Application of USP33 inhibitor in preparation of anti-SARS-CoV-2 virus drug, antiviral drug and preparation method of antiviral drug

Abstract

The invention provides an application of a USP33 inhibitor in preparation of an anti-SARS-CoV-2 virus drug, an antiviral drug and a preparation method of the antiviral drug. According to the invention, a novel regulation and control mode of the E protein of the novel coronavirus SARS-CoV-2 is found, that is, the USP33 can enhance the stability of the E protein by removing a K48 polyubiquitin chain, and compared with deubiquitination modification caused by USP32 and USP39, the regulation and control can promote the stability of the E protein better. On the basis, the USP33 inhibitor is designed to be used for preparing the medicine for resisting the SARS-CoV-2 virus, and a new treatment way is provided for resisting SARS-CoV-2 infection.

Description

Technical Field

[0001] The present invention belongs to the technical field of nucleic acid drugs and preparation thereof, and specifically relates to the use of USP33 inhibitors in the preparation of anti-SARS-CoV-2 virus drugs, antiviral drugs and preparation methods thereof. Background Art

[0002] The virus particles of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) are composed of four main structural proteins, namely spike protein (S), nucleocapsid protein (N), membrane protein (M) and envelope protein (E). Among these structural proteins, the envelope protein (E) is the smallest, consisting of only 75 amino acid residues. Despite its small size, the envelope protein shows a high expression level after the virus infects cells, a phenomenon that is closely related to the pathogenicity of the virus. Studies have shown that the envelope protein participates in the assembly and stabilization of viral particles through interaction with the membrane protein (M). In addition, the envelope protein can form ion channels, affect the integrity of the cell membrane, and regulate the ion balance inside and outside the host cell, thereby leading to apoptosis of the host cell. Further studies have also found that the envelope protein can promote the formation and activation of the NLRP3 inflammasome, thereby triggering the release of the inflammatory factor IL-1β and exacerbating the inflammatory response.

[0003] The ubiquitin-proteasome system is a key pathway for intracellular protein degradation that can rapidly recognize and degrade specific viral proteins, thereby mitigating the pathogenic effects of the virus. For example, the ORF6, NSP5, and NDP8 proteins of SARS-CoV-2 can be tagged with polyubiquitin chains and degraded by the proteasome in a short period of time. The ubiquitination process involves an enzyme cascade mediated by E1 activating enzymes, E2 conjugating enzymes, and about 600 E3 ubiquitin ligases. In contrast, deubiquitinating enzymes can rapidly cut off ubiquitin chains and reverse the above process. Viruses can also use the host's deubiquitinating enzymes to resist degradation. Therefore, the discovery of deubiquitinating enzymes that can stabilize viral proteins and interfere with this degradation process is seen as a potential antiviral strategy.

[0004] Ubiquitin-specific protease 33 (USP33), a protein with deubiquitinase activity, has been shown to be involved in regulating oncogenic signaling pathways and is therefore considered a potential target for cancer treatment. Recent studies have further revealed the key role of USP33 in neurodegenerative diseases, inflammatory responses, and metabolic disorders. This invention innovatively discovered that USP33 can act as a deubiquitinase for the E protein in the SARS-CoV-2 virus, playing a vital role in viral infection and replication.

[0005] E protein was initially identified as a protein susceptible to degradation by the ubiquitin-proteasome system. However, compared with those rapidly degraded viral proteins, such as ORF9b and ORF6, E protein has a relatively long half-life of approximately 16 hours. This suggests that in host cells, potential antagonism of deubiquitinases may offset the degradation process of E protein. Previous studies have reported that the stability of various proteins can be regulated by various deubiquitinases, such as PTEN and p53. In the present invention, we found that USP33 can significantly enhance the stability of E protein and promote viral replication. USP33 can selectively target E protein and contact with viral PLpro to increase its stability. The loss of USP33 leads to rapid ubiquitination and degradation of E protein, resulting in impaired viral replication and inflammatory response. Compared with the previously reported USP39, USP33 can further enhance the stability of E protein. In addition, unlike the case where the expression level of USP39 increased slightly after viral infection, we did not observe changes in the total protein level of USP33 after viral infection in various cell lines. However, transcriptome data from whole blood revealed that patients with mild and severe disease after infection had higher levels of USP33 mRNA than healthy individuals. This suggests that high expression of USP33 may be one of the causes of more severe disease rather than a direct consequence of infection. USP33 is expressed in both the cytoplasm and the nucleus and interacts with the E protein in the cytoplasm. Interestingly, in the context of SARS-CoV-2 infection, we observed that USP33 migrated from the nucleus to the cytoplasm. However, ectopic expression of the E protein alone had no effect on the localization of USP33. This may be due to the presence of other viral proteins that interact with USP33, such as M and ORF7b, thereby affecting its nuclear localization. According to our results and previous reports, the E protein is mainly localized in the cytoplasm, suggesting that USP33 regulates the stability of the E protein through a mechanism different from that of USP39. These findings reveal the complexity and multidimensionality of the ubiquitination process of viral proteins in host cells and highlight the potential value of combined therapeutic strategies. Summary of the invention

[0006] The primary purpose of the present invention is to provide an application of a USP33 (sequence is detailed in the sequence table) inhibitor in the preparation of anti-SARS-CoV-2 virus drugs. The present invention has discovered a new regulation mode of the E protein of the new coronavirus SARS-CoV-2, that is, USP33 can enhance the stability of the E protein by removing the K48 polyubiquitin chain, and this regulation has a more stable effect than the deubiquitination modification of the E protein caused by USP32 and USP39, and thus a USP33 inhibitor is designed for the preparation of anti-SARS-CoV-2 virus drugs.

[0007] Further,

[0008] The USP33 inhibitors include: siUSP33.

[0009] Further,

[0010] The siUSP33 sequence is at least one of the following:

[0011] hUSP33#1:CCCAGUAAUACAACAUUAATT

[0012] hUSP33#2:GGAGAAUAGAUGUUCAUAUTT

[0013] hUSP33#3:GCUGCAUUCAUCAAGUCAUTT

[0014] mUSP33#1:GCAGGAGACAAAGCAUUAUTT

[0015] mUSP33#2:GCCGGCUAAUCUGUUCCAATT

[0016] mUSP33#3:GCAGAGCCUCAGAAUCUAUTT

[0017] mUSP33#4:GCUGAACCUGGCCCUAUUUTT;

[0018] Preferred:

[0019] mUSP33#1:GCAGGAGACAAAGCAUUAUTT.

[0020] Furthermore,

[0021] The USP33 inhibitor comprises: lipid nano delivery particles and siUSP33 in combination.

