Trichoderma reesei with low beta-glucosidase activity and high filter paper enzyme activity as well as construction method and application of trichoderma reesei

Abstract

In the invention, the BG gene is knocked out from the Trichoderma reesei PX3 (a strain of a continuously activated cellulase transcription activator), so that the BG activity can be reduced under the condition that the filter paper enzyme activity of an enzyme system is not reduced or even improved, and a strain with low BG enzyme activity and high filter paper enzyme activity is constructed. The strategy can avoid negative effects on cellulase production after BG knockout, and the obtained strain can be used for efficient production of cellobiose or used as a chassis strain for producing cellulase.

Description

Technical Field

[0001] The invention belongs to the field of genetic engineering, and particularly relates to Trichoderma reesei with low beta-glucosidase activity and high filter paper enzyme activity, and a construction method and application thereof. Background Art

[0002] The statements in this section merely provide background information related to the present invention and do not necessarily constitute prior art.

[0003] In the strategy of making starch from straw, cellulose is partially degraded into cellooligosaccharides or cellobiose by cellulase, and then glucose-1-phosphate is generated by cellobiose / cellooligosaccharide phosphorylase, and then amylose is synthesized by α-glucan phosphorylase. This process does not require additional energy to directly generate glucose-1-phosphate. The entire conversion process is economical and energy-saving, which is a useful exploration of using cellulose to synthesize edible starch.

[0004] Trichoderma reesei is one of the most representative cellulose-degrading microorganisms. It can produce a large amount of exoglucanase (CBH) and endoglucanase (EG), showing a strong hydrolysis of lignocellulose. In addition, under optimized fermentation conditions, the protein secretion level of Trichoderma reesei is significant, reaching 100g / L, and can be used as a cellulase producer in the strategy of cellulose synthesis starch. The cellulose-degrading enzymes secreted by Trichoderma reesei include endoglucanase, exoglucanase and β-glucosidase (BG). Cellulose is degraded into cellobiose under the action of endoglucanase and exoglucanase, and then cellobiose is degraded into glucose by β-glucosidase, and the final degradation product is glucose.

[0005] In actual production, if Trichoderma reesei is to be fermented to accumulate cellobiose, it is necessary to remove the BG responsible for degrading cellobiose in the Trichoderma reesei cellulase system to reconstruct its cellulase system so that the main product of cellulose hydrolysis can be converted from glucose to cellobiose. However, it is reported that knocking out BG genes such as cel1a, cel1b, cel3a in Trichoderma reesei can reduce BG enzyme activity, but it will also cause the production of cellulase enzyme system to lag and reduce yield. Therefore, it is necessary to obtain an engineered strain that reduces BG enzyme activity but does not affect or increase cellulase activity through artificial modification. Summary of the invention

[0006] To overcome the deficiencies of the above-mentioned prior art, the present invention provides a Trichoderma reesei with low β-glucosidase activity and high filter paper enzyme activity, and a construction method and application thereof. In the present invention, by knocking out the BG gene in Trichoderma reesei PX3 (a strain expressing a sustainably activated cellulase transcription activator), the BG activity can be reduced without reducing or even increasing the filter paper enzyme activity of the enzyme system, and a strain with low BG enzyme activity and high filter paper enzyme activity can be constructed. This strategy can avoid the negative impact of BG knockout on cellulase production, and the obtained strain can be used for the efficient production of cellobiose or as a chassis strain for producing cellulase.

[0007] To achieve the above objectives, one or more embodiments of the present invention provide the following technical solutions:

[0008] In a first aspect of the present invention, a Trichoderma reesei with low β-glucosidase activity and high filter paper enzyme activity is provided, which is obtained by using Trichoderma reesei PXK1 as a starting strain and knocking out the β-glucosidase synthesis gene;

[0009] The β-glucosidase synthesis genes are cel3a and cel3b, the cel3a gene number is TRIREDRAFT_76672, and the cel3b gene number is TRIREDRAFT_121735.

[0010] In a specific embodiment of the present invention, the Trichoderma reesei PXK1 is obtained by knocking out the Ku70 protein using Trichoderma reesei PX3 which can sustainably activate the cellulase transcription activator as a starting strain through homologous recombination.

[0011] Filter paper activity (FPA) reflects the total enzyme activity of the complex enzyme system composed of three hydrolases of cellulase, namely, exoglucanase, endoglucanase and β-glucosidase, after synergistic action, that is, the cellulase described in the present invention.

[0012] The second aspect of the present invention provides a method for constructing Trichoderma reesei with low β-glucosidase activity and high filter paper enzyme activity.

[0013] It is obtained by activating the cellulase transcription activator in Trichoderma reesei and knocking out one or more genes encoding β-glucosidase.

