuan azacyclic group is to have 4-7, 5-7 or 6-7 ring members in the ring, and at least one nitrogen atom is included therein. The 4-7 yuan azacyclic group includes but is not limited to azetidinyl, pyrrolidinyl, piperidinyl and azepanyl.

[0046] As used herein, the term "pharmaceutically acceptable carrier" refers to a carrier that is pharmacologically and / or physiologically compatible with the subject and the active ingredient, which is well known in the art (see, e.g., Remington's Pharmaceutical Sciences. Edited by Gennaro AR, 19th ed. Pennsylvania: Mack Publishing Company, 1995), and includes, but is not limited to, pH regulators, surfactants, adjuvants, ionic strength enhancers, diluents, agents that maintain osmotic pressure, agents that delay absorption, and preservatives. For example, pH regulators include, but are not limited to, phosphate buffers. Surfactants include, but are not limited to, cationic, anionic or nonionic surfactants, such as Tween-80. Ionic strength enhancers include, but are not limited to, sodium chloride. Preservatives include, but are not limited to, various antibacterial and antifungal agents, such as parabens, chlorobutanol, phenol, sorbic acid, and the like. Agents that maintain osmotic pressure include, but are not limited to, sugars, NaCl, and the like. Agents that delay absorption include, but are not limited to, monostearate and gelatin. Diluents include, but are not limited to, water, aqueous buffers (such as buffered saline), alcohols and polyols (such as glycerol), etc. Stabilizers have the meanings generally understood by those skilled in the art, and are capable of stabilizing the desired activity of the active ingredient in the drug, including but not limited to sodium glutamate, gelatin, SPGA, sugars (such as sorbitol, mannitol, starch, sucrose, lactose, dextran, or glucose), amino acids (such as glutamic acid, glycine), proteins (such as dried whey, albumin or casein) or their degradation products (such as lactalbumin hydrolysate), etc.

[0047] As used herein, the term "treatment" refers to a method implemented in order to obtain a beneficial or desired clinical outcome. For the purposes of the present application, a beneficial or desired clinical outcome includes, but is not limited to, alleviating symptoms, reducing the scope of the disease, stabilizing (i.e., no longer worsening) the state of the disease, delaying or slowing the development of the disease, improving or alleviating the state of the disease and alleviating symptoms (whether partially or completely), whether detectable or undetectable. In addition, "treatment" may also refer to, compared to the expected survival period (if not treated), extending the survival period.

[0048] As used herein, the term "fever with thrombocytopenia syndrome virus" is also known as Dabie bandavirus, a tick-borne virus of the Bunyavirales order, Phenuiviridae family, genus Bandavirus, which can cause severe fever with thrombocytopenia syndrome (SFTS)

[0049] Beneficial technical effects of the present invention

[0050] The compounds shown in formula I provided by the present invention, such as bazedoxifene and pipindoxifene, can reduce the cytopathic effect caused by SFTSV infection on cells, inhibit the replication of the SFTSV viral genome, and reduce the release of SFTSV progeny virus particles in cell culture.

[0051] The compounds of formula I provided by the present invention, such as bazedoxifene and pipindoxifene, can reduce viremia in mice, prolong the survival time of ICR suckling mice infected with a lethal dose of SFTSV, and improve their survival rate.

[0052] The compounds of Formula I provided by the present invention, such as bazedoxifene and pipendoxifen, have the following characteristics of action in cells: they can reduce the viral nucleic acid load level of SFTSV-infected cells and the production of progeny infectious virus particles at micromolar concentrations.

[0053] The compounds of formula I provided by the present invention, such as bazedoxifene and pipindoxifene, can be used to treat SFTSV infection or diseases caused by SFTSV infection. BRIEF DESCRIPTION OF THE DRAWINGS

[0054] Figure 1 represents the structural formula of bazedoxifene and piperidoxifene, wherein A represents the structural formula of bazedoxifene (R=cycloheximide); and B represents the structural formula of piperidoxifene (R=piperidinyl).

[0055] Figure 2Figure 2 represents the CPE protective effect of bazedoxifene and pipezedoxifene against SFTSV in Huh7 cells, where A represents the antiviral activity and cytotoxicity of bazedoxifene against SFTSV in Huh7 cells; B represents the antiviral activity and cytotoxicity of pipezedoxifene against SFTSV in Huh7 cells, the left ordinate represents the inhibition rate of SFTSV, corresponding to the red marking in the figure; the right ordinate represents the cytotoxicity, corresponding to the blue marking in the figure; the abscissa represents the drug concentration.