[0022] The final molar ratio of the USP33 inhibitor is Dlin-MC3-DMA: DSPC: cholesterol: DMG-PEG: DOTAP = 23-26: 4-6: 19-20: 0.6-1: 48-52.

[0023] Among them, Dlin-MC3-DMA is an ionizable cationic lipid, which is often used as a carrier for delivering siRNA; DSPC (distearoylphosphatidylcholine) is often used to internalize siRNA; cholesterol can be used to prevent net outflow or inflow to maintain membrane integrity; DMG-PEG (dimyristoylglycerol-polyethylene glycol) provides an external polymerization layer to prevent serum protein adsorption and uptake by the mononuclear phagocyte system, prolong the circulation time in the body, and prevent the aggregation of nanoparticles during storage and in the blood; DOTAP ((2,3-dioleyloxypropyl)trimethylammonium chloride) can stably encapsulate nucleic acids inside liposomes through electrostatic effects, and form a lipid bilayer through its hydrophobic tail to encapsulate nucleic acids and drugs.

[0024] The preparation steps of the USP33 inhibitor of the present invention include:

[0025] The preparation steps of the USP33 inhibitor include: 1) taking Dlin-MC3-DMA: DSPC: cholesterol: DMG-PEG: DOTAP = 50mg: 6mg: 5mg: 4mg: 45mg, dissolving them together in 3mL of anhydrous ethanol to obtain a lipid solution, transferring it to an eggplant-shaped flask, dissolving 5.6mg siUSP33 in 1mL of 50mM citric acid buffer with a pH of 4 and containing 25% ethanol, slowly adding it to the lipid solution, mixing it, and incubating it for 20 minutes; treating it with ultrasound and a liposome extruder through a 100nm filter membrane; 2) dialyzing it with a nanodialysis device, using a polycarbonate membrane with a pore size of 10nm; 3) freeze-drying: adding a freeze-drying protectant and freeze-drying it.

[0026] The second aspect of the present invention aims to provide an anti-SARS-CoV-2 virus drug, which is the above-mentioned USP33 inhibitor.

[0027] The third aspect of the present invention aims to provide a method for preparing the anti-SARS-CoV-2 virus drug, comprising the following steps:

[0028] The preparation steps of the USP33 inhibitor include: 1) taking Dlin-MC3-DMA: DSPC: cholesterol: DMG-PEG: DOTAP = 50mg: 6mg: 5mg: 4mg: 45mg, dissolving them together in 3mL of anhydrous ethanol to obtain a lipid solution, transferring it to an eggplant-shaped flask, dissolving 5.6mg siUSP33 in 1mL of 50mM citric acid buffer with a pH of 4 and containing 25% ethanol, slowly adding it to the lipid solution, mixing it, and incubating it for 20 minutes; treating it with ultrasound and a liposome extruder through a 100nm filter membrane; 2) dialyzing it with a nanodialysis device, using a polycarbonate membrane with a pore size of 10nm; 3) freeze-drying: adding a freeze-drying protectant and freeze-drying it.

[0029] The fourth aspect of the present invention aims to provide the use of the siUSP33 in the preparation of a preparation that promotes the ubiquitination of the E protein in SARS-CoV-2.

[0030] This invention opens up avenues for deeper exploration of the role of USP33 in viral replication and inflammation, providing a potential therapeutic target for combating SARS-CoV-2 infection. Future studies can focus on optimizing the delivery system of siUSP33 to improve its efficacy and reduce off-target effects. In addition, studying the broader significance of targeting USP33 in other viral infections could provide valuable insights into the development of broad-spectrum antiviral strategies.

[0031] The present invention innovatively combines lipid nanomaterials with nucleic acid drugs and, by adjusting the components of the nanomaterials, innovatively achieves high lung targeting, high viral capacity and biosafety. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] Figure 1 In order to find that USP33 is the preferred target for positive regulation of SARS-CoV-2 replication through DUBs library screening; A) The important deubiquitinating enzymes that promote viral replication were screened through DUBs library, and the human DUBs overexpression library was transfected into Vero cells, and then infected with SARS-CoV-2 at MOI=0.1. After 24h, the expression level of N protein was detected by immunofluorescence, and the relative abundance of the virus was quantitatively determined; B) The DUBs screening results showed that USP33 is the preferred target for positive regulation of SARS-CoV-2 replication.

[0033] Figure 2 To explore the interaction and regulatory relationship between viral proteins and DUBs;

[0034] A) HEK293T cells were transfected with viral protein particles carrying Strep tags, and the expression of USP33 in whole cell lysates (WCL) and IP lysates was immunoprecipitated with anti-USP33 antibodies; B) GST and GST-E proteins were overexpressed in BL21 competent cells, and the beads were precipitated by interaction with GST beads. The beads were then incubated with HEK293T cell lysate and analyzed by immunoblotting; C) HEK293T cells were co-transfected with HA-USP33 and viral protein particles carrying Flag tags and treated with MG132 (10 mM); the whole cell lysate was then collected for denaturation and immunoprecipitated with Flag. beads, and finally the protein expression was detected by immunoblotting; D) HA-E was transfected into HEK293T cells, and then Flag-USP33 and His-tagged WT and K48 mutated Ub plasmids were transfected separately or co-transfected, and treated with MG132; WCLs (whole cell lysate) were denatured and immunoprecipitated with HAbeads, followed by immunoblotting analysis; E) HA-E was overexpressed in HEK293T cells, and the plasmids for gradient overexpression of Flag-USP33 were used; the expression level of E protein was detected by immunoblotting (left figure), and quantitative analysis was performed relative to the internal reference β-Actin (right figure); F) Flag-USP33 plasmids were gradient overexpressed in HEK293T cells overexpressing HA-E-K63R, and the protein expression level of E-K63R was analyzed by immunoblotting; G) HA-E was transfected into HEK293T cells, and the plasmids for gradient overexpression of Flag-USP33 were used to detect the protein expression level of E-K63R. Empty vector or Flag-USP33 were transfected in HEK293T cells overexpressing HA-E, and cell samples were collected at the indicated times after treatment with CHX. The levels of E protein were analyzed by immunoblotting (left panel); quantitative analysis relative to the internal reference β-Actin is shown in the right panel; H) Flag-USP32 or Flag-USP39 plasmids were gradiently transfected in HEK293T cells overexpressing HA-E; cells were lysed to detect the levels of E protein by immunoblotting (left panel), and the quantitative results are expressed as the mean ± SD (n = 3 independent experiments) (right panel); I) Flag-USP33 or Flag-USP39 was transfected in A549-ACE2 and Calu3 cells expressing HA-E, respectively, to detect the expression levels of E protein under different treatment conditions (left panel); quantitative results are expressed as the mean ± SD (n = 3 independent experiments) (right panel); Student's t-test (unpaired, two-tailed) was used, **P < 0.01, ***P < 0.001.