[0014] In a specific embodiment of the present invention, the method comprises:

[0015] 1) constructing a knockout mutant strain PXK1 of Trichoderma reesei ku70 and preparing protoplasts;

[0016] 2) constructing a plasmid for knocking out the β-glucosidase synthesis gene; the plasmid includes an sgRNA expression cassette targeting the β-glucosidase synthesis gene;

[0017] 3) Construction of Donor DNA to knock out the β-glucosidase synthesis gene;

[0018] manual

[0019] 4) The plasmid and Donor DNA obtained in step 2) were transformed to a concentration of 5×10 5-7 In PXK1 protoplasts of 100 μg / mL, the amount of plasmid is 1-3 μg, the amount of Donor DNA is 1-3 μg when a single gene is knocked out, and 2-4 μg when two genes are knocked out;

[0020] 5) placing the product obtained in step 4) on a mycospore culture medium, and obtaining a target transformant by identifying the mycelial genome;

[0021] In a specific embodiment of the present invention, when the β-glucosidase synthesis gene is cel3a, the Donor DNA is amplified by primers 3A-UF / 3A-UR or 3A-DF / 3A-DR to obtain upstream homology arms and downstream homology arms, respectively;

[0022] Or, when the β-glucosidase synthesis genes are cel3a and cel3b, the Donor DNA is amplified by primers 3A-UF / 3A-UR or 3A-D-F2 / 3A-DR to obtain the upstream homology arm and downstream homology arm of the cel3a gene, and the Donor DNA is amplified by primers 3B-UF / 3B-UR or 3B-D-F2 / 3B-DR to obtain the upstream homology arm and downstream homology arm of the cel3b gene; wherein the nucleotide sequence of the primer 3A-UF is shown in SEQ ID NO.35; the nucleotide sequence of the primer 3A-UR is shown in SEQ ID NO.36; the nucleotide sequence of the primer 3A-DF is shown in SEQ ID NO.37; the nucleotide sequence of the primer 3A-DR is shown in SEQ ID NO.38; the nucleotide sequence of the primer 3A-D-F2 is shown in SEQ ID NO.47; the nucleotide sequence of the primer 3B-UF is shown in SEQ ID NO. The nucleotide sequence of primer 3B-UR is shown in SEQ ID NO.51; the nucleotide sequence of primer 3B-D-F2 is shown in SEQ ID NO.52; and the nucleotide sequence of primer 3B-DR is shown in SEQ ID NO.53.

[0023] In a specific embodiment of the present invention, the method for constructing the Trichoderma reesei ku70 knockout mutant PXK1 comprises the following steps:

[0024] 1-1) Preparing protoplasts of Trichoderma reesei PX3;

[0025] 1-2) Construction of knockout vector;

[0026] 1-3) Amplify the Donor DNA of ku70 using primers ku70-UF / R and ku70-DF / R;

[0027] 1-4) in 5×10 5-7 1-2 μg Donor DNA and 1.5-3 μg knockout vector were added to the protoplasts of 100 μg / mL. After the protoplasts were transformed, the transformants were picked and placed on the spore medium for growth. The mycelial genome was identified and the

[0028] Among them, the nucleotide sequences of primers ku70-UF / R and ku70-DF / R are shown as SEQ ID NO.11, SEQ ID NO.12, SEQ ID NO.13, and SEQ ID NO.14, respectively, and the gene knockout vector includes a sgRNA target site targeting ku70, and the sgRNA target site sequence is shown as SEQ ID NO.4.

[0029] The third aspect of the present invention provides a Trichoderma reesei with low β-glucosidase activity and high filter paper enzyme activity or a construction method thereof for use in any one or more of the following:

[0030] A1: Application in cellulose degradation;

[0031] A2: Application in the production of cellobiose;

[0032] A3: Application in producing enzyme systems with high filter paper enzyme activity and low β-glucosidase activity;

[0033] The high activity is manifested as filter paper enzyme activity of 6.7-8 U / mL after 7-day fermentation in 100-200 mL culture medium, and the low activity is manifested as β-glucosidase activity of 0.1-0.3 U / mL after 7-day fermentation in 100-200 mL culture medium.

[0034] The fourth aspect of the present invention provides a method for producing low-activity β-glucosidase, which is obtained by fermentation using the Trichoderma reesei with low β-glucosidase activity and high filter paper enzyme activity described in the first aspect.

[0035] One or more of the above technical solutions have the following beneficial effects:

[0036] The present invention knocks out the BG gene in a strain (PXK1) expressing a sustainably activated cellulase transcription activator, constructs a series of strains with low BG enzyme activity and high filter paper enzyme activity or high filter paper enzyme activity, avoids the negative impact of BG knockout on cellulase production, and improves cellulose degradation capacity. The cellulase provided by the present invention can effectively degrade cellulose to generate cellobiose, improves the industrial production capacity of cellobiose, and has practical application value.

[0037] Advantages of additional aspects of the present invention will be given in part in the following description, and in part will become obvious from the following description, or will be learned through practice of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0038] The accompanying drawings in the specification, which constitute a part of the present invention, are used to provide a further understanding of the present invention. The exemplary embodiments of the present invention and their descriptions are used to explain the present invention and do not constitute improper limitations on the present invention.

[0039] Figure 1 It is a schematic diagram of the overall technical route of the present invention.

[0040] Figure 2 This is a schematic diagram of the pCPT0 plasmid of Example 1 of the present invention.

[0041] Figure 3 This is a schematic diagram of the pCPT1 plasmid in Example 2 of the present invention.

[0042] manual

[0043] Figure 4 The strategy for assembling the tRNA-sgRNA expression array in Example 2 of the present invention and the final PL-(tNSL) n Schematic diagram of the knockout plasmid in the -tT format.