[0056] Figure 3 It indicates that bazedoxifene and pinzazofene inhibit SFTSV RNA replication and infectious virus particle formation, wherein A and C indicate that bazedoxifene can inhibit the viral nucleic acid load and virus particle formation in Huh7 cells after Huh7 is infected with SFTSV for 48h, and the inhibitory activity is dose-dependent; B and D indicate that pinzazofene can inhibit the viral nucleic acid load and virus particle formation in Huh7 cells after Huh7 is infected with SFTSV for 48h, and the inhibitory activity is dose-dependent. In A and B, the ordinate is the percentage of viral RNA copy number in the sample (with the virus control as 100%), and the abscissa is the drug concentration. In C and D, the ordinate is the percentage of infectious virus particle formation (with the virus control as 100%), and the abscissa is the drug concentration.

[0057] Figure 4 The figure represents the cytotoxicity validation results of bazedoxifene and piperidoxifene in Huh7 cells, wherein A represents that no cytotoxicity was observed after Huh7 cells were treated with bazedoxifene at the tested concentration for 48 h. B represents that no cytotoxicity was observed after Huh7 cells were treated with piperidoxifene at the tested concentration for 48 h. The ordinate represents the cell viability percentage of Huh7 cells relative to the cell control group, and the abscissa represents the drug concentration.

[0058] Figure 5 It indicates that bazedoxifene exerts an antiviral effect after entering the SFTSV infection cycle, where A represents the different infection stages of SFTSV in this experiment, B represents that bazedoxifene can effectively reduce the viral nucleic acid load in SFTSV-infected Huh7 cells in stages III and IV, the ordinate represents the percentage of the number of viral RNA copies in the sample relative to the virus control group, and the abscissa represents the different virus infection stages.

[0059] Figure 6 It indicates that bazedoxifene can improve the survival rate of 1-day-old ICR suckling mice lethally infected with SFTSV, wherein A represents the survival curve and B represents the body weight curve. Bazedoxifene was injected intraperitoneally once a day 4 hours before the mice were challenged with the virus and in the following period, and the control group was injected with the same volume of solvent. After administration of bazedoxifene, the survival rate of 1-day-old ICR suckling mice lethally infected with SFTSV was significantly prolonged.

[0060] Figure 7 It indicates that bazedoxifene can reduce the viremia of 6-week-old BALB / c mice infected with SFTSV, wherein A indicates that bazedoxifene can inhibit the viral nucleic acid load in the blood of mice 24 hours after infection with SFTSV, and the inhibitory activity is dose-dependent. The ordinate represents the percentage of the number of viral RNA copies in the sample relative to the virus control group, and the abscissa represents the drug concentration. DETAILED DESCRIPTION

[0061] The substantive content of the present invention is further described below in conjunction with specific embodiments of the present invention. It should be understood that the following examples are only used to illustrate the present invention, but are not intended to limit the scope of protection of the present invention. In the following examples, if specific conditions are not specified, they are carried out according to conventional conditions or manufacturer recommendations. The raw materials used are not specified by the manufacturer, and are all conventional products that can be obtained commercially.

[0062] Although many materials and operating methods used in the following examples are well known in the art, the present invention is still described in as much detail as possible. It is clear to those skilled in the art that the materials and operating methods used in the following examples are well known in the art unless otherwise specified.

[0063] The experimental materials used in the embodiments of the present invention are as follows:

[0064] Human liver cancer cells (Huh7 cells) were purchased from the National Laboratory Cell Resource Sharing Platform (Cat. No.: SCSP-526). The above cells were cultured in a cell culture incubator at 37°C and 5% CO2. The complete medium used for cell growth was DMEM high-glucose medium (purchased from Gibco, Cat. No.: 2367374) supplemented with 10% FBS (purchased from Gibco, Cat. No.: 16000044) and penicillin-streptomycin (purchased from Gibco, Cat. No.: 2321152). The maintenance medium used for cell culture was DMEM high-glucose medium supplemented with 2% FBS and penicillin-streptomycin.