[0035] Figure 3 To explore whether USP33 regulates E protein specifically in SARS-CoV-2;

[0036] A) Amino acid sequence alignment of E proteins of seven human coronaviruses; B) Amino acid sequence similarity of E proteins in seven human coronaviruses; C) Homology of E proteins of seven human coronaviruses was evaluated using ClustalW; D) Myc-tagged E protein plasmids were overexpressed in HEK293T cells infected with seven human coronaviruses, treated with CHX for the indicated time, and then collected for immunoblotting to detect E protein levels (top); the relative amount to β-Actin is expressed as mean ± SD (n = 3 independent experiments) (bottom); E) HEK293T cells were transfected with plasmids containing Myc-E and HA-USP33, and protein levels were analyzed by immunoblotting; F) HEK293T cells were transfected with plasmids containing Myc-E and HA-USP33, Myc beads were added to the cell lysate for immunoprecipitation, and protein expression was analyzed by immunoblotting; G) Alignment of interaction sites of E proteins of seven human coronaviruses.

[0037] Figure 4 To verify the regulatory relationship of USP33 in mouse cells and design and synthesize the corresponding siRNA

[0038] A) MH-S cells overexpressing Flag-E were transfected with empty vector or HA-mUSP33, treated with CHX and collected at the indicated times for immunoblotting analysis of E protein levels. Two-way ANOVA test was performed for multiple groups, ***P<0.001; B) Four siRNAs targeting mUSP33 and control siRNA were transfected into mouse alveolar macrophages MH-S, respectively; cells were collected 48 hours later, and the protein level of USP33 was detected by immunoblotting.

[0039] Figure 5 : Design and synthesize lung-targeted materials;

[0040] A) Relevant parameters of LNP-nsRNA (control group) and LNP-siUSP33, including hydrodynamic diameter (nm), polydispersity index (PDI) and zeta potential (mV); B) Representative transmission electron microscopy images of LNP-nsRNA and LNP-siUSP33, scale bar, 100 nm; C) Lung-related cells and non-lung-related cells were transfected with siRNA (100 pmol) or added with LNP-siRNA (0.132 g), as shown in the figure. After about 48 hours, the cells were collected for immunoblotting to detect the protein level of USP33; D) Representative measurement of mouse protein levels by IVIS imaging system Whole-body bioluminescence images (left) and quantification results are shown as mean ± SD (n = 3 independent experiments) (right); E) Representative ex vivo images of siRNA fluorescence in organs of injected mice captured using the IVIS imaging system (top) and quantification results are shown as mean ± SD (n = 3 independent experiments) (bottom); F) Lungs of mice with different treatments were collected on the indicated days, and USP33 protein levels in the lungs were compared and quantified with those of the PBS-treated group. Two independent groups were compared using Student's t-test (unpaired, two-tailed), and two-way ANOVA was performed for comparison of multiple groups; *P<0.05; **P<0.01; ***P<0.001.

[0041] Figure 6 : Verify the safety of materials;

[0042] AB) Peripheral blood was collected from mice in different treatment groups on day 1 (A) and day 4 (B) to analyze routine physiological indices including blood routine examination (WBC, RBC, HGB and PLT), liver function tests (ALP, TBA, ALT and AST), and renal function tests (UREA, UA and CREA).

[0043] Figure 7 : Verify the validity of the material.

[0044] To verify the antiviral effect of USP33 in mice, we used AAV virus to overexpress human ACE2 protein in the lungs of mice. Six days after AAV virus infection, we injected PBS, LNP-nsRNA and LNP-siUSP33 into mice via retro-orbital intravenous injection. The next day, we infected mice with the wild-type strain of SARS-CoV-2 via nasal inoculation.

[0045] A) After infection, the weight of mice was recorded once a day for 8 days, and the quantification results of weight compared with before infection were expressed as mean ± standard deviation (n = 5 independent experiments); B) Total RNA was extracted from lung tissue, and the relative level of SARS-CoV-2N gene was detected. The lung tissue was then ground into a homogenate and then infected with Vero cells, and the virus titer was calculated using FFA; C) The lung tissue of mice was collected on the 8th day after infection, and the level of the corresponding protein was detected; D) Immunohistochemical analysis was performed using anti-SARS-CoV-2N antibody, To assess the relative viral load of SARS-CoV-2 in the lung, scale bar, 100 μm; E) H&E staining of lung tissues of mice in different treatment groups to observe the intensity of inflammatory infiltration, scale bar, 1000 μm (upper) and 50 μm (lower); F) Total RNA was extracted from the lungs, and the relative levels of the indicated inflammatory genes were detected using qRT-PCR; G) Schematic diagram of K18-hACE2 mice infected with SARS-CoV-2; H) and FFA was used to calculate the viral load of the lung, liver, and kidney in each treatment group on day 4 after infection. Two independent groups were compared using Student's t-test (unpaired, two-tailed), and two-way ANOVA was used for multiple group comparisons; *P<0.05; **P<0.01; ***P<0.001; ns, not significant. DETAILED DESCRIPTION

[0046] The following examples are intended to further illustrate the present invention, but are not intended to limit the present invention.

[0047] Example 1: Screening for DUBs that promote viral replication using a DUB library

[0048] An overexpression library of human deubiquitinases (DUBs) was transfected into Vero cells and subsequently infected with SARS-CoV-2 at a multiplicity of infection (MOI) of 0.1. The wild-type strain of SARS-CoV-2 was isolated from nasopharyngeal swab samples of COVID-19 patients collected from the Third People's Hospital of Shenzhen and amplified in Vero E6 cells. The infection process can be summarized as follows: When the cell confluence reached 90%, the medium was replaced with serum-free medium containing the virus. After incubation at 37°C for 1 hour, the medium was removed, the cells were washed with phosphate-buffered saline (PBS), and continued to be cultured in medium containing 10% fetal bovine serum. The medium containing progeny viruses was collected, serially diluted threefold, and used to infect Vero-E6 cells for 1 hour, after which it was replaced with medium containing 1.2% carboxymethyl cellulose (CMC). After 24 hours, the expression of nucleocapsid proteins was detected by immunofluorescence, and the relative abundance of the virus was quantified.

[0049] Attached Figure 1The results showed that among all the fluorescence quantitative analysis results, Vero cells transfected with USP33 showed higher fluorescence abundance and the strongest virus abundance, which also suggested that USP33 is the preferred target for positive regulation of SARS-CoV-2 replication.