[0044] Figure 5 The enzymatic activity and extracellular protein concentration of the cel3a single knockout strains of Examples 4 and 5 of the present invention, as well as the cellobiose yield, are compared with those of PXK1, wherein A is the filter paper enzyme activity after culture for 7 days, B is the pNPG enzyme activity after culture for 7 days, and C is the cellobiose yield after 12 hours of reaction.

[0045] Figure 6 The enzyme activity and cellobiose production of the cel3a and cel3b double knockout strains of Examples 4 and 5 of the present invention are compared with those of the cel3a single knockout strain and PXK1, wherein A is the filter paper enzyme activity on the 7th day of culture, B is the pNPG enzyme activity on the 7th day of culture, and C is the cellobiose production after 12 hours of reaction. DETAILED DESCRIPTION

[0046] The present invention will be further described below in conjunction with specific examples. It should be understood that these examples are only used to illustrate the present invention and are not intended to limit the scope of the present invention.

[0047] It should be noted that the details of the present invention are known to those skilled in the art. The experimental methods in the following examples that do not specify specific conditions are usually carried out under conventional conditions or according to the conditions recommended by the manufacturer. The experimental steps that are not recorded in detail refer to "Molecular Cloning Laboratory Manual" (Edited by (US) MR Green (Michael R. Green), (US) J. Sambrook (Joseph. Sambrook), fourth edition), pathophysiological experiments, online databases, etc.

[0048] In the following examples, the materials and reagents used were obtained from commercial sources unless otherwise specified.

[0049] In the present invention, "gene knockout" refers to deleting all or part of a specific gene from the genome through a certain pathway, thereby causing the loss of the function of the specific gene.

[0050] In the present invention, "expression cassette" refers to an independent component of vector DNA, which consists of the gene and regulatory sequences expressed by the transfected cells. The expression cassette consists of three parts: the promoter sequence, the open reading frame and the 3' untranslated region, which usually contains the polyadenylation site in eukaryotic organisms. Different expression cassettes can be transfected into different organisms such as bacteria, yeast, plants and plants.

[0051] In the present invention, "plasmid" refers to a DNA molecule independent of the host cell chromosome, and in the present invention, it specifically refers to an artificially constructed plasmid. In a specific embodiment of the present invention, the "plasmid for knocking out the β-glucosidase synthesis gene" includes an autonomous replication element capable of being in Trichoderma reesei, a CRISPR cassette capable of performing a cutting function, an expression cassette capable of expressing a target sgRNA, and some screening markers; wherein, except that the target sgRNA needs to be designed according to the different targeted genes, all other elements in the plasmid can be used that are well known to those skilled in the art. For example, the autonomous replication element can use AMA1; the screening marker can be an auxotrophic screening marker, a fluorescent protein screening marker or an antibiotic screening marker. In a specific embodiment of the present invention, the uracil auxotrophic gene pyrG is used.

[0052] In the present invention, the main experimental methods used are as follows:

[0053] 1. Detection of enzyme activity

[0054] Cellulose fermentation medium (1L): microcrystalline cellulose 20.0g, KH 2 PO 4 5g, (NH4 )2SO 4 5.0g, CaCl 2 1.0 g, MgSO 4 7H 2 O 0.6g, corn steep liquor 20.0g, sterilize at 121℃ for 30min.

[0055] DNS solution (5L): Weigh 104g NaOH, add about 3L of distilled water to fully dissolve, then add 910g potassium sodium tartrate and 25g anhydrous sodium sulfite, then add 30g 3,5-dinitrosalicylic acid (DNS), finally add 25g redistilled phenol in a fume hood and stir for one day. After fully dissolved, put it into a brown reagent bottle and let it stand at room temperature away from light for one week before use.

[0056] 0.2M acetic acid-sodium acetate buffer (1L): 4.84mL of glacial acetic acid, 9.68g of anhydrous sodium acetate, add distilled water to make up to 1L, and adjust the pH to 4.8.

[0057] 2. Filter paper enzyme activity determination (FPase activity):

[0058] (1) Take 7 pieces of Whatman No.1 filter paper and staple them together. Use a hole punch to punch out circular filter paper pieces with a diameter of 5 mm. Then, add them in groups of three as substrates into a 25 mL enzyme activity assay tube.

[0059] (2) Add 1.5 mL of acetic acid-sodium acetate buffer and 0.5 mL of diluted enzyme solution (no addition for the control group) to the enzyme activity assay tube. Mix all the reaction systems thoroughly and place them in a 50°C water bath for 1 h.

[0060] (3) After the reaction is completed, 3 mL of DNS was added to terminate the reaction. 0.5 mL of diluted enzyme solution was added to the control group, mixed thoroughly, and then boiled in water for 10 min.

[0061] (4) After the boiling water bath ends, cool the mixture in ice water immediately. Then add distilled water to make up to 25 mL and mix thoroughly by inverting.

[0062] (5) Pipette 200 μL of the reaction solution from each system into an ELISA tube, measure the OD value at a wavelength of 540 nm, and substitute it into the glucose standard curve measured under the same conditions for calculation.