[0065] The 96-well plate was purchased from Corning (Cat. No. 165306). The 12-well plate was purchased from Corning (Cat. No. 3512).

[0066] SFTSV strains were isolated and stored from clinical samples by our laboratory according to standard operating procedures (GenBank accession numbers: MZ561690, MZ561691, and MZ561692).

[0067] The compound bazedoxifene was purchased from Selleck (Cat. No. S2128). The compound piedoxifene was purchased from MedChemExpress (Cat. No. HY-13724). The structural formulas of bazedoxifene and piedoxifene are as follows: Figure 1 shown.

[0068] Cell-Titer Luminescent Cell Viability assay solution was purchased from Promega (Cat. No. G7572).

[0069] The microplate reader was purchased from Molecular Devices, model SpectraMax M5.

[0070] TRIzol reagent was purchased from Invitrogen (Cat. No. 15596026).

[0071] One Step PrimeScript TM The RT-PCR kit was purchased from Takara (Cat. No. RR47Q).

[0072] The SFTSV standard plasmid and qRT-PCR primers were synthesized by Sangon Biotechnology (Shanghai) Co., Ltd.

[0073] Analytical grade low melting point agarose was purchased from Promega (Cat. No.: V2111).

[0074] Ammonium oxalate crystal violet stain (1%) was purchased from Meilun Biotechnology (Cat. No. MA0149).

[0075] The IVC mouse cage was purchased from Tecniplast, model DVC ISO.

[0076] Example 1 In vitro anti-SFTSV activity evaluation experiment of bazedoxifene and piperidoxifene based on cytopathic effect

[0077] (1) Evaluation of the in vitro anti-SFTSV activity of bazedoxifene and pinzadoxifene

[0078] Huh7 cells were plated at approximately 5.0 × 10 3 The density of 100 × TCID was inoculated into a 96-well plate with a white wall and a transparent bottom, and cultured at 37°C and 5% CO2 for 24 hours. The SFTSV virus solution was then diluted with cell maintenance medium and added to the 96-well plate to a final concentration of 100 × TCID 50 At the same time, the test compound was diluted with cell maintenance medium and added to a 96-well plate to a final concentration of 100 μM, 33 μM, 11 μM, 0.37 μM, 0.12 μM, 0.04 μM, 0.01 μM and 0.005 μM. After about 5 days, the supernatant was discarded and the diluted Cell-Titer Luminescent Cell Viability Assay Solution was added, and the cells were shaken and lysed for 5 minutes in the dark, and then allowed to stand for 3 minutes. Finally, the luminescence value of each well was measured using an ELISA reader.

[0079] The calculation formula of the virus inhibition rate of the test compound is:

[0080]

[0081] (2) Cytotoxicity of bazedoxifene and pinzadoxifene on Huh7 cells

[0082] Huh7 cells were plated at approximately 5.0 × 10 3 The cells were inoculated into a 96-well plate with a white wall and a transparent bottom at a density of 100 μM, 33 μM, 11 μM, 0.37 μM, 0.12 μM, 0.04 μM, 0.01 μM and 0.005 μM, respectively. After 5 days, the supernatant was discarded and the diluted Cell-Titer Luminescent Cell Viability Assay Solution was added, and the cells were shaken and lysed for 5 minutes in the dark, and then allowed to stand for 3 minutes. Finally, the luminescence value of each well was measured using an ELISA reader.

[0083] The inhibition rate calculation formula of each dilution of the test compound is:

[0084]

[0085] (3) Data analysis

[0086] Origin9.0 software was used to fit the inhibition rate-concentration S-type curve and calculate the half-maximal effective concentration (EC) of the tested compound. 50 The half-cytotoxic concentrations (CC) of the tested compounds were calculated using the same method. 50 ) and in accordance with EC 50 and CC 50 Calculate the selection index (SI), SI = CC 50 / EC 50 .

[0087] (4) Experimental results

[0088] The experimental results are shown in Table 1-1, Table 1-2 and Figure 2As shown in Figure 3, both bazedoxifene and pinzedoxifene could inhibit the cytopathic effect of virus in Huh7 cells infected with SFTSV in a dose-dependent manner. 50 Value, CC 50 The values ​​and SI were 0.35±0.09μM, 3.81±1.67μM and 10.89, respectively. 50 Value, CC 50 The values ​​and SI were 0.33±0.20μM, 3.02±0.39μM and 9.15, respectively.