[0050] Example 2: Exploring the interaction and regulatory relationship between viral proteins and DUBs

[0051] Vero cells were transfected with strep-tagged SARS-CoV-2 viral protein expression plasmids, and then Co-IP was performed with strep beads (Sigma). The pull-down of endogenous USP33 was detected with USP33 antibody to clarify their interaction relationship. Figure 2 A results show that there is interaction between M protein, E protein, ORF7b and USP33. At the same time, a prokaryotic expression vector expressing the E protein of the new coronavirus with GST fusion was constructed, the fusion protein was purified in BL21 (DE3) Escherichia coli competent cells, and GST-pulldown assay was performed with GST Agarose to analyze the in vitro interaction between viral protein and DUB, and WB detection was performed. The results are as follows Figure 2 As shown in B, the interaction between E protein and USP33 was further verified by purifying E protein from E. coli and performing GST pull-down experiments. Afterwards, the USP33 plasmid with HA tag and other viral protein plasmids with flag tag were co-transfected into the E. coli, and Co-IP was performed with Flag beads (Sigma), and the pull-down of USP33 protein was detected, verifying their interaction relationship from both endogenous and exogenous levels. Figure 2 CD showed that USP33 can act as a deubiquitinase to remove ubiquitin chains bound to substrate proteins. Therefore, through further in vivo ubiquitination experiments, we found that although E, M and ORF7b proteins were significantly ubiquitinated, USP33 could only remove polyubiquitin chains from E protein. In the ubiquitin proteasome degradation pathway, proteins recognized and degraded by the proteasome usually form K48 polyubiquitin chains. RNF5 is the main E3 ubiquitin ligase of E protein, which catalyzes ubiquitination at the K63 site of E protein. By screening different types of ubiquitin mutants, we determined that the main ubiquitination type on E protein is K48 polyubiquitin chain, and USP33 significantly removed K48 type polyubiquitin chains from E protein.

[0052] In addition, USP32 and USP39, which are also reported to be deubiquitinases of E proteins and can stabilize E proteins, can slightly enhance the stability of E proteins. However, our verification results show that the effect of USP33 is more significant than that of USP32 and USP39 ( Figure 2 E; Figure 2H). In different lung-related cells, such as A549-ACE2 and Calu3, overexpression of USP33 more strongly enhanced E protein levels than overexpression of USP39 ( Figure 2 I). When an anti-ubiquitination mutation was introduced at K63, the effect of USP33 on E protein stability was no longer observed ( Figure 2 F). Overexpression of USP33 significantly prolonged the half-life of E protein ( Figure 2 G).

[0053] Example 3: Exploring whether USP33 regulates E protein in SARS-CoV-2

[0054] The E protein is an important component of coronavirus particles and is found in all seven human coronaviruses. In addition to the high homology between SARS-CoV and SARS-CoV-2 (89.3%), there are also significant differences in the E protein between other human coronaviruses ( Figure 3 AC). Although half-life analysis showed that all seven E proteins decreased after 24 h after CHX treatment, the degradation of SARS-CoV and SARS-CoV-2 E proteins was most obvious. USP33 only enhanced the stability of SARS-CoV and SARS-CoV-2 E proteins ( Figure 3 This is consistent with the fact that USP33 can only interact with the E proteins of SARS-CoV and SARS-CoV-2, as we demonstrated that the interaction site is conserved in these two coronaviruses, but exists in different amino acid forms in other coronaviruses ( Figure 3 FG).

[0055] Example 4: Design and synthesis of siRNA targeting USP33

[0056] According to the design principles, three human siRNAs and four mouse siRNAs were designed and synthesized to screen out the most effective siRNA.

[0057] Take 10ul of the synthesized siRNA solution (100nM) and transfect it into human lung cells and mouse lung cells using the Lipo-3000 transfection kit. Change the medium every 6-8 hours, and after continuous culture for 48 hours, collect the cells, add Trizol to lyse the cells, and freeze them at -20℃ for RNA extraction to detect the expression of USP33.

[0058] hUSP33#1:CCCAGUAAUACAACAUUAATT

[0059] hUSP33#2:GGAGAAUAGAUGUUCAUAUTT

[0060] hUSP33#3:GCUGCAUUCAUCAAGUCAUTT

[0061] mUSP33#1:GCAGGAGACAAAGCAUUAUTT

[0062] mUSP33#2:GCCGGCUAAUCUGUUCCAATT

[0063] mUSP33#3:GCAGAGCCUCAGAAUCUAUTT

[0064] mUSP33#4:GCUGAACCUGGCCCUAUUUTT

[0065] Expression detection of USP33 RNA

[0066] RNA extraction process:

[0067] (1) Place the lysed cells and tissues on ice at room temperature for 5 minutes to allow for complete lysis. Add 200 μL of chloroform to each tube of tissue or cell lysate, shake vigorously for 15 seconds, and place at low temperature for 5 minutes to allow for stratification.

[0068] (2) Centrifuge at 2-8°C, 12000 rpm for 15 minutes. The sample is divided into three layers: the organic phase is red at the bottom, the protein layer is white in the middle, and the aqueous phase is colorless at the top. The nucleic acid in the top layer is what we need.

[0069] (3) Pipette 450 μL of the upper layer of liquid into a new enzyme-free tube, add 450 μL of isopropanol, gently invert upside down to mix, and place at low temperature for 15 minutes.

[0070] (4) Centrifuge at 2-8°C, 12,000 rpm for 15 minutes. A white precipitate will appear at the bottom of the tube after centrifugation. Gently pour off the supernatant and carefully retain the precipitate at the bottom.

[0071] (5) Add 1 mL of 75% ethanol to each tube until the precipitate floats off the tube wall (75% ethanol is prepared with DEPC water). Centrifuge at 2-8°C, 7500 rpm for 5 minutes, discard the supernatant, repeat this step twice, centrifuge once, and discard the supernatant.

[0072] (6) Dissolve the white precipitate in nuclease-free water to obtain RNA. Promote dissolution: 50-60℃ or 4℃ refrigerator overnight.

[0073] cDNA preparation process:

[0074] (1) Follow the instructions of the reverse transcription kit:

[0075]

[0076] After mixing thoroughly, add the following ingredients:

[0077]

[0078] (2) Reaction procedure:

[0079] 25℃ 5 minutes

[0080] 42℃ 60min

[0081] 70℃ 5 minutes

[0082] (3) The reaction is completed on the PCR instrument. After the reaction is completed and each tube is cooled to 12°C, the sample is taken out for subsequent experiments or stored at -20°C for long-term storage.