[0063] One unit of enzyme activity is defined as the amount of enzyme required to hydrolyze substrate to produce 1 μmol of reducing sugar per minute.

[0064] β-Glucosidase activity assay (with pNPG as substrate):

[0065] (1) Take a 1.5 mL centrifuge tube and add 50 μL of 1 mg / mL pNPG substrate.

[0066] (2) Add 100 μL of enzyme solution diluted with 0.2 M acetic acid-sodium acetate buffer, mix well, and place in a 50°C water bath for reaction for 30 min.

[0067] (3) After the reaction, add 150 μL of 10% Na 2 CO 3 The solution terminates the reaction.

[0068] (4) Pipette 200 μL of the reaction solution into an ELISA tube, measure the OD value at a wavelength of 540 nm, and substitute it into the pNP standard curve measured under the same conditions for calculation.

[0069] β-Glucosidase activity assay (with cellobiose as substrate):

[0070] (1) Take a 1.5 mL centrifuge tube and add 100 μL of 2% cellobiose substrate.

[0071] (2) Add 100 μL of diluted enzyme solution (not added in the control group) and 100 μL of 0.2 M acetic acid-sodium acetate buffer, mix well, and place in a 50°C water bath for reaction for 30 min.

[0072] (3) After the reaction, add 100 μL of diluted enzyme solution to the control group and incubate in a boiling water bath for 10 min.

[0073] (4) The samples were processed and the glucose content was detected by HPLC.

[0074] Definition of enzyme activity unit: the amount of enzyme required to hydrolyze the substrate to produce 1 μmol pNP or glucose per minute under the conditions of enzyme activity determination.

[0075] 3. Determination of extracellular protein content

[0076] The determination method refers to the instruction manual of Modified Bradford Reagent (Shenggong): first draw a standard curve of Bradford solution, then add 200 μL Bradford reagent to the enzyme label strip, then add 20 μL diluted fermentation supernatant and pipette evenly, let it stand at room temperature for 5 minutes, and measure the OD value at a wavelength of 595 nm; calculate the extracellular protein concentration in the fermentation supernatant based on the standard curve.

[0077] 4. Saccharification to produce fiber

[0078] The total saccharification system was 20 mL. The substrate addition amount was 10% (w / v, based on dry weight), 5 mL of 0.2 M pH 4.8 acetic acid-sodium acetate buffer was added to maintain pH stability, potassium sorbate and sodium benzoate were added as preservatives with a final concentration of 0.4% (w / v), and distilled water was used to make up to 20 mL. The reaction was carried out at 50°C and 150 rpm, and the samples were analyzed by high performance liquid chromatography (HPLC).

[0079] Hydrothermal pretreatment of corn straw: cut the straw into small segments of 2-3 cm, with a solid-liquid ratio of 1:10, pretreat at 190°C for 15 min, and rinse the solid residue with water until it is neutral.

[0080] The strains and vector information used in the present invention are as follows:

[0081] Trichoderma reesei PX3 is a strain constructed by the applicant's research group, see Zhao Q, Zhang Z, Liu Z, et al. A closed-loop strategy for on-site production of saccharolytic enzymes for lignocellulose biorefinery using internal lignocellulosic hydrolysates [J]. Chemical Engineering Journal, 2024, 480: 148272. Escherichia coli competent cells Trans5α were purchased from Beijing Quanshijin Biotechnology Co., Ltd.

[0082] Plasmid pFC330 was previously deposited by the applicant's research group. The specific sequence and usage method can be found in Nodvig CS, Nielsen JB, Kogle ME, et al. A CRISPR-Cas9 system for genetic engineering of filamentous fungi [J]. PLOS ONE, 2015, 10 (7). The specific sequence of plasmid pUC19 can be found in Norrander J, Kempe T, Messing J. Construction of improved M13 vectors using oligodeoxynucleotide-directed mutagenesis [J]. Gene, 1983, 26 (1): 101-106.

[0083] Plasmid pGG-Tr5S was constructed by the applicant, and the sgRNA expression cassette can be constructed by Golden Gate assembly, which is only used to knock out the ku70 gene. The construction method is shown in Example 1. Plasmid psgRNA-tRNA Gly The plasmid was constructed by the applicant and synthesized by Beijing Qingke Biotechnology Co., Ltd. The SLt sequence was inserted into the multiple cloning site of the pUC19 plasmid for amplification of the SLt sequence. The SLt sequence is the sgRNA backbone sequence-connector sequence-tRNA sequence. The overall sequence of this part is as follows:

[0084] GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGG CACCGAGTCGGTGCAAACAAGCGTAATTGGTTTAGTGGTAAAATTCTCCGTTGCCATCGGGGAGCCCTGGGTTCGATTCCCAGATTACGCA.

[0085] For the specific sequence and usage of pCas9-2, see Wang Q, Zhao Q, Liu Q, et al. CRISPR / Cas9-mediated genome editing in Penicillium oxalicum and Trichoderma reesei using 5S rRNA promoter-driven guide RNAs[J]. Biotechnol Lett, 2021, 43(2): 495-502.

[0086] The present invention will be further described in detail below in conjunction with specific embodiments. It should be noted that the specific embodiments are intended to explain the present invention rather than to limit it.