[0089] Table 1-1. Verification of in vitro antiviral activity of bazedoxifene

[0090] Concentration (μM) 3.33 1.11 0.37 0.12 0.04 0.01 Inhibition rate (%) 81.76±19.81 97.96±23.35 59.79±27.79 14.82±16.63 -3.60±10.68 -3.10±6.76 Cytotoxicity (%) 19.96±12.67 -20.31±20.45 -22.59±18.57 -11.06±7.50 -5.83±4.84 -2.92±6.90

[0091] Table 1-2. Verification of in vitro antiviral activity of Pidoxifene

[0092] Concentration (μM) 1.11 0.37 0.12 0.04 0.014 0.005 Inhibition rate (%) 129.04±8.08 90.07±33.03 43.55±34.56 17.18±14.72 4.92±5.68 -0.94±0.12 Cytotoxicity (%) -20.63±0.05 -25.85±2.18 -25.05±6.68 -18.7±11.26 -11.59±14.73 2.81±19.58

[0093] Example 2 Experiment on the inhibition of SFTSV RNA replication by bazedoxifene and pipindoxifene and the production of infectious virus particles in the supernatant (1) Experiment on the inhibition of SFTSV RNA replication by bazedoxifene and pipindoxifene

[0094] ① Huh7 cells were cultured at a rate of approximately 1×10 5 The density of 100 μg / mL was inoculated in 12-well plates and cultured for 24 hours at 37 ° C and 5% CO2. The SFTSV virus solution was subsequently diluted to 0.01 MOI with cell maintenance medium and added to 12-well plates. The test compounds bazedoxifene and doxyfen were diluted to corresponding concentrations with cell maintenance medium and added to 12-well plates so that the final concentrations of bazedoxifene were 3.00 μM, 1.00 μM, 0.33 μM, 0.11 μM and 0.04 μM, and the final concentrations of doxyfen were 1.50 μM, 0.50 μM, 0.16 μM, 0.05 μM and 0.02 μM. Incubated for 48 hours at 37 ° C and 5% CO2, the supernatant was collected, centrifuged and dispensed at 8000 rpm × 5 min, and stored at -80 ° C for use. After each well of the remaining lower layer cells was washed 3 times with 1 mL PBS, the total RNA in the cells was extracted according to the TRIzol reagent specification.

[0095] ②qRT-PCR detection

[0096] 1) Prepare the standard using the recombinant SFTSV linearized plasmid: Calculate the copy number of the standard based on the linearized plasmid concentration and molecular weight, and dilute it accurately to 10 -1 , 10 -2 , 10 -3 , 10-4 , 10 -5 , 10 -6 , 10 -7 , 10 -8 The concentration was doubled until the copy number was lower than the detection limit of the fluorescence quantitative PCR instrument. After the standard was prepared, the standard of each concentration was divided into aliquots and stored at -80℃ for later use.

[0097] 2) Use One Step PrimeScript TM The RT-PCR kit was used to detect the RNA load of SFTSV in the sample. The primer and probe sequences used in the experiment were as follows:

[0098] Forward primer:GGGTCCCTGAAGGAGTTGTAAA

[0099] Reverse primer: TGCCTTCACCAAGACTATCAATGT

[0100] Probe:TTCTGTCTTGCTGGCTCCGCGC

[0101] 3) The reaction procedure is as follows:

[0102] Reverse transcription: 42°C for 25 minutes;

[0103] Pre-denaturation: 95°C for 3 minutes;

[0104] Signal acquisition: 95°C for 20 s, 59°C for 1 min, for a total of 45 cycles.