[0083] qPCR experimental steps and reaction procedures

[0084] (1) Reaction system

[0085]

[0086] (2) The reaction procedure is as follows:

[0087]

[0088] (3) Export the reaction results and calculate the Ct, ΔCt and 2-ΔΔCt of the target gene and reference gene:

[0089] The Ct value was calculated by ABI 7500Manager software; ΔCt1 = Ct of the gene to be detected in the experimental group - Ct of the reference gene in the experimental group; ΔCt2 = Ct of the gene to be detected in the control group - Ct of the reference gene in the control group; ΔΔCt = ΔCt1-ΔCt2; 2-ΔΔCt was calculated by the formula. Graph RAD prism7 was used to make a bar graph to analyze the 2-ΔΔCt of circRNA in cells. The independent sample t test was used to test and analyze the 2-ΔΔCt value of circRNA in cells.

[0090] We targeted the delivery of siUSP33 using LNPs. With 89.5% homology between mouse and human USP33, we first demonstrated that mUSP33 can also enhance the stability of E protein in mouse lung cells, including lung cancer cells (LLCs) and alveolar macrophages (MH-S) ( Figure 4A). We designed four siRNAs targeting mouse USP33, and after the above experimental steps, we found that siRNA#1 had the highest knockdown efficiency among the USP33 knockdowns ( Figure 4 B), therefore, siRNA#1 will be used in all subsequent experiments.

[0091] Example 5: Design and synthesis of lung-targeted materials

[0092] We incorporated selective organ-targeting nanotechnology into the traditional MC3-based LNP formulation used in the FDA-approved RNAi therapy Patisiran / Onpattro by adding the supplementary cationic lipid DOTAP (1,2-dienyl-3-trimethylammonium-propane). This produced highly lung-selective LNPs with a final molar ratio of Dlin-MC3-DMA:DSPC(1,2-distearoyl-sn-glycero-3-phosphocholine):cholesterol:DMG-PEG:DOTAP of 25:5:19.3:0.8:50. (Take Dlin-MC3-DMA: DSPC: cholesterol: DMG-PEG: DOTAP = 50mg: 6mg: 5mg: 4mg: 45mg, dissolve them together in 3mL of anhydrous ethanol, transfer to an eggplant flask, dissolve 5.6mg siUSP33 in 1mL of citric acid buffer (50mM citrate, pH = 4) containing 25% ethanol, slowly add to the lipids, mix well, and incubate for 20 minutes. Treat with ultrasound and a liposome extruder (100nm filter membrane); dialyze with a nanodialysis device (polycarbonate membrane, pore size 10nm); 3) Freeze-drying: add a lyophilization protectant and perform freeze-drying. The preparation method refers to Cui Z, Zeng C, Huang F, et al. Cas13d knockdown oflung protease Ctsl prevents and treats SARS-CoV-2infection. Nat Chem Biol. 2022; 18(10): 1056-1064. doi: 10.1038 / s41589-022-01094-4) LNP-siNC and LNP-siRNA have high reproducibility, are about 100nm in size, are uniformly spherical, and are observed by transmission electron microscopy and verified by physiological and biochemical indicators. ( Figure 5-7 )

[0093] 1H&E staining and immunohistochemical analysis

[0094] Lungs from infected and uninfected mice were first fixed in 4% paraformaldehyde for 24 hours. The samples were then dehydrated and embedded in paraffin. Thin sections (4-5 μm) were cut and stained with hematoxylin and eosin to observe tissue morphology. For immunohistochemistry, paraffin-embedded sections were deaffinity, dehydrated, and subjected to antigen extraction. Before blocking primers, they were incubated with a primary antibody specific for SARS-COV-2-nucleoprotein, followed by incubation with an HRP-labeled secondary antibody and DAB (peroxidase) to visualize antigen localization and expression levels in tissues.

[0095] 2 Cryogenic TEM (Cryogenic TEM)

[0096] Cryo-TEM sample preparation and imaging were performed as follows: First, 5 μL of the sample was carefully coated on a glow-discharge treated grid (R1.2 / 1.3Au, 300mesh, GiG). The grid was then subjected to water absorption for 4 s at 100% humidity and 4°C. Next, the grid was quickly immersed in liquid ethane using a Mark IV vitrobot (ThermoFisher). Imaging was performed using a Talos Glacios transmission electron microscope (ThermoFisher). The magnification was set to 92,000× and the pixel size was 1.57A.

[0097] 3 In vivo imaging software imaging

[0098] Lipid nanoparticles (LNPs) containing CY5-modified siRNA were injected into C57BL / 6 mice via retroretinal vein injection (dose of 0.5 mg / kg). Fluorescence imaging of the whole body and major organs (heart, liver, spleen, lung, kidney) was then performed using the IVIS Lumina XR system and Living ImageSoftware v.4.3.1 (Caliper Life Science).

[0099] Typically, LNPs accumulate in the liver and kidneys, but LNPs with a high molar ratio of ionizable cationic lipids show better lung targeting. Therefore, we prepared siUSP33 encapsulated in DOTAP-LNPs (LNP-siUSP33) and characterized the size and surface charge of the LNP-encapsulated siRNA ( Figure 5 A). The morphology of LNP-siRNA was further characterized by transmission electron microscopy, showing a clear core structure ( Figure 5B). By transfecting free siUSP33 or LNP-siUSP33 into mouse cells of different origins, we found that in lung-related cells such as LLC, MLE-12, and TC-1, siUSP33 delivered by LNP-siUSP33 had a higher knockout efficiency than the traditional siUSP33 transfected with lipo-3000. In non-lung-related cells such as MEF, NIH-3T3, and AML12, the knockout efficiency of LNP-siUSP33 was reduced, while the knockout efficiency of the traditional transfection method was higher ( Figure 5 C).

[0100] Next, we compared several different routes of LNP administration, including retro-orbital injection, intravenous injection (tail injection), and intranasal inoculation. Whole-body bioluminescence imaging and in vitro fluorescence detection showed that retro-orbital injection of LNP-siUSP33 into the lungs had minimal loss and reached a peak at 12 hours ( Figure 5 D). Retro-orbital injection also showed the best inhibitory effect on the 1st, 2nd and 4th day after treatment ( Figure 5 E). To better analyze the effects of LNP-siUSP33 on the lungs and the efficiency of knocking out USP33 over time after injection, mice were injected with PBS, Free-siUSP33, and LNP-siUSP33. Whole-body bioluminescence imaging showed that after injection, Free-siUSP33 rapidly spread throughout the body and gradually accumulated in the liver and kidneys, while LNP-siUSP33, although also accumulated in small amounts in the liver and kidneys, gradually targeted the lungs (in vitro fluorescence detection of lung, brain, liver, kidney, and spleen tissues was performed on days 0.5, 1, 2, 4, 7, 10, 14, and 21 after injection. The results showed that LNP-siUSP33 specifically targeted the lungs, and its protein level analysis showed that in the lungs, USP33 decreased significantly 1d after injection, lasted for at least 14 days, and returned to its original level by day 21 ( Figure 5 F).