[0087] Embodiment 1

[0088] This example discloses Trichoderma reesei PXK1 and a method for constructing the same.

[0089] In order to improve the efficiency of exogenous gene integration, the present invention uses a non-homologous end joining repair mechanism mediated by Ku70 / Ku80 protein on the basis of Trichoderma reesei PX3, and achieves this by knocking out ku70. Among them, Trichoderma reesei PX3 has been disclosed in Zhao Q, Zhang Z, Liu Z, et al. A closed-loop strategy for on-site production of saccharolytic enzymes for lignocellulose biorefinery using internal lignocellulosic hydrolysates [J]. Chemical Engineering Journal, 2024, 480: 148272;

[0090] This is achieved through the following methods:

[0091] (1) The Trichoderma reesei PX3 genome was used as a template and the primer pair GG-5S-F / GG-5S-BsaI-R was used to amplify the Trichoderma reesei 5S promoter sequence, so that the 3′ end of the amplified promoter had two BsaI restriction sites in opposite directions (the sticky ends after restriction digestion were TATG and TTTC, respectively), a TTTTTT terminator and a homologous region at one end of the linearized pUC19 plasmid, and the 5′ end had a homologous region at the other end of the linearized pUC19 plasmid. The pUC19 plasmid was digested with KpnI, and the 5S promoter sequence was ligated to the linearized pUC19 plasmid using the ClonExpressII One Step Cloning Kit to construct an auxiliary plasmid pGG-Tr5S containing a 5S rRNA promoter (the sequence is the same as SEQ ID NO. 2 in the public text CN 116179544A), two BsaI restriction sites and a TTTTTT terminator.

[0092] (2) Use the sgRNA design website CHOPCHOP to design a 20 bp sgRNA target site for knocking out the ku70 gene, using the primer pair sgku70-GG-F / sgku70-GG-R with psgRNA-tRNA GlyThe sgRNA backbone with a 20bp sgRNA target site was amplified as a template, and the sgRNA backbone with the corresponding target site was connected to pGG-Tr5S by Golden Gate assembly. Then, the primer pair 5S-OC-F / 5S-OC-R was used to amplify the pGG-Tr5S connected to the target site to obtain the sgRNA expression cassette containing the 5S rRNA promoter, the complete sgRNA and the TTTTTT terminator, which was inserted into the pFC330 plasmid by the ClonExpress II One Step Cloning Kit to construct a complete knockout plasmid. The corresponding target site of ku70 is shown in SEQ ID NO.4 (CGAGACTCTGAAAGACGAGG).

[0093] (3) The upstream fragment of ku70 gene was amplified using the primer pair ku70-UF / ku70-UR with the Trichoderma reesei PX3 genome as a template, and the downstream fragment of ku70 gene was amplified using the primer pair ku70-DF / ku70-DR with the Trichoderma reesei PX3 genome as a template. The donor DNA (DonorDNA) without selection marker was constructed by connecting through fusion PCR and amplifying using the primer pair.

[0094] (4) The donor DNA (1.5 μg) and knockout plasmid (2 μg, sgRNA targeting ku70 linked to pFC330) were transformed into Trichoderma reesei PX3 protoplasts by protoplast transformation.

[0095] (5) Transformants were selected and grown on a mycospore culture medium. After mycelium grew, the genome was extracted and the genotype was verified using the primer pair ku70-YZ-F / ku70-YZ-R.

[0096] (6) The transformants were purified to obtain the ku70 gene knockout strain PXK1.

[0097] The nucleotide sequences of the primers used are shown in Table 1 below:

[0098] Table 1: Primers required for knockout vector construction

[0099]

[0100]

[0101] In order to improve the efficiency of gene knockout, a new plasmid pCPT1 for knocking out the target gene is also designed in the present invention.

[0102] The specific construction method is as follows:

[0103] First, construct a plasmid pCPT0 that efficiently expresses Cas9 protein and can be used for reverse screening, including the following steps:

[0104] (1) The pFC330 plasmid was digested with PacI and NheI to remove AMA1, the E. coli replication start site, and the ampicillin resistance gene ampR.

[0105] (2) Using the Trichoderma reesei genome as a template, the primer pair OC-Ppdc-Cas9-F / Ppdc-Cas9-R was used to amplify the endogenous pdc promoter of Trichoderma reesei (SEQ ID NO. 2), so that the 3′ end of the amplified promoter had a homologous region to the Cas9 protein coding sequence, the 5′ end had a homologous region to the other end of the pFC330 plasmid, and a new SgsI restriction site was added between the 5′ homologous region and the promoter sequence; Cas9-Tpdc-F / Tpdc-pyrG-R was used to amplify the pdc terminator (SEQ ID NO. 3).