[0105]

[0106] (2) Plaque forming unit (PFU) experiment

[0107] Huh7 cells were expressed at approximately 1 × 10 5 The supernatant samples were diluted to 10% with DMEM medium containing 2% FBS. -1 , 10 -2 , 10 -3 , 10 -4 , 10 -5 , 10 -6 , 10 -7 , 10 -8Times the concentration. Discard the supernatant of the 12-well plate, add 500 μL of supernatant samples of different dilutions to each well, and adsorb at 37°C for 2 hours. After 2 hours, discard the supernatant, wash each well twice with 1 mL PBS, add 1 mL agarose medium to each well, let it stand at 4°C for 5 minutes until the agarose medium solidifies, and continue to culture in a cell culture incubator for 3-4 days. When virus plaques appear, add 1 mL 4% formaldehyde to each well and fix at room temperature for at least 4 hours, wash off the upper agarose medium with running water, add 1% crystal violet to stain for 15 minutes, aspirate the dye and rinse and dry, count the plaques, and calculate PFU according to the following formula:

[0108]

[0109] (3) Statistical analysis

[0110] Statistical significance was calculated using one-way ANOVA using GraphPad Prism 8 software. Data are presented as mean ± SD. p < 0.05 indicated statistical significance.

[0111] (4) Experimental results

[0112] The experimental results are shown in Table 2-1, Table 2-2 and Figure 3 As shown, both bazedoxifene and pipindoxifene inhibited the replication of SFTSV RNA in a dose-dependent manner ( Figure 2 A and C), and also inhibited the production of infectious virus particles ( Figure 2 B and D).

[0113] Table 2-1. In vitro antiviral experiments of bazedoxifene

[0114]

[0115] Table 2-2. In vitro antiviral experiments of Pidoxifene

[0116]

[0117] Example 3 Cytotoxicity Verification Experiment of Bazedoxifene and Pidoxifene on Huh7 Cells

[0118] (1) Experimental methods:

[0119] Huh7 cells were plated at approximately 1 × 10 5The cells were inoculated into 12-well plates at a density of 1.00 μM, 1.00 μM, 0.33 μM, 0.11 μM and 0.04 μM, and the cells were incubated at 37°C, 5% CO2 for 24 hours. The test compounds bazedoxifene and pipindoxifene were then diluted to the corresponding concentrations with cell maintenance medium and added to the 12-well plates, so that the final concentrations of bazedoxifene were 3.00 μM, 1.00 μM, 0.33 μM, 0.11 μM and 0.04 μM, and the final concentrations of pipindoxifene were 1.50 μM, 0.50 μM, 0.16 μM, 0.05 μM and 0.02 μM. The cells were incubated at 37°C, 5% CO2 for 48 hours, the supernatant was discarded, and the diluted Cell-Titer Luminescent Cell Viability Assay Solution was added, and the cells were shaken and lysed for 5 minutes in the dark, and then allowed to stand for 3 minutes. Finally, the luminescence value of each well was measured using an ELISA reader.

[0120] (2) Statistical analysis

[0121] Statistical significance was calculated using one-way ANOVA using GraphPad Prism 8 software. Data are presented as mean ± SD. p < 0.05 indicated statistical significance.

[0122] (3) Experimental results

[0123] The experimental results are shown in Table 3-1, Table 3-2 and Figure 4 As shown, bazedoxifene and pipindoxifene were not cytotoxic to Huh7 cells within a specific concentration range.

[0124] Table 3-1. Cytotoxicity test of bazedoxifene on Huh7 cells

[0125] Concentration (μM) 3.33 1.11 0.37 0.12 0.04 Blank control group Cell survival rate% 94.9±3.19 103.56±2.56 107.01±3.49 106.82±3.07 106.94±4.77 100±0.00

[0126] Table 3-2. Cytotoxicity test of pirindoxifene on Huh7 cells

[0127] Concentration (μM) 1.50 0.500 0.167 0.056 0.019 Blank control group Cell survival rate% 103.09±5.26 105.04±9.83 102.34±4.39 101.12±1.05 101.14±0.45 100±0.00

[0128] Example 4 Bazedoxifene anti-SFTSV mechanism of action verification experiment

[0129] (1) Timing experiment

[0130] The concentration of bazedoxifene used in the experiment was 3 μM, the concentration of the positive compound T-705 (favipiravir) was 100 μM, and the SFTSV infection dose was 0.01 MOI. The specific steps were: Huh7 cells were plated at approximately 1.0×10 5The cells were inoculated at a density of 1.50 μg / ml in a 12-well plate and cultured at 37°C and 5% CO2 for 24 hours. The test compound bazedoxifene, the positive compound T-705, and the SFTSV virus solution were then diluted to the corresponding concentrations using cell maintenance medium and then cultured according to Figure 5 The pre-diluted compound was added at the time points shown in A (stage I: -2h~0h, stage II: 0h~2h, stage III: 0h~24h, stage IV: 2h~24h), and the virus was added at the 0h time point. After continuing to culture for 24 hours, the supernatant was collected, centrifuged at 8000rpm×5min, packaged, and stored at -80℃ for use. The remaining lower layer cells were washed 3 times with 1mL PBS per well, and the total RNA in the cells was extracted by TRIzol method. The intracellular viral RNA load and viral particle formation were detected by qRT-PCR and PFU methods, and the specific experimental conditions were the same as described above.