[0101] Considering that the in vivo delivery peak of LNP is on the first day after injection, and the USP33 knockout efficiency is at the optimal level 4 days after injection, we collected blood samples from each group on the 1st and 4th days for blood routine and blood biochemical physiological index analysis. The results showed that there was no significant change in hematological indicators, and the liver and kidney functions of mice were basically normal ( Figure 6 ). This suggests that our strategy of encapsulating siRNA with Dlin-MC3-DMA and adding additional cationic lipids (DOTAP) is effective in reducing side effects. The LNP system maintains a relatively neutral surface charge at physiological pH levels. We also kept its diameter below 140nm to reduce LNP binding to fibrinogen and clot formation. The above results suggest that our LNP delivery strategy and knockdown of USP33 is a potential antiviral approach.

[0102] To verify the antiviral effect of USP33 in mice, we used adeno-associated virus (AAV) to overexpress human ACE2 protein in the lungs of mice (to construct COVID-19 susceptible mice). Six days after AAV transduction, we injected PBS, LNP-nsRNA, and LNP-siUSP33 into mice via the retroorbital route. The next day, we infected mice with nasal inoculation of the SARS-CoV-2 wild-type strain and recorded daily body weight changes within 8 days after infection. There was no difference between the LNP-nsRNA group and the PBS group, and the body weight gradually decreased, reaching a minimum level of about 20% on the 7th day. However, the body weight of mice injected with LNP-siUSP33 reached the lowest level on the third or fourth day after infection, decreased by about 5%, and gradually returned to the original weight ( Figure 7 A). Detection of USP33 protein expression in the lungs of AAV-hACE2 mice in different treatment groups showed that the viral load in the lungs of mice in the LNP-siUSP33 group was significantly lower than that in the PBS and LNP-nsRNA groups ( Figure 7 BC). The immunohistochemical results were consistent with this. H&E staining showed that LNP-nsRNA did not alleviate the inflammation caused by viral infection, while the viral load of mice in the LNP-siUSP33 group was significantly reduced, and the inflammatory infiltration in the lungs was also significantly reduced ( Figure 7 DE). The inhibitory effect of LNP-siUSP33 on viral virulence was also confirmed by detecting the expression of inflammatory factors in lung tissue ( Figure 7 F). K18-hACE2 transgenic mice (transgenic mice expressing human angiotensin-converting enzyme 2 (hACE2) can be used to study SARS-CoV-2 infection and disease manifestations.) were also used to measure the effects of LNP-siUSP33. Unlike AAV-hACE2 mice that express hACE2 only in the lungs, K18-hACE2 mice can express hACE2 in multiple organs. The results showed that the viral load and inflammatory infiltration in the lung tissues of LNP-siUSP33-treated mice were significantly reduced on day 4 after infection, but there was no significant change in viral load in the liver and kidneys due to targeted delivery ( Figure 7 FG). These results indicate that LNP-siUSP33 can specifically target the lungs, inhibit viral replication, and reduce the inflammatory response caused by the virus.