[0106] Using pCas9-2 containing a complete expression cassette of the Cas9 gene as a template, the primer pair Cas9-flag-F / Cas9-flag-R was used to amplify the SV40 NLS sequence and 3×FLAG sequence in the coding sequence of the Cas9 protein, and the 5′-end SV40 NLS sequence and the 5′-end Cas9 protein sequence were codon optimized for Trichoderma reesei (SEQ ID NO.1), so that the codons corresponding to their sequences were compatible with Trichoderma reesei, and the primer pair Cas9-op-F / Cas9-Tpdc-R was used to amplify the Cas9 protein and nucleoplasmin in the coding sequence of the Cas9 protein. NLS sequence; use Tpdc-pyrG-F / OC-pyrG-330-R primer pair to amplify pyrG selection marker with pCas9-2 as template, so that the 3′ end of the amplified pyrG fragment has the homology region at one end of the pFC330 plasmid, and add a new NheI restriction site between the homology region and the fragment sequence, and the 5′ end has the homology region at the 3′ end of the pdc terminator. Then use ClonExpress IIOne Step Cloning Kit to construct the vector, connect all fragments into a complete plasmid, and construct pCPT0 plasmid, such as Figure 2 shown.

[0107] The nucleotide sequences of the primers used are shown in Table 2 below:

[0108] Table 2: Primers required for plasmid construction

[0109]

[0110] Secondly, the plasmid pCPT1 for assembling the tRNA-sgRNA expression array by homologous recombination method was constructed.

[0111] The pCPT0 plasmid was digested with NheI. The 5S promoter was amplified using the primer pair GG-M13R(-48)-F / OC-5GSG-R0 with pGG-Tr5S as the template, so that the 5′ end of the amplified promoter contained the homologous region at one end of the linearized pCPT0 plasmid and the 3′ end contained tRNA Gly Homologous region; use primer pair OC-5GSG-F1 / OC-5GSG-R1 to amplify the tRNA sequence, so that the 3′ end of the amplified tRNA sequence has the homologous region of one end of the sgRNA, and the 5′ end has the homologous region of the 5S promoter. The three sequences are inserted into the pCPT0 plasmid by one-step cloning to construct the pCPT1 plasmid, such as Figure 3 As shown. The sgRNA-tRNA sequence is amplified using a primer pair so that the 5′ end of the amplified promoter carries tRNA Gly The homology region at the 3′ end carries the homology region at the other end of the linearized pCPT0 plasmid. The two sequences are inserted into the pCPT0 plasmid by one-step cloning to construct the pCPT1 plasmid, e.g. Figure 3 The sequence of tRNA is shown in SEQ ID NO.27 (GCGTAATTGGTTTAGTGGTAAAATTCTC-CGTTGCCATCGGGGAGCCCTGGGTTCGATTCC CAGATTACGCA

[0112] ) as shown; the sgRNA backbone sequence is shown in SEQ ID NO.28 (GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGT GGCACCGAGTCGGTGC).

[0113] The nucleotide sequences of the primers used are shown in Table 3 below:

[0114]

[0115] Embodiment 2

[0116] This example provides a single gene knockout strain of Trichoderma reesei with low β-glucosidase activity and high filter paper enzyme activity and a method for constructing the same.

[0117] (1) Refer to the Double-joint PCR method, see Yu JH, Hamari Z, Han KH, et al. Double-joint PCR: a PCR-based molecular tool for gene manipulations in filamentous fungi [J]. Fungal Genet Biol, 2004, 41 (11): 973-981. First, the location of the cel3a gene on the genome was found based on the genome information of Trichoderma reesei QM6a (URL: https: / / mycocosm.jgi.doe.gov / Trire_Chr / Trire_Chr.home.html). The Trichoderma reesei genome was used as a template and the upstream homology arm (3A-UF / 3A-UR) and the downstream homology arm (3A-DF / 3A-DR) were amplified using the corresponding primer pairs. The selection marker gene pyrG was amplified using the pCPT0 plasmid as a template and the primer pair pyrG-F / pyrG-R. After the above three fragments were cut and recovered, the upstream homology arm, pyrG, and downstream homology arm were subjected to fusion PCR at a molar concentration of 1:2:1, and then the fusion product was used as a template and amplified using a nested PCR primer pair (such as 3A-CS-F / 3A-CS-R). After gel cutting and recovery, a knockout box for knocking out the β-glucosidase gene was obtained.

[0118] (3) The knockout cassette was transformed into Trichoderma reesei PXK1 protoplasts.

[0119] (4) Transformants were selected and grown on mycospore medium. After mycelium grew, the genome was extracted and the genotype was verified using primer pair 3A-YZ-F / 3A-YZ-R.

[0120] (5) Purifying the transformants to obtain Trichoderma reesei with low β-glucosidase activity and high filter paper enzyme activity.

[0121] The nucleotide sequences of the primers used are shown in Table 4 below:

[0122] Table 4: Primers required for knockout cassette construction

[0123]

[0124] Embodiment 3

[0125] This example provides a multi-gene knockout strain of Trichoderma reesei with low β-glucosidase activity and high filter paper enzyme activity and a method for constructing the same.

[0126] For ease of understanding, this embodiment is described by taking the knockout of cel3a and cel3b as an example.

[0127] The specific steps include:

[0128] (1) The coding sequences of cel3a and cel3b genes were found in the genome, and the corresponding sgRNAs were designed using CHOPCHOP, where the sgRNA sequences were: TCAAGGTAGCTCAACATCGG and AGGCGTCCGATGATCCAGCA (SEQ ID NO. 43, SEQ ID NO. 44), respectively.