[0131] (2) Statistical analysis

[0132] Statistical significance was calculated using one-way ANOVA using GraphPad Prism 8 software. Data are presented as mean ± SD. p < 0.05 indicated statistical significance.

[0133] (3) Experimental results

[0134] The experimental results are shown in Table 4 and Figure 5 As shown, after adding bazedoxifene at different stages of SFTSV infection in Huh7 cells, the intracellular SFTSV RNA load and virus particle formation were detected. The experimental results showed that bazedoxifene mainly played a role in the post-entry stage of viral infection and had no obvious inhibition on the adsorption and entry of the virus.

[0135] Table 4. Experiments to verify the mechanism of action of bazedoxifene against SFTSV

[0136] Group Ⅰ Ⅱ Ⅲ Ⅳ Virus control group Blank control group Bazedoxifene inhibition rate % 85.42±2.69 69.70±14.08 35.69±4.46 45.62±1.40 100±0.00 0.00±0.00 T-705 inhibition rate % 101.04±9.66 94.60±1.75 28.33±0.79 32.35±5.20 100±0.00 0.00±0.00

[0137] Example 5 Experiment on the protection of bazedoxifene against lethal infection of SFTSV in 1-day-old ICR suckling mice

[0138] (1) Experimental animals

[0139] The one-day-old ICR offspring used in the experiment were SPF grade, purchased from Beijing Weitonglihua Experimental Animal Technology Co., Ltd., with a clear source and passed the inspection.

[0140] (2) Experimental procedures

[0141] Three litters of one-day-old ICR offspring were randomly divided into three groups, namely, a virus control group and a drug-treated group (two groups), and the doses of bazedoxifene were 10 mg / kg and 5 mg / kg, respectively. Each mouse was intraperitoneally challenged with 1.25×10 6 PFU, the first intraperitoneal administration was carried out 6 hours later, the virus control group was given the drug solvent, and then the drug was administered once a day for 7 consecutive days. The survival and weight changes of the mice were weighed and recorded every day.

[0142] (3) Statistical analysis

[0143] The statistical significance of the survival curve was calculated using Log-Rank of GraphPad Prism 8 software. p<0.05 indicated statistical significance.

[0144] (4) Experimental results

[0145] The experimental results are shown in Table 5 and Figure 6 As shown: Bazedoxifene showed a dose-dependent protective effect on ICR suckling mice inoculated with a lethal dose of SFTSV. Compared with the virus control group, the survival rate of 1-day-old ICR suckling mice was significantly increased at a dose of 10 mg / kg ( Figure 6 ).

[0146] Table 5. Protection experiment of bazedoxifene against lethal infection of SFTSV in 1-day-old ICR suckling mice - body weight record

[0147]

[0148]

[0149] Example 6 Experiment on the inhibition of viremia caused by SFTSV infection in BALB / c mice by bazedoxifene

[0150] (1) Experimental animals

[0151] The 6-week-old female BALB / c mice used in the experiment were SPF grade and purchased from Beijing Weitonglihua Experimental Animal Technology Co., Ltd. The source was clear and passed the inspection.

[0152] (2) Detection of SFTSV viral load in the blood of 6-week-old BALB / c mice

[0153] Forty 6-week-old BALB / c mice were randomly divided into five groups, namely, virus control group, 30 mg / kg drug group, 10 mg / kg drug group, 3 mg / kg drug group and blank control group. Each mouse was intraperitoneally challenged with 1×10 5PFU, the infection time was set as 0 hours, and the drug was administered by gavage three times at -12 hours, 0 hours and 12 hours. The virus control group and the blank control group were given the drug solvent. Eyeballs were removed and blood was collected 24 hours after infection. RNA was extracted using TRIzol reagent, and then the viral RNA in the blood was quantitatively analyzed by qRT-PCR.