[0103] Human USP33 sequence

[0104] ATGACAGGATCAAATTCACACATAACGATATTAACCTTAAAGGTGTTACCTCATTTTGAAAGTCTTGG

[0105] GAAACAGGAAAAAATTCCTAACAAAATGTCAGCTTTTCGAAATCATGTCCACATTTGGATTCAGTT

[0106] GGTGAAATAACAAAGAAGATTTGATACAAAAATCCCTTGGTACTTGGTCAGGATTGTAAAGTCCAAG

[0107] GACCAAATCTTTGGGCATGTCTGGAGAATAGATGTTCATATGTTGGCTGTGGTGAATCACAAGTAGA

[0108] TCACAGCACCATACATTCTCAGGAGACAAAGCATTATCTAACTGTGAACCTTACCACTCTTCGAGTAT

[0109] GGTGTTATGCTTGCAGCAAAGAAGTATTTTTTGGATAGGAAATTAGGAACTCAGCCTTCATTGCCTCAT

[0110] GTAAGACACCTCACCAAATACAAGAAAACAGTGTCCAGGATTTTAAAATACCCAGTAATACAACAT

[0111] TAAAAACTCCTCTGGTTGCCGTATTTGATGATCTGGATATAGAAGCGGATGAAGAAGATGAACTTAG

[0112] GGCCAGAGGTCTTACAGGTTTGAAAAATATTGGAAATACTTGTTACATGAATGCAGCTTTGCAGGCT

[0113] CTTTCTAATTGCCCACCTTTGACACAGTTTTTTCTTGATTGTGGAGGACTAGCTCGAACAGATAAGAA

[0114] ACCTGCCATTTGTAAAAGTTATCTCAAACTAATGACAGAGCTGTGGCATAAAAGCAGGCCAGGATCT

[0115] GTTGTGCCTACTACTCTGTTTCAAGGAATTAAAACTGTAAATCCAACATTTCGGGGGTATTCTCAGCA

[0116] GGATGCTCAAGAATTCCTTCGATGTTTAATGGATTTGCTTCATGAAGAATTGAAAGAGCAAGTCATG

[0117] GAAGTAGAAGAAGATCCGCAAACCATAACCACTGAGGAGACAATGGAAGAAGACAAGAGCCAGTC

[0118] GGATGTAGATTTTCAGTCTTGTGAATCTTGTAGCAACAGTGATAGAGCAGAAAATGAAAATGGCTCT

[0119] AGATGCTTTTCTGAAGATAATAATGAAACAACAATGTTAATTCAGGATGATGAAAACAATTCAGAAA

[0120] TGTCAAAGGATTGGCAAAAAGAGAAGATGTGCAATAAGATTAATAAAGTAAATTCTGAAGGCGAAT

[0121] TTGATAAAGATAGAGACTCTATATCTGAAACAGTCGACTTAAACAACCAGGAAACTGTCAAAGTGCA

[0122] AATACACAGCAGAGCTTCAGAATATATCACTGATGTCCATTCGAATGACCTGTCTACACCACAGATC

[0123] CTTCCATCAAATGAAGGTGTTAATCCACGTTTATCGGCAAGCCCTCCTAAATCAGGCAATTTGTGGCC

[0124] AGGATTGGCACCACCACACAAAAAAGCTCAGTCTGCATCTCCAAAGAGAAAAACAGCACAAGAA

[0125] ATACAGAAGTGTTATTTCAGACATATTTGATGGAACAATCATTAGTTCAGTGCAGTGTCTGACTTGTG

[0126] ACAGGTGTCTGTAACCCTCGAGACCTTTCAAGATCTGTCCTTGCCAATTCCTGGCAAGGAAGACCTT

[0127] GCTAAGCTGCATTCATCAAGTCATCCAACTTCTATAGTCAAAGCAGGATCATGTGGCGAAGCATATG

[0128] CTCCACAAGGGTGGATAGCTTTTTTCATGGAATATGTGAAGAGCTGGTTTTGGGGTCCAGTAGTAAC

[0129] CTTGCAAGATTGTCTTGCTGCCTTCTTTGCCAGAGATGAACTAAAAGGTGACAATATGTACAGTTGTG

[0130] AAAAATGCAAAAAGTTGAGAAATGGAGTGAAGTTTTGTAAAGTACAAAACTTTCCTGAGATTTTGTG

[0131] CATCCACCCTTAAGATTCAGACATGAACTAATGTTTTCCACCAAAATCAGTACCCATGTTTCATTTC

[0132] CGCTAGAAGGCTTGGATCTTCAGCCATTTCTTGCTAAGGATAGTCCAGCTCAAATTGTGACATATGAT

[0133] CTTCTGTCAGTCATTTGCCATCATGGAACTGCAAGTAGTGGACACTATATAGCCTACTGCCGAAACA

[0134] ATCTAAATAATCTCTGGTATGAATTTGATGATCAGAGTGTCACTGAAGTTTCAGAATCTACTGTACAA

[0135] AATGCAGAAGCTTACGTTCTTTTCTATAGGAAGAGCAGCGAAGAGGCACAAAGGAGAGGAGAAGG

[0136] ATATCAAATTTATTGAACATAATGGAACCAAGCCTCCTTCAGTTTTATATTTCTCGACAGTGGCTTAA

[0137] TAAATTTAAGACCTTTGCCGAACCTGGCCCTATTTCAAATAATGACTTTCTTTGTATTCATGGAGGTG

[0138] TTCCTCCAAGAAAAGCTGGTTATATTGAAGACCTGGTTTTGATGCTGCCTCAGAACATTTGGGATAAC

[0139] CTATATAGCAGGTATGGTGGAGGACCAGCTGTCAACCATCTGTACATTTGTCATACTTGCCAAATTGA

[0140] GGCGGAGAAAATTGAAAAAAGAAGAAAAACTGAATTGGAAATTTTTATTCGGCTTAACAGAGCGTT

[0141] CCAAAAAGAGGACTCTCCAGCTACTTTTTATTGCATCAGTATGCAGTGGTTTAGAGAATGGGAAAGT

[0142] TTTGTGAAGGGTAAAGATGGAGATCCTCCAGGTCCTATTGACAATACTAAGATTGCAGTCACTAAAT

[0143] GTGGTAATGTGATGCTTAGGCAAGGAGCAGATTCTGGCCAGATTTCTGAAGAAACATGGAATTTTCT

[0144] GCAGTCTATTTATGGTGGAGGGCCTGAAGTTATCCTGCGACCTCCGGTTGTTCATGTTGATCCAGATA

[0145] TACTTCAAGCAGAAGAAAAAATTGAAGTAGAAACTCGGTCTTTGTAA

[0146] Mouse USP33 sequence

[0147] ATGACGACTTTTCGAAATCATTGTCCACATTTGGATTCAGTTGGTGAAATAACGAAAGAGGACTTGA

[0148] TACAGAAATCTCTCGGCGCTTGTCAGGACTGTAAAGTCAGAGGACCAAACCTGTGGGCGTGCCTGGA

[0149] GAATAGGTGCTCCTATGTTGGCTGCGGGGAGTCGCAAGTGGACCACAGCACCATACACTCGCAGGAG

[0150] ACAAAGCATTATCTAACTGTGAACCTCACCACTCTTCGAGTATGGTGTTATGCTTGCAGCAAAGAAG

[0151] TATTTTTGGATAGAAAATTAGGAACTCCTCCTTCATTACCTCATGTAAGACAGCCTCAACAAACACAA

[0152] GAAAACAGTGTCCAGGATTTTAAAATTCCCAGTAATCCAGCATTGAAAACCCCCATGGTTGCTGTGT

[0153] CTGAAGATCTGGATATAGAAGTGGAAGAGGAAGACGAGCTGAAGGCTAGAGGCCTGACAGGTTTGA

[0154] AAAACATTGGAAATACTTGTTATATGAACGCGGCGCTGCAGGCTCTTTCTAACTGCCCACCTTTGACA

[0155] CAGTTCTTTCTTGATTGTGGAGGACTGGCTAGAACAGATAAGAAACCAGCAATTTGTAAAAGTTATC

[0156] TCAAACTAATGACCGAGTTGTGGCACAAGAGCAGGCCAGGATCTGTTGTGCCGGCTAATCTGTTCCA

[0157] AGGAATTAAAACTGTAAATCCAACTTTTCGAGGTTATTCTCAGCAGGATGCCCAGGAATTCCTTCGCT

[0158] GTCTAATGGACCTGCTTCATGAGGAGCTGAAGGAGCAGGTCATGGAAATGGAGGAAGAGCCTCAAA

[0159] CACTAACTTCTGAGGAGACGGTGGAGGAAGAGAAGAGCCAGTCAGATGTGGATTTTCAGTCGTGCG

[0160] AGTCTTGTAGCAGCAGCGAGAAAGCAGAAAATGAGAGTGGCTCCAAAGGCTTTCCTGAGGACAGCA

[0161] ATGAGACCACCATGCTCATCCAGGACGAGGATGACCTGGAGATGGCCAAAGACTGGCAGAAAGAGA

[0162] AGGTGTGCAATAAGATCAACAAGGCAAATGCCGATGTAGAACTGGACAAAGACAGGGACACAGTGT

[0163] GTGAAACAGTTGACCTAAACAGCCAGGAGACCGTCAAAGTGCAGATACACGGCAGAGCCTCAGAAT