[0129] (2) Use NheI to digest the pCPT1 plasmid. Gly As template, use primer pair

[0130] OC-tG-3b-3a-F / OC-tG-3b-3a-R amplifies the SLt sequence, so that the 5′ end of the amplified promoter carries the homology region of the pCPT1 plasmid and the 20bp sgRNA target site of the cel3b gene, and the 3′ end carries the 20bp sgRNA target site of the cel3a gene and the homology region of the pCPT1 plasmid, and connects them through one-step cloning to construct a complete editing plasmid. When knocking out 3 or more genes, amplify multiple SLt sequences so that their two ends carry the sgRNA target sites of different genes, and then connect them through one-step cloning to construct Figure 4 PL-(tNSL) shown n -tT knockout plasmid, wherein P is the promoter, L is the linker sequence, t is the tRNA sequence of Trichoderma reesei, N is the sgRNA sequence targeting different genes, S is the sgRNA backbone sequence, n is the number of targeting sites, and T is the terminator.

[0131] (3) Using the genome of Trichoderma reesei PX3 as a template, the primer pair 3A-UF / 3A-UR was used to amplify the upstream fragment of the cel3a gene, 3A-D-F2 / 3A-DR was used to amplify the downstream fragment of the cel3a gene, 3B-UF / 3B-UR was used to amplify the upstream fragment of the cel3b gene, and 3B-D-F2 / 3B-DR was used to amplify the downstream fragment of the cel3b gene. The upstream and downstream of the cel3a gene and the upstream and downstream of the cel3b gene were connected by fusion PCR to construct a donor DNA without a screening marker.

[0132] (4) The two donor DNAs and the knockout plasmid obtained in step (2) were co-transformed into Trichoderma reesei PXK1 protoplasts, wherein the amount of donor DNA added was 3 μg each, the amount of knockout plasmid added was 2 μg, and the concentration of PXK1 protoplasts was 5×10 6Pieces / mL.

[0133] (5) Transformants were picked and placed on a conidial medium for growth. After mycelium grew, the genome was extracted and the knockout of cel3a and cel3b was verified using primer pairs 3A-YZ-F / YZ-pyrG-R2 and 3B-YZ-F / YZ-pyrG-R2, respectively. The verification of cel3b found that the starting strain could not amplify a band, while the knockout strain could amplify a 2.4kb band. The verification of cel3a found that the starting strain could not amplify a band, while the knockout strain could amplify a 2.8kb band. The results showed that the double knockout efficiency could reach 82.14%.

[0134] The nucleotide sequences of the primers used are shown in Table 5 below:

[0135] Table 5: Required primers

[0136]

[0137]

[0138] Embodiment 4

[0139] This example provides enzyme activity detection of the BG knockout strain.

[0140] The BG knockout strain was inoculated into the cellulase fermentation medium and cultured at 50°C and 200 rpm for 7 days. After 7 days of fermentation, the extracellular enzyme solution of the BG knockout strain was taken to detect β-glucosidase and filter paper enzyme activities. On the seventh day, the knockout of cel3a reduced the extracellular β-glucosidase activity from 1.32U / mL of PXK1 to 0.28U / mL, a decrease of 79%, and also increased the filter paper enzyme activity from 5.55U / mL of the PXK1 strain to 6.39U / mL. Figure 6 It can be seen that compared with Δcel3a, the double knockout strain of cel3a and cel3b further reduced the extracellular BG activity while ensuring that the filter paper enzyme activity was not reduced, from 0.222U / mL of Δcel3a to 0.196U / mL on the seventh day, a decrease of 12%.

[0141] Embodiment 5

[0142] This example provides detection of cellobiose production capacity of a BG knockout strain.

[0143] Detection of cellobiose production capacity of single knockout strains:

[0144] Using 10% (w / v) microcrystalline cellulose (MCC) as the substrate, the enzyme solution of the cel3a single knockout strain was added at 5 mg protein / g MCC, and the saccharification experiment was carried out. The results are as follows Figure 6 A and Figure 6 As shown in B, Figure 6 From the composition of the 12-hour glycation products of A, it can be seen that the cellobiose produced by the enzymatic hydrolysis of Δcel3a was significantly increased, from 6.46 mg / mL of PXK1 to 12.72 mg / mL, an increase of 97%.

[0145] Detection of cellobiose production capacity of cel3a and cel3b knockout strains:

[0146] The saccharification experiment was carried out with 10% (w / v) hydrothermal pretreated corn stover as substrate and 6 mg protein / g MCC as enzyme solution. Figure 6 As shown in Figure C, at 12 hours, the cellobiose production of the single knockout strain increased from 8.10 mg / mL of PXK1 to 13.93 mg / mL, and the double knockout strain continued to increase the cellobiose production from 13.93 mg / mL to 14.81 mg / mL on the basis of the single knockout strain, and reduced the glucose production from 3.82 mg / mL to 3.42 mg / mL.

[0147] Matters not covered by the present invention are known technologies.

[0148] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Although the present invention is described in detail with reference to the aforementioned embodiments, those skilled in the art can still modify the technical solutions described in the aforementioned embodiments or replace some of the technical features therein by equivalents. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. A Trichoderma reesei with low β-glucosidase activity and high filter paper enzyme activity, It is characterized in that The Trichoderma reesei PXK1 was used as the starting strain, and the β-glucosidase synthesis gene was knocked out to obtain it; The β-glucosidase synthesis genes are cel3a and cel3b.