[0154] (4) Statistical analysis

[0155] Statistical significance was analyzed using unpaired t-test using GraphPad Prism 8 software. p < 0.05 indicated statistical significance.

[0156] (5) Experimental results

[0157] The experimental results are shown in Table 6 and Figure 7 As shown, bazedoxifene treatment significantly reduced the viral load in the blood of mice. The above results indicate that bazedoxifene has anti-SFTSV activity in vivo.

[0158] Table 6. Experiment on the inhibition of viremia caused by SFTSV infection in BALB / c mice by bazedoxifene

[0159]

[0160] Although the specific embodiments of the present invention have been described in detail, it will be understood by those skilled in the art that various modifications and substitutions may be made to those details based on all the teachings disclosed, and these changes are within the scope of protection of the present invention. The full scope of the present invention is given by the attached claims and any equivalents thereof.

Claims

1. Use of a compound represented by formula I, its geometric isomers, its pharmaceutically acceptable salts, its solvates or its hydrates in the preparation of a medicament, wherein the medicament is used to treat a fever with thrombocytopenia syndrome virus infection or a disease caused by a fever with thrombocytopenia syndrome virus infection in a subject, in: R is a 4-7 membered nitrogen heterocyclic ring.

2. Use of a pharmaceutical composition in the preparation of a drug, wherein the pharmaceutical composition contains a compound represented by formula I, a geometric isomer thereof, a pharmaceutically acceptable salt thereof, a solvate thereof or a hydrate thereof, and a pharmaceutically acceptable carrier, and the drug is used to treat fever with thrombocytopenia syndrome virus infection or a disease caused by fever with thrombocytopenia syndrome virus infection in a subject, in: R is a 4-7 membered nitrogen heterocyclic ring.

3. The use according to claim 1 or 2, wherein the disease caused by FET virus infection is FET.

4. The use of claim 1 or 2, wherein the disease caused by fever with thrombocytopenia syndrome virus infection is selected from acute fever, cough, fatigue, gastrointestinal symptoms, leukopenia and / or thrombocytopenia, multi-organ hemorrhage, disseminated intravascular coagulation and viral encephalitis.

5. Use of the compound represented by formula I, its geometric isomers, its pharmaceutically acceptable salts, its solvates or its hydrates in the preparation of a medicament, wherein the medicament is used to inhibit the replication or reproduction of fever with thrombocytopenia syndrome virus in a subject, in: R is a 4-7 membered nitrogen heterocyclic ring.

6. Use of a pharmaceutical composition in the preparation of a drug, wherein the pharmaceutical composition contains a compound represented by formula I, a geometric isomer thereof, a pharmaceutically acceptable salt thereof, a solvate thereof or a hydrate thereof, and a pharmaceutically acceptable carrier, and the drug is used to inhibit the replication or reproduction of fever with thrombocytopenia syndrome virus in a subject, in: R is a 4-7 membered nitrogen heterocyclic ring.

7. Use of the compound represented by formula I, its geometric isomers, its pharmaceutically acceptable salts, its solvates or its hydrates in the preparation of a drug, wherein the drug is a fever with thrombocytopenia syndrome virus inhibitor, in: R is a 4-7 membered nitrogen heterocyclic ring.

8. Use of a pharmaceutical composition in the preparation of a drug, wherein the pharmaceutical composition comprises a compound represented by formula I, a geometric isomer thereof, a pharmaceutically acceptable salt thereof, a solvate thereof or a hydrate thereof, and a pharmaceutically acceptable carrier, and the drug is a fever with thrombocytopenia syndrome virus inhibitor, in: R is a 4-7 membered nitrogen heterocyclic group.

9. The use according to any one of claims 1, 2, 5 to 8, wherein R is a 5-7 membered nitrogen heterocyclic group; Preferably, R is a 6-7 membered nitrogen heterocyclic group; Preferably, R is azetidinyl, pyrrolidinyl, piperidinyl or azepanyl; Preferably, the compound is bazedoxifene or pipindoxifene.

10. The use according to any one of claims 1, 2, 5-8, wherein the subject is a mammal, such as bovine, equine, caprine, porcine, canine, feline, rodent, primate, preferably human, cat, dog or pig.

Images