[0164] CTATCACTGATGTCCATCTGAATGACCTAGCTACGTCACAGATCCTTCCTTCAAATGAAAGTGTTAGT

[0165] CCACGGTTATCAGCAAGCCCTCCTAAGCTAGGCAGTCTGTGGCCAGGACTGTCGCCTCCACACAAGA

[0166] AAGCTCAGTCTACATCTGCAAAGAGGAAAAAGCAGCATAAGAAATACAGAAGTGTCATCTCCGACA

[0167] TATTCGATGGAACAGTCATTAGCTCGGTACAGTGTCTGACGTGCGATAGGGTGTCTATAACCCTCGA

[0168] GACCTTTCAGGATCTGTCCTTGCCGATTCCTGGCAAGGAGGACCTGGCTAAGCTGCACTCCTCCAGTC

[0169] ACCCAACTATAGTCAAAGCAGGGTCATGTGGTGAAGCGTACGCCCCGCAGGGGTGGATAGCTTTCTT

[0170] CATGGAGTATGTGAAGAGCTGGTTTTGGGGTCCAGTAGTTACCTTGCAAGATTGTCTTGCTGCCTTCT

[0171] TCGCCAGAGATGAACTTAAAGGTGACAACATGTACAGTTGTGAAAAATGCAAAAAGTTGAGGAATG

[0172] GAGTAAAGTTTTGTAAAGTACAGAAGTTTCCTGAGATTTTGTGTATCCACCTTAAAAGATTTCGACAT

[0173] GAACTGATGTTTTCCACCAAAATTAGCACCCATGTTTCCTTCCCCCTGGAAGGCCTCGATCTTCAGCC

[0174] ATTTCTTGCAAAGGACAGCCCAGCTCAGATTGTGACATATGATCTCCTGTCAGTCATCTGTCACCATG

[0175] GGACTGCAAGTAGTGGGCACTACATTGCCTACTGCCGAAACAATTTAAATAACCTGTGGTATGAGTT

[0176] TGATGACCAGAGCGTCACTGAAGTTTCAGAGTCCACTGTACAGAATGCCGAGGCCTACGTCCTTTTCT

[0177] ACAGGAAGAGCAGTGAAGAGGCACAAAAGGAGAGGCGGAGGATATCAAATTTGTTGAACATCATGG

[0178] AACCTAGCCTCCTTCAGTTCTACATATCTCGACAGTGGTTGAATAAATTTAAGACCTTTGCTGAACCT

[0179] GGCCCTATTTCAAATAATGATTTTCTCTGTATCCATGGAGGTATTCCTCCACGAAAAGCGAGTTATAT

[0180] TGAAGACTTAGTTTTGATGCTGCCTCAGAACATTTGGGATAACCTCTATAGCAGGTATGGAGGAGGG

[0181] CCTGCTGTCAACCATCTCTACATCTGCCACACCTGCCAAATTGAGTTAGAGAAGATTGAAAAACGAA

[0182] GAAAAACCGAATTGGAAATTTTTATTCGGCTCAACAGAGCATTTCAAGAGGAGGACTCCCCAGCTAC

[0183] TTTTTACTGTATCAGCATGCAGTGGTTTAGAGAATGGGAGAGTTTTGTAAAGGATCCCCCAGGTCCA

[0184] ATCGACAACACTAAAATTGCGGTTACTAAATGTGGCAGTGTGATGCTCAAGCAAGGAGCAGACTCTG

[0185] GTCAAATTTCAGAAGAAACATGGAATTTCCTGCAGTCTATATATGGTGGGGGGCCTGAAGTTATCCT

[0186] CCGACCTCCAGTTGTTCATGTTGACCCTGATGTACTCCAAGCAGAGGAAAAGATTGAAGTAGAAACT

[0187] CGCTCTTTGTAG。

Claims

1. Application of USP33 inhibitors in the preparation of anti-SARS-CoV-2 virus drugs.

2. The use according to claim 1, characterized in that: The USP33 inhibitors include: siUSP33.

3. The use according to claim 2, characterized in that: The siUSP33 sequence is at least one of the following: hUSP33#1:CCCAGUAAUACAACAUUAATT hUSP33#2:GGAGAAUAGAUGUUCAUAUTT hUSP33#3:GCUGCAUUCAUCAAGUCAUTT mUSP33#1:GCAGGAGACAAAGCAUUAUTT mUSP33#2:GCCGGCUAAUCUGUUCCAATT mUSP33#3:GCAGAGCCUCAGAAUCUAUTT mUSP33#4:GCUGAACCUGGCCCUAUUUTT; Preferred: mUSP33#1:GCAGGAGACAAAGCAUUAUTT.

4. The use according to claim 2, characterized in that: The USP33 inhibitor comprises: lipid nano delivery particles and siUSP33 in combination.

5. The use according to claim 4, characterized in that: The final molar ratio of the components in the lipid nano-delivery particles of the USP33 inhibitor is Dlin-MC3-DMA: DSPC: cholesterol: DMG-PEG: DOTAP = 23-26: 4-6: 19-20: 0.6-1: 48-52.

6. The use according to claim 4 or 5, characterized in that: The preparation steps of the USP33 inhibitor include: 1) taking Dlin-MC3-DMA: DSPC: cholesterol: DMG-PEG: DOTAP = 50mg: 6mg: 5mg: 4mg: 45mg, dissolving them together in 3mL of anhydrous ethanol to obtain a lipid solution, transferring it to a flask, dissolving 5.6mg siUSP33 in 1mL of 50mM citric acid buffer with a pH of 4 and containing 25% ethanol, slowly adding it to the lipid solution, mixing it, and incubating it for 20 minutes; treating it with ultrasound and a liposome extruder through a 100nm filter membrane; 2) dialyzing it with a nanodialysis device, using a polycarbonate membrane with a pore size of 10nm; 3) freeze-drying: adding a freeze-drying protectant and freeze-drying it.

7. An anti-SARS-CoV-2 virus drug, characterized in that: The USP33 inhibitor according to any one of claims 1 to 6.

8. The method for preparing the anti-SARS-CoV-2 virus drug according to claim 7, characterized in that: The following steps are involved: 1) Take Dlin-MC3-DMA: DSPC: cholesterol: DMG-PEG: DOTAP = 50mg: 6mg: 5mg: 4mg: 45mg, dissolve them together in 3mL of anhydrous ethanol to obtain a lipid solution, transfer it to an eggplant flask, dissolve 5.6mg siUSP33 in 1mL of 50mM citric acid buffer with a pH of 4 containing 25% ethanol, slowly add it to the lipid solution, mix well, and incubate for 20 minutes; treat it with ultrasound and liposome extruder through a 100nm filter membrane; 2) dialyze it with a nanodialysis device using a polycarbonate membrane with a pore size of 10nm; 3) freeze-drying: add a freeze-drying protectant and freeze-dry it.

9. Application of siUSP33 in the preparation of preparations that promote ubiquitination of E protein in SARS-CoV-2.

Images