2. The Trichoderma reesei having low β-glucosidase activity and high filter paper enzyme activity as claimed in claim 1, It is characterized in that The cel3a gene number is TRIREDRAFT_76672; the cel3b gene number is TRIREDRAFT_121735.

3. The Trichoderma reesei having low β-glucosidase activity and high filter paper enzyme activity as claimed in claim 1, It is characterized in that The Trichoderma reesei PXK1 is obtained by using Trichoderma reesei PX3 which can sustainably activate the cellulase transcription activator as a starting strain and knocking out the ku70 protein through homologous recombination.

4. A method for constructing Trichoderma reesei with low β-glucosidase activity and high filter paper enzyme activity, It is characterized in that It is obtained by activating the cellulase transcription activator in Trichoderma reesei and knocking out one or more genes encoding β-glucosidase.

5. The construction method according to claim 4, It is characterized in that include: 1) constructing a knockout mutant strain PXK1 of Trichoderma reesei ku70 and preparing protoplasts; 2) constructing a plasmid for knocking out the β-glucosidase synthesis gene; the plasmid includes an sgRNA expression cassette targeting the β-glucosidase synthesis gene; 3) Construction of Donor DNA to knock out the β-glucosidase synthesis gene; 4) The plasmid and Donor DNA obtained in step 2) were transformed to a concentration of 5×10 5-7 In PXK1 protoplasts of 100 μg / mL, the amount of plasmid is 1-3 μg, the amount of Donor DNA is 1-3 μg when a single gene is knocked out, and 2-4 μg when two genes are knocked out; 5) Placing the product obtained in step 4) on a mycospore culture medium, and obtaining a target transformant by identifying the mycelial genome.

6. The construction method according to claim 4, It is characterized in that When the β-glucosidase synthesis gene is cel3a, the Donor DNA is amplified by primers 3A-UF / 3A-UR or 3A-DF / 3A-DR to obtain the upstream homology arm and the downstream homology arm of the Trichoderma reesei PX3 genome respectively; or, when the β-glucosidase synthesis genes are cel3a and cel3b, the Donor DNA is amplified by primers 3A-UF / 3A-UR or 3A-D-F2 / 3A-DR to obtain the upstream homology arm and the downstream homology arm of the cel3a gene respectively, and the Donor DNA is amplified by primers 3B-UF / 3B-UR or 3B-D-F2 / 3B-DR to obtain the upstream homology arm and the downstream homology arm of the cel3b gene respectively; The nucleotide sequence of primer 3A-UF is shown in SEQ ID NO.35; the nucleotide sequence of primer 3A-UR is shown in SEQ ID NO.36; the nucleotide sequence of primer 3A-DF is shown in SEQ ID NO.37; the nucleotide sequence of primer 3A-DR is shown in SEQ ID NO.38; the nucleotide sequence of primer 3A-D-F2 is shown in SEQ ID NO.47; the nucleotide sequence of primer 3B-UF is shown in SEQ ID NO.50; the nucleotide sequence of primer 3B-UR is shown in SEQ ID NO.51; the nucleotide sequence of primer 3B-D-F2 is shown in SEQ ID NO.52; the nucleotide sequence of primer 3B-DR is shown in SEQ ID NO.

53.

7. The construction method according to claim 5, It is characterized in that The method for constructing the Trichoderma reesei ku70 knockout mutant strain PXK1 comprises the following steps: 1-1) Preparing protoplasts of Trichoderma reesei PX3; 1-2) Construction of knockout vector; 1-3) Primers ku70-UF / R and ku70-DF / R were used to amplify the donor DNA of ku70; 1-4) in 5×10 5-7 1-2 μg Donor DNA and 1.5-3 μg knockout vector were added to the protoplasts of 100 μg / mL. After the protoplasts were transformed, the transformants were picked and placed on the spore medium for growth. The mycelial genome was identified and the Among them, the nucleotide sequences of primers ku70-UF / R and ku70-DF / R are shown as SEQ ID NO.11, SEQ ID NO.12, SEQ ID NO.13, and SEQ ID NO.14, respectively, and the gene knockout vector includes an sgRNA target site targeting ku70.

8. The construction method according to claim 8, It is characterized in that The sgRNA target sequence is shown in SEQ ID NO.

4.

9. Use of Trichoderma reesei with low β-glucosidase activity and high filter paper enzyme activity or the construction method according to claim 4 in any one or more of the following: A1: Application in cellulose degradation; A2: Application in the production of cellobiose; A3: Application in the production of high-activity filter paper enzymes and low-activity β-glucosidase; The high activity is manifested as filter paper enzyme activity of 6.7-8 U / mL after 7-day fermentation in 100-200 mL culture medium, and the low activity is manifested as β-glucosidase activity of 0.1-0.3 U / mL after 7-day fermentation in 100-200 mL culture medium.

10. A method for producing low-activity β-glucosidase, It is characterized in that The method is obtained by fermentation using the Trichoderma reesei having low β-glucosidase activity and high filter paper enzyme activity as claimed in claim 1.

Images